bs_bs_banner Botanical Journal of the Linnean Society, 2014, 174, 601–619. With 3 figures On the systematic position of some Asian enigmatic genera of Asclepiadoideae (Apocynaceae) SIDDHARTHAN SURVESWARAN1, MEI SUN2, GUIDO W. GRIMM3 and SIGRID LIEDE-SCHUMANN FLS4* 1 Centre for Ecological Sciences, Indian Institute of Science, Bangalore 560012, India School of Biological Sciences, The University of Hong Kong, Pokfulam Road, Hong Kong, China 3 Sektionen för Paleobiologi, Naturhistoriska riksmuseet, PO Box 50007, 10405 Stockholm, Sweden 4 Department of Plant Systematics, University of Bayreuth, 94447 Bayreuth, Germany 2 Received 6 May 2013; revised 1 January 2014; accepted for publication 19 January 2014 The phylogenetic structure of Asclepiadoideae (Apocynaceae) has been elucidated at the tribal and subtribal levels in the last two decades. However, to date, the systematic positions of seven Asian genera, Cosmostigma, Graphistemma, Holostemma, Pentasachme, Raphistemma, Seshagiria and Treutlera, have not been investigated. In this study, we examine the evolutionary relationships among these seven small enigmatic Asian genera and clarify their positions in Asclepiadoideae, using a combination of plastid sequences of rbcL, rps16, trnL and trnLF regions. Cosmostigma and Treutlera are resolved as members of the non-Hoya clade of Marsdenieae with strong support (maximum parsimony bootstrap support value BSMP = 96, maximum likelihood bootstrap support value BSML = 98, Bayesian-inferred posterior probability PP = 1.0). Pentasachme is resolved as sister of Stapeliinae to Ceropegieae with moderate support (BSMP = 64, BSML = 66, PP = 0.94). Graphistemma, Holostemma, Raphistemma and Seshagiria are all nested in the Asclepiadeae–Cynanchinae clade (BSMP = 97, BSML = 100, PP = 1.0). The study confirms the generally accepted tribal and subtribal structure of the subfamily. One exception is Eustegia minuta, which is placed here as sister to all Asclepiadeae (BSMP = 58, BSML = 76, PP = 0.99) and not as sister to the Marsdenieae + Ceropegieae clade. The weak support and conflicting position indicate the need for a placement of Eustegia as an independent tribe. In Asclepiadeae, a sister group position of Cynanchinae to the Asclepiadinae + Tylophorinae clade is favoured (BSMP = 84, BSML = 88, PP = 1.0), whereas Schizostephanus is retrieved as unresolved. Oxystelma appears as an early-branching member of Asclepiadinae with weak support (BSMP = 52, BSML = 74, PP = 0.69). Calciphila and Solenostemma are also associated with Asclepiadinae with weak support (BSMP = 37, BSML = 45, PP = 0.79), but all alternative positions are essentially without support. The position of Indian Asclepiadoideae in the family phylogeny is discussed. © 2014 The Linnean Society of London, Botanical Journal of the Linnean Society, 2014, 174, 601–619. ADDITIONAL KEYWORDS: classification – chloroplast DNA – India – phylogeny – rbcL – rps16 – systematics – trnL – trnL-F. INTRODUCTION In Apocynaceae, Asclepiadoideae has been shown to form a monophyletic group, sister to Secamonoideae, from which it differs by the possession of two instead of four pollinia per pollinarium (Livshultz et al., 2011). The tribal and subtribal structure of Asclepiadoideae is generally well understood (e.g. Rapini, Van den Berg & Liede-Schumann, 2007). At present, four *Corresponding author. E-mail: sigrid.liede@uni-bayreuth.de tribes are recognized, with the small Fockeeae (two genera; Endress, Liede-Schumann & Meve, 2007) branching off first (Verhoeven, Liede & Endress, 2003). Marsdenieae (27 genera, Endress et al., 2007) and Ceropegieae (46 genera, Endress et al., 2007), both