RESEARCH ARTICLE Analyses of phylogenetics, starch granule morphology and consumer preference of Canna indica L. grown in Sri Lanka R.W.K.M. Senevirathna, L.T. Ranaweera, N.D.U.S. Nakandala, H.M.T.N. Senavirathna, W.M.D.A. Wijesundara, H.S.M. Jayarathne, C.K. Weebadde and S.D.S.S. Sooriyapathirana Highlights • The sequence polymorphism of the atpB gene differentiates Canna indica (Arrowroot/Buthsarana) from ornamental Canna spp. • Canna indica has the significantly large starch granules compared to those of Xanthosoma sagittifolium, Manihot esculenta, Solanum tuberosum, and Ipomoea batatas. • Canna indica has unique scallop-seashell shaped starch granules. • The cooked Canna indica tubers are accepted, better than those of Xanthosoma sagittifolium, and rated equally to Solanum tuberosum, and Manihot esculenta. Ceylon Journal of Science 49(3) 2020: 261-273 DOI: http://doi.org/10.4038/cjs.v49i3.7777 RESEARCH ARTICLE Analyses of phylogenetics, starch granule morphology and consumer preference of Canna indica L. grown in Sri Lanka R.W.K.M. Senevirathna1, L.T. Ranaweera1, N.D.U.S. Nakandala1, H.M.T.N. Senavirathna1, W.M.D.A. Wijesundara1, H.S.M. Jayarathne1, C.K. Weebadde2 and S.D.S.S. Sooriyapathirana1,3,* 1 Department of Molecular Biology and Biotechnology, Faculty of Science, University of Peradeniya, Peradeniya, Sri Lanka. 2 Department of Plant, Soil and Microbial Sciences, College of Agriculture and Natural Resources, Michigan State University, East Lansing, 48824, USA. 3 Postgraduate Institute of Science, University of Peradeniya, Peradeniya, Sri Lanka. Received: 22/05/2019; Accepted: 29/06/2020 Abstract: Canna indica is a tuber crop which has many medicinal values. In Sri Lanka, C. indica tubers are consumed in rural areas and mainly available in street-markets of NuwaraEliya and Kandy Districts. In the present study, we assessed the phylogenetics of C. indica, starch granule morphology and consumer preference of C. indica tubers in comparison to the popular tuber crops. The phylogenetic analysis was conducted based on the sequence polymorphism at rbcL, atpB gene, trnLtrnF and trnH-psbA marker-loci with respect to the ornamental Canna spp. in Sri Lanka and the previously published sequences of Canna spp. The starch granules were isolated and observed under optical and scanning electron microscopes. The diameter and the surface area of the starch granules were measured under the optical microscope and subjected to analysis of variance. As C. indica tubers are consumed as boiled tuber pieces in Sri Lanka, the consumer preference analysis was conducted using the boiled tuber pieces C. indica, Xanthosoma sagittifolium, Manihot esculenta, Solanum tuberosum, and Ipomoea batatas. The phylogenetic tree based on rbcL marker revealed that C. indica in Sri Lanka is slightly divergent from the other Canna spp. Only the polymorphism of the atpB gene can be used to differentiate C. indica from the ornamental Canna sp. in Sri Lanka. The morphological analysis of starch granules revealed that C. indica has the biggest scallop-seashell shaped starch granules compared to other tuber species. The boiled C. indica tubers were accepted better than that of X. sagittifolium, rated equally to the tubers of S. tuberosum and M. esculenta, and rated less than I. batatas. The hardy and fibrous nature of C. indica tubers must be the major limiting factors for achieving the highest consumer preference highlighting the need of breeding for better texture in tubers. Keywords: Devkali, Indian-shot, Large starch granules in plants, Ornamental Canna spp., Underutilized tuber crops. INTRODUCTION Canna indica of family Cannaceae is considered as one of the traditionally used tuber crops in the world (Prince, 2010). The vernacular names of C. indica are Indian-Shot in English, Arrowroot in Africa, Achira in Latin America, Devkali in India, Buthsarana in Sinhala, and Ampurut Alai in Tamil (Bachheti et al., 2013). It is believed that C. indica was originated in Latin America (Andrade-Mahecha et al., 2012) and later naturalized in many countries including Sri Lanka (Olango et al., 2013; Gunarathna et al., 2016). The rhizome is the edible part of the plant and all parts of the plant contain medicinal values including antioxidant property (Mahesh et al., 2014; Joshi et al., 2009a), HIV reverse transcription inhibitory activity (Woradulayapinij et al., 2005), antidiarrheal, hemostatic, hepatoprotective, antibacterial and antiworming effects (Rahmatullah et al., 2010; Josephine et al., 2013; Lin et al., 2011; Joshi et al., 2009b; Anisuzzaman et al., 2007; Indrayan et al., 2011; Thepouyporn et al., 2012; Abdullah et al., 2012; Nirmal et al., 2007). The tubers of C. indica are a common commodity in ayurvedic herbal medical preparations (Kankanamalage et al., 2014). Although C. indica possesses significant medicinal and food values, it is currently an underutilized tuber crop in Sri Lanka (Malkanthi, 2017). The tubers of C. indica rarely appear in the country-wide market. The younger generation who generally appreciate fast food and limited array of choices, even do not know that C. indica tuber is a human food. However, C. indica is fast growing (Zhang et al., 2008) with an excellent ornamental value (Zhang et al., 2008) and recently being identified as one of the best species for the phytoremediation of the polluted water released from reverse osmosis process of the water purification units in Sri Lanka (Gunarathna et al., 2016). It is believed that C. indica contains the largest starch granules ever known (Hermann