characterized by erect pollinaria, form a clade sister to Asclepiadeae (91 genera, Endress et al., 2007; Liede-Schumann et al., 2012), with pendent pollinia. The pollinia of Marsdenieae are either devoid of pellucid margins or, if a pellucid margin is present, it is located along the proximal side of the pollinium, © 2014 The Linnean Society of London, Botanical Journal of the Linnean Society, 2014, 174, 601–619 601 602 S. SURVESWARAN ET AL. whereas the pollinia of Ceropegieae have a pellucid margin along the distal side of the pollinium in all species. Only two genera, Eustegia R.Br. and Emicocarpus K.Schum. & Schltr., are considered presently as unassigned to a tribe, and Eustegia has taken conflicting positions in several analyses (compare Liede, 2001 and Rapini et al., 2003, 2007). Emicocarpus, a narrow Mozambique endemic, is a putative close relative of Eustegia as judged from morphology, but it has not been rediscovered in the last decade and might be extinct. Of a total of 168 accepted genera of Asclepiadoideae, 27 have not yet been sequenced and have been assigned to one of the tribes according to pollinium orientation and structure (Endress et al., 2007; Liede-Schumann et al., 2012). Of these, nine are assigned to Marsdenieae based only on morphological characteristics, including Anatropanthus Schltr., Asterostemma Decne., Cosmostigma Wight, Dolichopetalum Tsiang, Heynella Backer, Jasminanthes Blume, Oreosparte Schltr., Pycnorhachis Benth. and Treutlera Hook.f. A subtribal structure has not yet been proposed for Marsdenieae (T. Livshultz et al., unpubl. data) and no hypotheses for the positions of these small genera are presently available. In Ceropegieae, only Pentasachme Wall. ex Wight is insufficiently known. For morphological reasons, it has been assigned to subtribe Leptadeniinae, but this placement has not yet been verified. In Asclepiadeae, nine genera are incompletely known in the Old World, Adelostemma Hook.f., Graphistemma (Champ. ex Benth.) Champ. ex Benth., Holostemma R.Br., Mahawoa Schltr., Merrillanthus Chun & Tsiang, Pentastelma Tsiang & P.T.Li, Raphistemma Wall., Seshagiria Ansari & Hemadri and Sichuania M.G.Gilbert & P.T.Li. In the New World, the positions of Hypolobus E.Fourn., Pherotrichis Decne., Rhyssostelma Decne., Rojasia Malme, Stelmagonum Baill., Stenomeria Turcz. and Widgrenia Malme have not yet been ascertained by molecular analysis. All the Old World genera, except for Seshagiria, have been tentatively ascribed to Cynanchinae (Endress et al., 2007), but their affiliation to another subtribe or even to an undescribed lineage cannot be ruled out. The New World genera have been tentatively attributed to subtribes Gonolobinae, Metastelmatinae and Oxypetalinae (Endress et al., 2007). All the still unsequenced genera are small (consisting of one to a few species), and most (70%) are Asian. Some will have to remain obscure, because they are either believed to be extinct (Hypolobus; Fontella Pereira & Konno, 1999) or the type material has been lost (Anatropanthus, Heynella, Mahawoa, Pycnorhachis) and no material for neotypification has been identified. For the other genera, increased efforts have been made to obtain materials that can be sequenced. The present study focuses on Asian taxa: Cosmostigma, Graphistemma, Holostemma, Pentasachme, Raphistemma, Seshagiria and Treutlera. Cosmostigma is a genus with three accepted species (The Plant List, http://www.theplantlist.org/, accessed on 20 March 2013), which are found in India, Sri Lanka, Indochina, Hainan, Java and the Philippines. The plants are twiners with large heart-shaped leaves and conspicuous condensed bostrychoid inflorescences borne on long peduncles. In the Indian C. racemosum Wight, the inflorescences do not exceed the leaves, whereas they are clearly longer in the other two species. The corona consists of five completely separate, thin staminal lobes not exceeding the gynostegium. The pollinia are erect and without a pellucid zone, corresponding to the typical Marsdenieae pollinarium. The follicles are > 20 cm long, ovatelanceolate and thick-walled (Omlor, 1998). Graphistemma comprises a single species, G. pictum (Champ. ex Benth.) Benth. & Hook. ex Maxim., from south-eastern China and Vietnam. The plants are large twiners with elliptic to ovate leaves and almost sciadioidal inflorescences. The corolla is large, > 1 cm in diameter, yellowish-green on the outside and dark maroon with a yellowish margin and two yellowish stripes at the base of each corolla lobe on the inside. A basally fused corona with strongly outwardly revolute staminal lobes constitutes the defining character of the genus. The pollinia are pendent and the follicles are up to 11 cm long, ellipsoid and thick-walled. Graphistemma pictum is a larval food plant for Danaus (Salutara) genutia (Cramer 1779) (Shirôzu, 1960). Graphistemma was at one point included in Holostemma. Its inclusion in Cynanchinae by Endress et al. (2007) is supported by its typical prophylls, which are small, almost sessile leaflets in the nodes. For Holostemma, 14 names have been published (Table 1). Two names have been misapplied to New World taxa, Fischeria scandens DC. and Diplolepis mucronata (Decne.) Hechem & C.Ezcurra, and five names have been applied to thick-fruited Asian taxa, among them Metaplexis hemsleyana Oliv., Graphistemma pictum and three Cynanchum spp. Four names are synonyms of the most frequent species, H. annularium (Roxb.) K.Schum., widespread in India, Pakistan, Bhutan, Nepal and China. The history of this name has recently been elucidated by Turner (2013). Holostemma annularium is a large twiner with pronouncedly heart-shaped leaves, flowers up to 3.5 cm in diameter, white outside, and crimson corolla lobes with broad white margins inside. The gynostegium sits on top of a short annular corona, which is pink at the base, changing to white above. The pendent pollinia are conspicuously slender and the club-shaped follicles are > 10 cm long and © 2014 The Linnean Society of London, Botanical Journal of the Linnean Society, 2014, 174, 601–619 ASIAN ASCLEPIADOIDEAE Table 1. Taxonomy of Holostemma R.Br Species Correct name H. ada-kodien Schult., Syst. Veg. 6: 95. 1820 H. annularium (Roxb.) K.Schum., Nat. Pflanzenfam. 4(2): 250 (1895) ≡ Asclepias annularia Roxb., Hort. Bengal. 20. 1814 H. brunonianum Royle; Ill. Bot. Himal. Mts. 276, t. 66. 1839 H. candolleanum Spreng.; Syst. Veg. 1: 851. 1824 H. chilense Phil.; Linnaea 33: 174–175. 1864 H. annularium (Roxb.) K.Schum. H. annularium (Roxb.) K.Schum. Fischeria scandens DC. Diplolepis mucronata (Decne.) Hechem & C. Ezcurra H. fragrans Wall. H. fragrans Wall.; Pl. Asiat. Rar. 2: 51. 1831 H. laeve Blume; Bijdr. Fl. Cynanchum ovalifolium Ned. Ind. 1055. 1826 Wight H. muricatum Blume; Bijdr. Cynanchum muricatum Fl. Ned. Ind. 1054. 1826 (Blume) Boerl. H. pictum Champ. ex Benth.; Graphistemma pictum Hooker’s J. Bot. Kew Gard. (Champ. ex Benth.) Misc. 5: 53 (1853) Benth. & Hook. f. ex Maxim. H. rheedei Wall.; Numer. List H. annularium (Roxb.) K.Schum. n. 4409. 1828, and Pl. Asiat. Rar. 2: 51. 1831, nom. illeg. (superfl.) H. rheedianum Spreng.; Syst. H. annularium (Roxb.) Veg. 1: 851. 1825 K.Schum.? Metaplexis hemsleyana H. sinense Hemsl.; J. Linn. Oliv. Soc., Bot. 26(173): 103. 