et al., 1997) thus, can be used as a candidate species to broaden our knowledge on starch science and technology. In Sri Lanka, C. indica is grown in lowland plains (30 – 200 m above sea level) of Sri Lanka without much attention. However, C. indica plants thrive well in the central highlands of Sri Lanka (500 m above mean sea level, 2000 mm annual rainfall and 23-26 0C of mean temperature) and grow as large dense bushes where suckers keep coming from the mother plants. The tubers can be harvested for human *Corresponding Author’s Email: sunethuop@gmail.com http://orcid.org/0000-0002-5592-1742 This article is published under the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 262 Ceylon Journal of Science 49(3) 2020: 261-273 consumption after six months of planting. There are slight variations in leaf size, leaf margin and plant height exist among the C. indica populations found in different habitats. However, when suckers from one location is planted in a different habitat, these variations get changed based on the soil fertility and moisture content. However, the genetic diversity or the exact species delimits of the C. indica have not been studied in Sri Lanka. In addition to the edible C. indica, there are ornamental Canna plants which can produce attractive flowers and foliage grown in many places of the country. The species differences between edible C. indica (i.e. Arrowroot) and the ornamental Canna spp. have not been studied to date. The extensive multidisciplinary research attempts are needed to uplift C. indica from its current underutilized status. Also, the taste and other sensory attributes of C. indica in comparison to the popular tuber crops must be studied. Therefore, the present study was conducted to assess the species delimits and phylogenetic relationships, starch granule morphology, and consumer preference of C. indica in Sri Lanka. MATERIALS AND METHODS DNA extraction, PCR and DNA sequencing The DNA was extracted from the immature leaves of C. indica, plants collected from Kundasale, Matale, Nuwara-Eliya, Peradeniya (7°16’42.2”N 80°40’33.7”E, 7°27’29.7”N 80°36’31.3”E, 6°52’53.7”N 80°48’55.5”E, 7°16’01.1”N 80°36’23.2”E) and ornamental Canna spp. plants in Kandy, (7°15’26.8”N 80°35’08.9”E) using modified cetyltrimethylammonium bromide (CTAB) method (Porebski et al., 1997). The extracted DNA samples were stored at -20 °C. The PCR was performed in a Thermal Cycler (TP600: Takara, Otsu Shiga, Japan) using four DNA barcoding markers given in Table 1. Each PCR was performed in a 30 µl reaction mixture with 2× Go Taq Green Master Mix (15 µl), 10µM forward and reverse primers (1 µl each) and 10 µM spermidine (7 µl). The PCR products were resolved in 2.5% agarose gel electrophoresis (Sambrook and Russell, 2001). The PCR amplicons of the four DNA markers were purified using QIAquick® PCR purification kit (Catalog No.: 28104, Qiagen, Hilden, Germany) and sequenced using ABI 3500 Automated Phylogenetic analysis The initial and end noises of the sequencing data obtained from four DNA markers (Table 1) were observed independently using MEGA 7 (Kumar et al., 2016). Then the identities of the trimmed sequences were confirmed independently by subjecting to a search in Basic Local Alignment Search Tool (BLAST). We created separate alignments for each marker in MEGA 7. In order to relax the family Cannaceae topology, we did not use phylogenetically distant outgroup, or a too closely related one. Thus, we used two species from family Commelinaceae as outgroups which can also be found in the Commelinids clade where family Cannaceae is located. To compare the Canna spp. Sri Lanka, the sequences generated were aligned for the marker, rbcL, with the dataset generated in Prince, (2010) (Table 2). A model selection analysis in Jmodel test (Posada, 2008) was implemented to infer the best nucleotide substitution process of the dataset. A phylogeny was constructed in Maximum Likelihood framework in RAxML (Stamatakis, 2006). We implemented rapid+boostrap algorithm with 1000 iterations and GTRGAMMA as the nucleotide substitution model. The analysis was implemented in the CIPRES supercomputer (Miller et al., 2010). We also carried out a tree search in the Bayesian framework in MrBays (Huelsenbeck and Ronquist, 2001) in CIPRES science gateway. Two hot and cold chains of Markov Chain Monte Carlo (MCMC) running for 30 million generations were used to probe trees in the tree-space. The 10% of the initial trees were removed as burn-in, and the rest of the probed trees were used to draw the final 50% majority rule consensus tree. The Effective Sample Size (ESS) of all the priors used were checked in TRACER v1. 4 (Rambaut and Drummond, 2007). To check the intra species variability of the Sri Lankan Canna spp., UPGMA trees were constructed for the markers, using uncorrected pairwise genetic distance matrices. The gaps (INDELS) were considered as pairwise deletions and considered uniformed rates across all the states. The trees were constructed in MEGA7. Finally, all the drawn trees were modified using FigTree v1.4.3 (Rambaut, 2014). Sequencer (Catalog No.: 622-0010, Applied Biosystem). All the sequences generated were submitted to the Genbank under the accession numbers: MK952702-MK952733. Table 1: DNA barcoding markers used in the present study. DNA marker Primer sequence trnH-psbA F: CGCGCATGGTGGATTCACAATCC rbcL trnL-trnF atpB gene R: GTTATGCATGAACGTAATGCTC F: ATGTCACCACAAACAGAGACTAAAGC R: GTAAAATCAAGTCCACCRCG F: CGA AAT CGG TAG ACG CTA CG R: ATT TGA ACT GGT GAC ACG AG F: TATGAGAATCAATCCTACTACTTCT R: TCAGTACACAAAGATTTAAGGTCAT Annealing Reference temperature (ºC) 64 Tate and Simpson, (2003) 50 Sang et al., (1997) Levin et al., (2003) Kress et al., (2009) Taberlet et al., (1991) 55 Hoot et al., (1995) 55 263 R.W.K.M. Senevirathna et al. Table 2: Metadata of the sequences used in the phylogenetic analysis. Species trnH-psbA GenBank accession numbers atpB gene rbcL trnL-trnF Voucher No. C. indica (Kundasale: arrowroot) C. indica (Matale: arrowroot) DMB115 DMB116 MK952726 MK952727 MK952710 MK952711 MK952702 MK952703 MK952718 MK952719 C. indica (Ambewela: arrowroot) DMB117 MK952728 MK952712 MK952704 MK952720 C. indica (Nuwara-Eliya: arrowroot) DMB118 MK952729 MK952713 MK952705 MK952721 C. indica (Peradeniya: arrowroot) DMB119 MK952730 MK952714 MK952706 MK952722 C. indica (Kandy: ornamental red) DMB120 MK952731 MK952715 MK952707 MK952723 C. indica (Kandy: ornamental yellow) DMB121 MK952732 MK952716 MK952708 MK952724 C. indica (Kandy:ornamental orange) DMB122 MK952733 MK952717 MK952709 MK952725 C. flaccida Siebert_1403 FJ861136 C. glauca Prince_1995 239 AF378774 C. indica Kress_89 2849 AF378763 C. indica Godfrey_60501 FJ861135 C. indica Duke_88 124 FJ861130 C. indica Duke_66 314 FJ861131 C. indica Prince_1995 210 FJ861132 C. iridiflora Plowman Davis_4753 FJ861134 C. jaegeriana Kress_89 2884 FJ861133 C. paniculata Plowman Kennedy 5700 AY656132 C. tuerckheimii Kress_89 2853 AF378764 C. tuerckheimii Duke_85 034 FJ861129 Costus pulverulentus Duke_GH_86 043 AY656108 Dimerocostus strobilaceus Kress_94 3601 AF243838 Tapeinochilos ananassae Kress_90 2984 AF243840 Heliconia irrasa Kress_76 519 AF378778 Heliconia rostrata Duke_GH_81 030 AF378767 Orchidantha fimbriata Kress_87 2159 AF243841 Orchidantha siamensis Kress_94 3718 AF378771 Haumania sp DJ_Harris_6672 AY656119 Sarcophrynium brachystachys Kress_01 7007 AY656126 Ensete ventricosum Kress_96 5372 AF243843 Musa ornata Duke_GH_88 110 AF378779 Musella lasiocarpa Kress_94 3709 AF243844 Phenakospermum guyannense Kress_86 2099D AF243845 Ravenala madagascariensis Kress_92 3504 FJ861128 Strelitzia nicolai Duke_GH_78 044D AF243846 Globba curtissii Kress_99 6247 AF243847 Siphonochilus kirkii Kress_94 3692 FJ861127 Anigozanthos sp Prince_2003 499 FJ861123 Cartonema philydroides - FJ861121 Hanguana sp Kress_99 6325 FJ861125 Helmholtzia glaberrima Prince_2003 007 FJ861124 Palisota ambigua Faden_86/55 FJ861122 Dyckia marnier-lapostollei T._World_97686 FJ861120 264 Assessment of the starch granules The starch granule morphology of C. indica was assessed in comparison to the starch granules of well-known tuber crops in Sri Lanka; Xanthosoma sagittifolium, Manihot esculenta, Solanum tuberosum, Ipomoea batatas purpletuber, and I. batatas yellow-tuber. The healthy tubers at the right maturity stage for harvesting were collected from all six species. Isolation of starch Ceylon Journal of Science 49(3) 2020: 261-273 staining purpose. The observations and the analysis of tissues were done by using the Zeiss scanning electron microscope (SEM) (Jeol SEM 6400, Tokyo, Japan). The images were taken using same magnification, ×1000, as in optical microscope to illustrate the arrangement of starch granules inside the cells. The same procedure was carried out to capture the images of extracted starch granules. Here, instead of tissues, extracted starch granules of all of the tuber types were used to capture the images and, the magnification was adjusted to ×2000 for better resolution. The starch was isolated from each species using the modified protocols explained in Alves et al., (1999) and De Pater et al., (2006). The tubers were thoroughly washed, peeled and chopped into small pieces. The chopped pieces were homogenized using a solution containing 0.075% sodium bisulfate to avoid the browning. The homogenateslurry was then filtered to eliminate the impurities and fiber. Then the filtrate was allowed to settle for three hours. The supernatant was discarded and the sediment was resuspended in about five volumes of distilled water for further purification. The starch was allowed to settle for 30 minutes. The procedure of decanting the supernatant and re-suspending the sediment in water was repeated for three to four more times to make sure that the extracted starch was completely free of impurities. Finally the starch was allowed to settle for one hour followed by treating with a solution containing 0.1% NaOH. This step was carried out to reduce the effects of non-starch polysaccharides which may greatly interfere with starch isolation procedure by retaining the smaller granules in the remaining fibrous matrix. A magnetic stirrer was used to stir the viscous solution. The extracted starch was then washed with distilled water to remove the excess NaOH and allowed to dry overnight at room temperature. The resulting starch was stored at -20 °C. Assessment of the consumer preference on boiled tubers Starch granule observation under optical microscopy (OM) RESULTS AND DISCUSSION A few drops of starch granule suspension of each type of tuber were treated with iodine and observed under the optical microscope at ×1000 magnification. As a control, the same observations were made by using starch granule suspensions without treating with iodine. An optical microscope (Carl Zeiss Microscopy GmbH, SN 3150000610) equipped with the camera Zeiss AxioCam ICc 5 was used for the observations, and the captured photos were analyzed using the image analysis software, Zen lite 2.1. The diameter and the cross-sectional area of 20 starch granules were measured for each