1889 Cynanchum tuberculatum H. tuberculatum Blume; (Blume) Boerl. Bijdr. Fl. Ned. Ind. 1055. 1826 thick-walled. Holostemma annularium is also a larval food plant for Danaus genutia (Chaturvedi & Haribal, 1992). The species is used in Ayurvedic medicine and is apparently rare (Martin, 2003, and references therein). It has also been included in Cynanchinae (Endress et al., 2007), but lacks prophylls. A second species, H. fragrans Wall., has been described from Myanmar. Holostemma fragrans differs from H. annularium by the more slender leaves and minutely purple-spotted corolla lobes, instead of corolla lobes with a single large purple spot. Holostemma fragrans is only known from the type (Wallich 4470, K) and a more thorough analysis would be 603 necessary to determine whether its deviating features are within the variability of H. annularium or whether it constitutes a species in its own right. For Pentasachme, ten names have been published, if the later spelling variant ‘Pentasacme’ is taken into account. Four names are considered today to be synonyms of species of Vincetoxicum Wolf, and one is a synonym of a species of Heterostemma Wight & Arn. Of the remaining five names, two are synonymous, so that the current species count stands at four species. These occur in the Indian Peninsula, the Himalayas, southern China and Indochina (Rahman & Wilcock, 1991). The plants are erect or decumbent rheophytic herbs, with fascicled roots and slender, elliptic leaves. The sessile inflorescences bear a few showy flowers with long, slender petals. The pollinia are erect and bear a small translucent beak at the apex. For Raphistemma, four names have been published. One, R. ciliata Hook.f., is a synonym of Pergularia daemia (Forssk.) Chiov. (Goyder, 2006), and a second, R. brevipedunculatum Y.Wan, is considered as a synonym of one of the two accepted species, R. hooperianum (Blume) Decne. Both species are distributed in southern China and Indochina, with R. pulchellum (Roxb.) Wall. extending into India and the Himalayan countries. Both are woody lianas with heart-shaped leaves, rather large creamy-white flowers (to 4 cm diameter in R. pulchellum) in which the tube is approximately as long as the lobes. The follicles are likewise large (to 18 cm long), ovoid and thick-walled. The main difference between the two species lies in the larger floral size of R. pulchellum and the corona lobes being more pronouncedly exserted from the tube in R. hooperianum. Both names have at one point been considered as synonyms of names in Oxystelma R.Br., a genus so far unplaced in Asclepiadeae, even though two of its species have been included in molecular studies. Nevertheless, Endress et al. (2007) placed the genus in Cynanchinae. Raphistemma pulchellum is also a larval food plant for Danaus genutia (Chaturvedi & Haribal, 1992). Seshagiria was described as late as 1971, with a single species, S. sahyadrica Ansari & Hemadri, endemic to the Western Ghats. Even though Ansari & Hemadri (1971) provided a detailed illustration of the plant and the pendent pollinia clearly associate it with Asclepiadeae, the mix of characters has so far prevented its inclusion in any of the known subtribes. It is a medium-sized herbaceous twiner with pronouncedly heart-shaped leaves reminiscent of Cynanchum, but a strongly twisted corolla reminiscent of Vincetoxicum s.l. (Vincetoxicum s.s. + Tylophora; see Liede-Schumann et al., 2012). The corona of a short outer ring and inner globular staminal parts is vaguely reminiscent of the Sarcostemma R.Br. group of Cynanchum s.l. The ovate-lanceolate solitary folli- © 2014 The Linnean Society of London, Botanical Journal of the Linnean Society, 