type of tuber assessed. The data were subjected to ANOVA procedure using the statistical package SAS 9.4 (SAS Institute, NC, Cary, USA). Starch granule observation under scanning electron microscopy (SEM) The freshly harvested tubers from each of the six species were used to obtain tissue samples. The tissues were subjected to the vacuum for about 15 min. The vacuumdried tissue samples were mounted on stubs with carbon tabs. The tissue samples were exposed to gold particles for The fresh and healthy tubers at the right maturity stage were collected from all six species. The tubers were peeled, washed thoroughly, cut into approximately 3 cm x 3 cm pieces, and boiled in water for 20 mins. The water was filtered out, and the salt was added to ascertain the generally preferred taste. A taste panel of 40 human subjects was employed representing randomly selected equal proportions of males and females in the age range of 18 - 65 years. The required instructions were provided to the panelists before the assessment. Each panelist was given 40 g of boiled tuber pieces of each tuber type for tasting. The panelists were requested to taste and rank the tubers for seven sensory attributes; color, aroma, texture, bitterness, fibrous nature, hardness, and overall taste according to a three-tier scoring system. Score “1” was assigned for the least preferred level. Score “2” was assigned for medium preferred level and Score “3” was assigned for the highest preferred level. The care was taken to refresh the palates of each panelist by providing water in between the tasting each tuber dish (Leighton et al., 2010). The ranked data generated by the taste panel were subjected to association analysis using FREQ procedure in SAS. Morphology of C. indica Canna indica is a perennial herb that grows up to 1-3 m in height at flowering stage (Figure 1). The newly emerged rhizome (Figure 1A) is elliptical in shape and covered with whitish scale leaves. The interior of the newly emerged rhizome is cream-white to ivory in color (Figuers1B and 1C). The fully-grown rhizome is irregular shaped, monopodial or sympodial, stoloniferous or tuberous, branched and also covered with scale leaves where the distal part of the scale leaves are blackish-brown, and proximal parts are whitish-yellow (Figure 1D). However, at maturity, the external color of the rhizome is brown. The root system of C. indica consists of an excessively branched network of fibrous roots. The roots do not go deep into the soil; however, forms a mat within 30 cm of soil depth (Figure 1E). The roots are cylindrical and thick with numerous hairs. The color of the roots is creamy white (Figure 1E). As C. indica has a rhizome, the roots are adventitious in nature. When rhizomes are separated from the mother plant or in case where mother plant is dead, sprouting of rhizomes happen immediately upon touching with moist soils (Figure 1F). After two weeks, 265 R.W.K.M. Senevirathna et al. the shoot gets elongated up to 5 - 15 cm. At this stage, no roots are apparent. In the next three to four weeks, the shoot is extending further, and roots start to grow (Figure 1G). Within another week or so, the first leaf is unfolding and continuing to produce new leaves sequentially (Figure 1H). The plant remains in the vegetative stage for four months and then starts flowering. A potted C. indica plant at its fully grown vegetative stage is shown in Figure 1I. The stem is a pseudo stem covered with sheathing leaves. They are erect, herbaceous and cylindrical (Figure 1I). Appearance of the leaves is somewhat similar to the banana leaves; however, the size is less as C. indica leaves are 15 – 20 cm wide and 20 – 50 cm long. The leaf shape is more or less ovate. The leaf lamina is dark green with purplish brown margins. Moreover, the leaf lamina is parallel veined and has smooth and wavy margins. The leaf apex is acute (Figures 1J and 1K). Red, solitary flowers are normally 1 cm to 2 cm long and sepals are also having the same length range. In flowers, the reddish-brown coral tube is a prominent character. The flowers are hermaphrodite (Figure 1L). The fruits are spiny, 2 cm to 3 cm long structures consisting of green capsules (Figure 1L). The seeds are 5 – 6 mm long, 2 – 3 mm wide and white color at the initial stage, and black color at the maturity stage (Rao and Donde, 1955). A cultivated C. indica which appears as a bush at five months of age is shown in Figure 1M. Figures 1N and 1O show two C. indica plants grown in a natural habitat and an infertile land, respectively. Phylogenetics of C. indica The best substitution model for combined datasets of Prince, (2010) and the Canna spp. in Sri Lanka is TPM3uf+I+G (A/ C=2.100; A/G=8.260; A/T=1.000; C/G=2.100; C/T=8.260; G/T=1.000). The maxmum convergence for the MCMC tree is at 20 millon chain runs and the ESS value for each prior is above 200. Almost similer branching pattern is obtained for the trees constructed in the baysin and ML frameworks. However, the ML tree resolves the best, thus presented in this study (Figure 2). The Canna spp. in Sri Lanka are separately clustered in the Cannaceae clade of the phylogram (Figure 2A). However, the phylogenetic relationships of the Cannaceae clade in this phylogeny are poorly resolved with few polytomic relationships. This has also been described in the Prince, (2010), where they concluded that plastid markers failed to resolve the correct phylogenetic relationships within the Cannaceae family. The nucleotide variation is recognized in the selected loci of the chloroplast