2014, 174, 601–619 604 S. SURVESWARAN ET AL. cle, c. 8 cm long, is thick-walled and has warty protuberances, reminiscent of Pergularia and other Asclepiadinae. Thus, Seshagiria was considered as a genus incertae sedis by Endress et al. (2007). Treutlera comprises a single species, T. insignis Hook.f., endemic to the eastern Himalayas (Mitra & Mukherjee, 2007), growing at elevations up to 3000 m. Treutlera insignis is a large twiner with elliptic leaves, and its sciadioidal inflorescences are borne on long peduncles. The campanulate flowers constitute the character for which it was separated from Marsdenia R.Br. Because four of the seven small Asian genera studied (Graphistemma, Holostemma, Raphistemma and Seshagiria) were expected to fall in Asclepiadeae, for which a subtribal concept is available (Endress et al., 2007), care was taken to include the Old World genera considered as ‘Asclepiadeae incertae sedis’ in the data matrix, even though they have been included in previous molecular analyses. Calciphila Liede & Meve was described only recently for two species from Somalia (Liede-Schumann & Meve, 2006). One species was originally described under Cynanchum (Liede, 1996) because of its highly fused laminar urceolate corona, but doubts were raised because its corolla bears an unusual kind of trichome and its inflorescences are extremely elongated, characters not found elsewhere in Cynanchum. Molecular analyses, however, revealed that it is not a member of Cynanchum (Liede & Kunze, 2002; Liede-Schumann & Meve, 2006), its affinities remaining obscure. Oxystelma, also with two species, is widespread in tropical Africa and Asia. Both species are riparian and possess thick, inflated follicles capable of floating. They share a broadly campanulate pendulous corolla with some members of the South American genus Philibertia Kunth, and were, for this feature, included in the artificially wide Sarcostemma R.Br. of Holm (1950). Molecular analyses, however, have shown that Sarcostemma sensu Holm (1950) is polyphyletic and that Oxystelma should be treated as an independent genus (Liede & Täuber, 2000). Solenostemma Hayne is a monotypic genus widespread in the dry areas of northern Africa and the Arabian Peninsula. It is an erect, densely foliose shrub with a long-stipitate gynostegium far exceeding an almost tubular corolline corona. With Glossonema Decne. and Odontanthera Wight, it was considered to form the subtribe Glossonematinae K.Schum. (Liede, 1997), but, with both Glossonema and Odontanthera transferred to Cynanchinae (Liede & Täuber, 2002), Solenostemma remained unclassified. Liede, Meve & Täuber (2002) observed a relationship of Solenostemma to Oxystelma and Asclepiadinae, but considered the data to be inconclusive. In the most recent phylogenetic analysis available (Liede-Schumann et al., 2012), four clades (Tylophorinae, Asclepiadinae, Calciphila and an almost unsupported clade of Solenostemma and Oxystelma) formed a moderately supported polytomy sister to Cynanchinae. In the present study, we aim to clarify the positions of the Asian Cosmostigma, Graphistemma, Holostemma, Pentasachme, Raphistemma, Seshagiria and Treutlera in the known phylogenetic structure of Asclepiadoideae, using plastid DNA sequences of rbcL, rps16, trnL and trnL-F regions. In addition, we investigate the phylogenetic affiliation of Eustegia and the subtribal placement of Calciphila, Oxystelma and Solenostemma based on the same molecular dataset. MATERIAL AND METHODS TAXON SAMPLING Taxa were selected to represent the Asian enigmatic genera as comprehensively as possible. Representatives of all published tribes and subtribes of