genome of C. indica and ornamental Canna spp. (Figures 2B, 2C and 2D). Out of the two coding and two non-coding markers employed in the present study, only rbcL, atpB gene and trnH-psbA can be effectively employed to identify the nucleotide polymorphism and thereby to designate the species in respective clusters within a UPGMA tree. The marker trnL-trnF is monomorphic for all the samples sequenced. The informative substitutions in the atpB gene are detected; thus an enhanced separation is obtained in the phylogeny (Figure 2B). Accordingly, five edible Canna spp. are cladded in the same cluster. Remarkably, the point mutation (A/C) at the 2nd position in atpB gene is sufficient to ascertain the variance between the ornamental Canna spp. from the edible Canna spp. with a genetic divergence of 0.0008. However, the ornamental Canna sp. (red flower bearing) is diverged out from the clade which contains the other two ornamental Canna spp. (yellow and orange flower bearing). This might be attributed to the synonymous mutations at 1417th and 1418th positions in the atpB gene. Furthermore, five transversions (C/G, C/A, T/G) and one unique transition (A/G) within the trnH-psbA region are detected. C. indica (Kundasale, Matale and NuwaraEliya) are grouped into one clade with a unique haplotype, thus clearly differentiating them from ornamental Canna sp. (yellow) with a genetic divergence of 0.0014. The clade containing C. indica (Nuwara-Eliya) and ornamental Canna sp. (red) is distinguishable from C. indica (Peradeniya) with a genetic divergence of 0.0014. The ornamental Canna sp. (orange) can be considered as the most evolutionary diverged group, by relying predominantly on the SNP variation in trnH-psbA locus (Figure 2D). Moreover, synonymous mutations are identified in the rbcL region. Consequently, C. indica (Matale, and Nuwara-Eliya) and ornamental Canna sp. (red) are nested in the same clade while C. indica (Nuwara-Eliya), ornamental Canna spp., yellow and orange, are cladded together. Similarly, C. indica (Kundasale and Peradeniya) are fallen within the same clade with a 0.0018 genetic divergence (Figure 2C). Based on the results, it can be suggested that the usefulness of the two loci; trnH-psbA and rbcL, in discriminating the ornamental and edible Canna species is less, compared with the informativeness of atpB gene. The ornamental Canna spp. are also identified as C. iridiflora and C. jaegeriana in the published literature (Prince, 2010; Tanaka et al., 2009). However, in the present study for rbcL and trnHpsbA, the ornamental Canna spp. do not show any clear separation from C. indica (edible Arrow-root) indicating that ornamental Canna spp. could also come under C. indica. conflicting with the nomenclature provided in (Prince, 2010; Tanaka et al., 2009) (Figures 2C and 2D). The ornamental Canna spp. and C. indica are clearly separated by the polymorphism at the atpB gene (Figure 2B) highlighting the possible speciation or sub speciation which requires further studies. Morphological variability of starch granules The variability of the size of the starch granules are given in the Table 3. The results revealed that the granule size and the shape are highly variable among the tuber crops studied. C. indica starch granules are significantly larger than the granules of the other popular starch crops studied for the comparison purpose. The mean diameter and the mean cross-sectional area of the starch granules are 53.72 µm of 2180.46 µm2 respectively for C. indica and they are the largest reported values for the six species studied (P<0.05). The microscopic analysis of the starch granules in the present study further verifies the past observations reporting that C. indica has large starch granules (Hermann et al., 1997). The smallest size of the starch granules is observed in I. batatas (purple) (mean diameter: 10.56 µm, cross sectional area: 91.44 µm2) (P<0.05). The appearance of starch granules under the OM and SEM are presented in 266 Ceylon Journal of Science 49(3) 2020: 261-273 Figure 1: Morphological appearance of the whole plant and the different parts of C. indica plant. A: Newly emerged rhizome; B: Cross section of the newly emerged rhizome; C: Longitudinal section of the newly emerged rhizome; D: Fully grown rhizome at the harvesting stage (economically important part); E: Root system with sprouting rhizomes; F: Close-up view of sprouting rhizome; G: Rhizome sprouted fully and ready to produce leaves; H: Sprouted rhizome with the first leaf; I: C. india plant in a pot (a poly bag); J: Adaxial view of a fully grown leaf; K: Abaxial view of the fully grown leaf; L: Flower and fruit; M: A cultivated bush of C. indica; N: C. indica plant naturally grown; O: C. indica plant grown in an infertile land. Figure 3. A pronounced difference in the shape of the starch granules is observed in C. indica. The shape is like a shell of a bivalve with curve-like patterns (scallop-seashell shaped) throughout the surface when viewed under OM (Figure 3A1; 3A2). The granules displayed a disk shape with a smooth surface under SEM (Figure 3A3) and the similar results have previously been reported by Jane et al., (1994). However, within the tissue, the cells contain much smaller number of starch granules in C. indica in comparison to the other tuber crops studied (Figure 3A4). According to the SEM images and the surface area measurements under OM, the highest surface area is recorded for C. indica. Several other studies also have reported the same observation (Wickramasinghe et al., 2009, Piyachomkwan et al., 2002, Hung and Morita, 2005, Cisneros et al., 2009). Moreover, the high viscosity and the ability to make a clear paste of C. indica starch make it a good candidate as a thickening agent (Andrade-Mahecha et al., 2012). R.W.K.M. Senevirathna et al. 267 Figure 2: Phylogenetic structure of Canna spp. in Sri Lanka. A: rbcL phylogram showing the phylogenetic position of Canna spp. inhabited in Sri Lanka; B: UPGMA tree drawn for atpB gene; C: UPGMA tree drawn for rbcL; D: UPGMA tree drawn for trnH-psbA. 268 Ceylon Journal of Science 49(3) 2020: 261-273 Figure 3: Morphological variability of starch granules in root and tuber crops, observed under the optical microscope and scanning electron microscope. A: Canna indica; B: Xanthosoma sagittifolium; C: Manihot esculenta; D; Solanum tuberosum; E: Ipomoea batatas-purple; F: Ipomoea batatas-yellow. 1: Optical microscopic photographs of granules isolated from the tissue and stained with iodine; 2: Optical microscopic photographs of granules isolated from the tissue and not stained; 3: Scanning electron microscopic photographs of granules isolated from the tissue (Magnification: ×2K); 4: Scanning electronic microscopic photographs of granules present within the tissue; (Magnification: ×1K). 269 R.W.K.M. Senevirathna et al. Table 3: Variation of the average diameter and the cross sectional area of the starch granules. Mean diameter Mean surface (µm) Area (µm2) Canna indica 53.72a 2180.46a Solanum tuberosum 14.55c 148.26c Xanthosoma sagittifolium 15.82c 235.28b Manihot esculenta 19.86b 322.47b Ipomoea batatas-yellow 20.01b 313.99b Ipomoea batatas-purple 10.56d 91.44d Species Means denoted by the same letters within the column are not significantly different at P<0.05. Figure 4: The boiled tuber pieces of the six species used for the taste panel analysis. A: Canna indica; B: Xanthosoma sagittifolium;C: Manihot esculenta; D; Solanum tuberosum; E; Ipomoea batatas (purple); F: Ipomoea batatas (yellow). In contrast, X. sagittifolium is found to possess a significantly high number of starch granules within the tissue with irregular shapes (Figure 3B1; 3B2; 3B3; 3B4). The granules observed under the OM reveals that those of the I. batatas (yellow) and I. batatas (purple) are similar in morphology with a polygonal shape (Figures 3E1; 3E2; 3F1; 3F2). The exception is being M. esculenta and S. tuberosum which appears to be having a mixture of shapes (Figures 3C1; 3C2; 3D1; 3D2 respectively). The OM photographs show that some of the S. tuberosum granules are oval shaped whereas the others are elliptical (Figures 3D1; 3D2) while SEM displays disk and oval shaped S. tuberosum granules (Figure 3D3). The cells of I. batatas are observed with spherical and irregular shapes of granules (Figure 3E3; 3F3) and fairly a high number of granules when viewed under the SEM (Figures 3E4; 3F4). However, M. esculenta granules possess both spherical and irregular shapes (Figure 3C3). As shown by SEM image, the number of granules within the tissues of M. esculenta is higher than that of C. indica, however, less than that of X. sagittifolium (Figure 3C4). Moreover, S. tuberosum displays relatively a smaller number of starch granules within the tissue, nevertheless a high number of granules compared to C. indica. Consumer preference The representative samples of the boiled tubers prepared for the taste panel are shown in Figure 4. The boiled tubers of C. indica are brown in color (Figure 4A) compared to other tubers boiled. All the taste parameters assessed except bitterness are significantly associated with the type of tuber (i.e., tuber species) (Figure 5, P<0.05). The strongest association is detected between the type of tuber and the preferred color (Figure 5A). The highest preferred color is recorded for I. batatas (yellow) (88%) and S. tuberosum (68%). The color of C. indica, M. esculenta and I. batatas (purple) are equally preferred (15-18%). It is interesting to note that the color of C. indica is preferred more than that of X. sagittifolium which is a more popular tuber crop than C. indica. The highest preferred aroma is observed for I. batatas (yellow) (28%) followed by S. tuberosum (15%). The respondents equally rank C. indica and M. esculenta for the preferred level of aroma (Figure 5B). The highest preferred texture is reported for the two types of I. batatas; however, the texture of C. indica is preferred more than X. sagittifolium (Figure 5C). The bitterness felt is low for all the tuber types assessed; however, 10 % of the respondents rank the highest felt bitterness for C. indica tubers (Figure 5D). The highest felt fibrousness is observed for C. indica 270 Ceylon Journal of Science 49(3) 2020: 261-273 Figure 5: The associations between the taste parameters and six tube crop species studied. Y-axis represent the percentage (%) respondents. The % respondents for each category of association is given within the bars. R.W.K.M. Senevirathna et al. (73%) followed by I. Batatas (purple) (21%) (Figure 5E). The highest felt hardness is also reported for C. indica. The felt hardness is found be the least for S. tuberosum and I. batatas (yellow). The tubers of X. sagittifolium and M. esculenta are ranked as the hardest by 25% and 20% respondents respectively (Figure 5F). In the ranking of tubers for overall taste, 70% and 50% of the respondents said they highly prefer the taste of I. batatas (yellow) and I. batatas (purple) respectively. Interestingly, C. indica and M. esculenta get equal ranks for the overall taste (Figure 5G). The association analysis based on the taste panel data provided important insights on the potentials of C. indica tubers and the avenues for the crop improvement. It is evident from the analysis that consumers prefer yellow color in boiled tubes but the color of C. indica is not entirely rejected. The color of C. indica accepted better than that of X. sagittifolium. The highest fibrousness and the hardness could be the reasons for the less preference for the tubers of C. indica. However, when considering the overall taste, C. indica gets equally ranked to the highest levels as the two of the world famous and established tuber crops, S. tuberosum and M. esculenta (Figure 5G). Thus, improving the tuber properties; softness and less fibrousness, through breeding and selection will undoubtedly uplift C. indica from its current underutilized status. CONCLUSIONS The phylogenetic tree constructed based on rbcL marker revealed that C. indica is slightly divergent from the other Canna species in the world. The polymorphism of the atpB gene can be used to differentiate C. indica from ornamental Canna spp. The polymorphism of rbcL and trnH-psbA cannot be used to differentiate C. indica from the rest. The starch granules morphological analysis revealed that C. indica has the significantly large (scallop-seashell shaped) starch granules compared to Xanthosoma sagittifolium, Manihot esculenta, Solanum tuberosum, and Ipomoea batatas. The consumer preference analysis indicates that boiled C. indica tubers are accepted better than that of X. sagittifolium. The C. indica tubers rate equally to the tubers of Solanum tuberosum, and M. esculenta. The relatively hardy fibrous nature of the tubers of C. indica is the major limiting factor for achieving the highest consumer preference. The breeding programs on C. indica must be planned to achieve softer and less fibrous tubers for higher appetite. ACKNOWLEDGEMENTS The authors wish to thank Departments of Geology and Zoology of the Faculty of Science of University of Peradeniya, Sri Lanka for kindly providing electron microscopic and light microscopic facilities. STATEMENT OF CONFLICT OF INTEREST The authors declare no conflict of interest. REFERENCES Abdullah, E., Ahmad Raus, R. and Jamal, P. (2012). Extraction and evaluation of antibacterial activity from 271 selected flowering plants. American Medical Journal 3(1): 27-32. Alves, R.M.L., Grossmann, M.V.E. and Silva, R.S.S.F. (1999). Gelling properties of extruded yam (Dioscorea alata) starch. Food Chemistry 67(2): 123-127. Andrade-Mahecha, M.M., Tapia Blácido, D.R. and Menegalli, F.C. (2012). Physical-chemical, thermal, and functional properties of achira (Canna indica L.) flour and starch from different geographical origin. Starch Stärke 64(5): 348-358. Anisuzzaman, M., Rahman, A.H.M.M., Harun-Or-Rashid, M., Naderuzzaman, A.T.M. and Islam, A.K.M.R. (2007). An ethnobotanical study of Madhupur, Tangail. Journal of Applied Sciences Research 3(7): 519-530. Bachheti, R.K., Rawat, G.S., Joshi, A. and Pandey, D.P. (2013). Phytochemical investigation of aerial parts of Canna indica collected from Uttarakhand India. International Journal of PharmTech Research 5(2): 294-300. Cisneros, F. H., Zevillanos, R. and Cisneros-Zevillanos, L. (2009). Characterization of Starch from two Ecotypes of Andean Achira Roots (Canna edulis). Journal of Agricultural and Food Chemistry 57: 7363-7368. De Pater, S., Caspers, M., Kottenhagen, M., Meima, H., Ter Stege, R. and De Vetten, N. (2006). Manipulation of starch granule size distribution in potato tubers by modulation of plastid division. Plant Biotechnology Journal 4(1): 123-34. Gunarathna, M.H.J.P., Ranasinghe, A.I., Rathnayake, S.C., De Costa, T.K. and Lanka, P. (2016). Can Canna Indica use as a phytoremediation agent in mitigating high pollution concentrations in reverse osmosis concentrate? International Journal of Advances in Agricultural & Environmental Engg 3(1): DOI http:// dx.doi.org/10.15242/IJAAEE.ER0116025. Hermann, M., Quynh, N.K. and Peters, D. (1997). Reappraisal of edible canna as a high-value starch crop in Vietnam. CIP Program Report 98: 415-424. Hoot, S.B., Culham, A. and Crane, P.R. (1995). The utility of atpB gene sequences in resolving phylogenetic relationships: comparison with rbcL and 18S ribosomal DNA sequences in the Lardizabalaceae. Annals of the Missouri Botanical Garden 82: 194-207. Huelsenbeck, J.P. and Ronquist, F. (2001). MrBayes: Bayesian inference of phylogeny. Bioinformatics 17: 754-755. Hung, P. V. and Morita, N. (2005). Physicochemical properties and enzymatic digestibility of starch from edible canna (Canna edulis) grown in Vietnam. Carbohydrate Polymers 61: 314-321. Indrayan, A.K., Bhojak, N.K., Kumar, N., Shatru, A. and Gaur, A. (2011). Chemical composition and antimicrobial activity of the essential oil from the rhizome of Canna indica Linn. Indian Journal of Chemistry 50(8): 1136-1139. Jane, J.L., Kasemsuwan, T., Leas, S., Zobel, H. and Robyt, J.F. (1994). Anthology of starch granule morphology by scanning electron microscopy. Starch-Stärke 46(4): 121-129. Josephine, O.O., Josephine, O.O. and Cosmos, O.T. (2013). Evaluation of the antidiarrhoea activity of the 272 methanolic extract of Canna indica leaf (Cannaceae). International Journal of Pharmaceutical and Chemical Sciences 2(2): 669-674. Joshi, Y.M., Kadam, V.J. and Kaldhone, P.R. (2009a). In vitro antioxidant activity of methanolic extract of aerial parts of Canna indica L. Journal of Pharmacy Research 2(11): 1712-1715. Joshi, Y.M., Kadam, V.J., Patil, Y.V. and Kaldhone, P.R. (2009b). Investigation of Hepatoprotective activity of Aerial Parts of Canna indica L. Journal of Pharmacy Research 2(12): 1879-1882. Kankanamalage, T.N.M., Dharmadasa, R.M., Abeysinghe, D.C. and Wijesekara, R.G.S. (2014). A survey on medicinal materials used in traditional systems of medicine in Sri Lanka. Journal of Ethnopharmacology 155(1): 679-691. Kress, W.J., Erickson, D.L., Jones, F.A., Swenson, N.G. and Perez, R. (2009). Plant DNA barcodes and a community phylogeny of a tropical forest dynamics plot in Panama. Proceedings of National Academy of Sciences of the United States of America 106: 18621-18626. Kumar, S., Stecher, G. and Tamura, K. (2016). MEGA7: Molecular Evolutionary Genetics Analysis version 7.0 for bigger datasets. Molecular Biology and Evolution 33 (7): 1870-1874. Leighton, C.S., Schönfeldt, H.C. and Kruger, R. (2010). Quantitative descriptive sensory analysis of five different cultivars of sweet potato to determine sensory and textural profiles. Journal of Sensory Studies 25(1): 2-18. Levin, R.A., Wagner, W.L. and Hoch, P.C. (2003). Familylevel relationships of Onagraceae based on chloroplast rbcL and ndhF data. American Journal of Botany 90: 107-115. Lin, Z.L., Bai’e, Z.H.A.N.G., Li, H.U.A.N.G., Yun, C.H.E.N. and Chunsheng, F.A.N.G. (2011). Hemostatic Effect of Canna Indica L. Journal of Dali University 10: 12. Mahesh, K.N., Wickramaratne, M.N. and Wickramaratne, D.B.M. (2014). Evaluation of antioxidant activity of five medicinal plants in Sri Lanka. Pharmacognosy Journal 6(3): 49-54. Malkanthi, S.H.P. (2017). Importance of underutilized crops in Thanamalwila Divisional Secretariat Division in Monaragala District in Sri Lanka. Journal of Agricultural Sciences 12(3): 197-206. Miller, M.A., Pfeiffer, W. and Schwartz, T. (2010). Creating the CIPRES Science Gateway for inference of large phylogenetic trees. Gateway Computing Environments Workshop (GCE). Available from: http:// www. ieeexplore.ieee.org/abstract document/5676129 (06 June December 2020). Nirmal, S.A., Shelke, S.M., Gagare, P.B., Jadhav, P.R. and Dethe, P.M. (2007). Antinociceptive and anthelmintic activity of Canna indica. Natural Product Research 21(12): 1042-1047. Olango, T.M., Stadlmayr, B. and Charrondiere, U.R. (2013). Diversity in nutrient composition of underutilised root and tuber crops. Acta Horticulturae 979(979): 147-155 Piyachomkwan, K., Chotineeranat, S., Kijkhunasatian, Ceylon Journal of Science 49(3) 2020: 261-273 C., Tonwitowat, R., Prammanee, S., Oates., C.G. and Sririth, K. (2002) Edible canna (Canna edulis) as a complementary starch source to cassava for the starchindustry. Industrial Crops and Products 16: 1121. Porebski, S. Bailey, L.G. and Baum, B.R. (1997). Modification of a CTAB DNA extraction protocol for plants containing high polysaccharide and polyphenol components. Plant Molecular Biology 15(1): 8-15. Posada, D. (2008). JModelTest: phylogenetic model averaging. Molecular Biology and Evolution 25: 12531256. Prince, L.M. (2010). Phylogenetic relationships and species delimitation in Canna (Cannaceae). Diversity, Phylogeny, and Evolution in the Monocotyledons 307: 331. Rao, V.S. and Donde, N. (1955). The floral anatomy of Canna flaccida. Journal of the University of Bombay 24: 1-10. Rahmatullah, M., Kabir, A.A.B.T., Rahman, M.M., Hossan, M.S., Khatun, Z., Khatun, M.A. and Jahan, R. (2010). Ethnomedicinal practices among a minority group of Christians residing in Mirzapur village of Dinajpur District, Bangladesh. Advances in Natural and Applied Sciences 4(1): 45-51. Rambaut, A. and Drummond, A. (2007). Tracer v1. 4. Available from: http://beast. bio. ed. ac. uk/Tracer (06 June 2020). Rambaut A (2014). FigTree, a graphical viewer of a phylogenetic trees. Available from: http://tree. bio. ed.ac. uk/software/figtree (06 June 2020). Sambrook, J. and Russell, S.W. (2001). Molecular Cloning: A Laboratory Manual. 3. NewYork (NY): Cold Spring Harbor Laboratory Press. Sang, T., Crawford, D.J. and Stuessy, T.F. (1997). Chloroplast DNA phylogeny, reticulate evolution and biogeography of Paeonia (Paeoniaceae). American Journal of Botany 84: 1120-1136. Stamatakis, A. (2006). RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics 22(21): 2688-2690. Taberlet, P., Gelly, L., Pautou, G. and Bouvet, J. (1991). Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Molecular Biology 17(5): 1105-1109. Tanaka, N., Uchiyama, H., Matoba, H. and Koyama, T. (2009). Karyological analysis of the genus Canna (Cannaceae). Plant Systematics and Evolution 280: 4551. Tate, J.A. and Simpson, B.B. (2003). Paraphyly of Tarasa (Malvaceae) and diverse origins of the polyploid species. Systematic Botany 28: 723-737. Thepouyporn, A., Yoosook, C., Chuakul, W., Thirapanmethee, K., Napaswad, C. and Wiwat, C. (2012). Purification and characterization of anti-HIV-1 protein from Canna indica L. leaves. Southeast Asian Journal of Tropical Medicine and Public Health 43(5): 1153. Wickramasinghe, H.A.M., Takigawa, S., Matsuura-Endo, C., Yamauchi, H. and Noda, T. (2009). Comparative analysis of starch properties of different root and tuber R.W.K.M. Senevirathna et al. crops of Sri Lanka. Food Chemistry 112(1): 98-103. Woradulayapinij, W., Soonthornchareonnon, N. and Wiwat, C. (2005). In vitro HIV type 1 reverse transcriptase inhibitory activities of Thai medicinal plants and Canna indica L. rhizomes. Journal of Ethnopharmacology 101(1-3): 84-89. Zhang, Z., Rengel, Z. and Meney, K. (2008). Interactive effects of N and P on growth but not on resource allocation of Canna indica in wetland microcosms. Aquatic Botany 89(3): 317-323. 273