Asclepiadoideae were included in the matrix. Because geography is often a better predictor than morphology (e.g. Liede & Täuber, 2000, 2002) of relationships in Asclepiadoideae, we included Asian species as far as possible, depending on the availability of material. As outgroup, samples of the sister subfamily Secamonoideae (Livshultz et al., 2007) were chosen. Species, author names, their tribal and subtribal affiliation, vouchers and geographical origins are summarized in Table 2. Eighty sequences were newly obtained for this study. DNA EXTRACTION, AMPLIFICATION AND SEQUENCING DNA was extracted from silica-dried leaves (vouchers held at UBT and SUK) or from leaf fragments taken from herbarium specimens held at ABD, GA, MO, MSUN, NU and UBT. Total DNA was extracted using the DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions. PCR primers and protocols for the plastid trnT-trnL and trnL-trnF spacers and the trnL intron followed Taberlet et al. (1991). The trnL intron and trnL-trnF intergenic spacer were amplified either as one fragment using primers c and f, or as two separate fragments using primers c and d, and e and f, respectively. For rps16, the protocol detailed in Liede-Schumann et al. (2005) was followed. The rbcL gene was amplified using primers rbcL1F and rbcL1390R, and internal primers rbcL700F and rbcL800R (Table 3). The primer rbcL1F is a forward primer corresponding to the first 20 base pairs of the rbcL exon, and rbcL1390R is the reverse primer corresponding to the 24 nucleotides on the complementary strand from the 1390th position in the reverse direction. The primer rbcL700F corresponds to © 2014 The Linnean Society of London, Botanical Journal of the Linnean Society, 2014, 174, 601–619 ASIAN ASCLEPIADOIDEAE 605 Table 2. Species, vouchers and GenBank accession numbers Taxon Pervillaea tomentosa Decne. Secamone geayi Costantin & Gallaud Secamone elliptica R.Br. Secamone emetica R.Br. Toxocarpus wightianus Hook. & Arn. Eustegia minuta (L.f.) N.E.Br. Cibirhiza albersiana H.Kunze, Meve & Liede Fockea capensis Endl. Taxonomic placement Voucher Origin (country of origin) Outgroup: Secamonoideae Outgroup: Secamonoideae Ex hort. Palmengarten Civeyrel 1200 (TL) In cult. (Madagascar) Madagascar Outgroup: Secamonoideae Outgroup: Secamonoideae Outgroup: Secamonoideae Middleton 1162 (A) Thailand Kamble 1150 (SUK) Surveswaran s.n. (UBT) India: Sirumalai, Tamil Nadu Hong Kong Eustegieae Bruyns 4357 (K) South Africa Fockeeae Specks 21460 (UBT) Tanzania Fockeeae ex L. Hill s.n. (RBGK 385, K)/Civeyrel 1067 (TL) ex hort (UBT)/ Livshultz s.n. Forest et al. 793 (NBG)/Nicholas 2811 (UDW) Styles 2448 (NH)/ Edwards s.n. (UDW)/Jürgens 1459 (NU) Kamble 2143 (SUK) Fockea edulis K.Schum. Anisotoma cordifolia Fenzl Fockeeae Riocreuxia torulosa Decne. Ceropegieae– Anisotominae Heterostemma dalzellii Hook.f. Heterostemma piperifolium King & Gamble Heterostemma tanjorense Wight & Arn. Leptadenia hastata (Pers.) Decne. Leptadenia reticulata (Retz) Wight & Arn. Ceropegieae– Heterostemminae Ceropegieae– Heterostemminae Ceropegieae– Anisotominae Middleton 194 (A) rbcL – AJ419761 DQ660665 (ACK76588) EU196290 (ACC96794) EU196292 (ACC96795) trnL-F region (trnL intron, trnL-F spacer) AJ431768 AJ431769 DQ221152 DQ221194 rps16 AJ699319 – EF456116 DQ660610 HG530570 – – – AM234833 (CAJ86704) HG530548 AJ410206 AJ410207 FM178484 FM178485 HG530587 South Africa AM234834 (CAJ86705) DQ221131 DQ221173 – in cult. (South Africa) South Africa HG530549 EF456115 EF456653 AM234829 (CAJ86700) AJ410017 AJ410018 – South Africa AM234841 (CAJ86712) AJ574842 AJ574843 HG530589 India: Nandurbar, Maharashtra Thailand HG530550 HG530571 HG530590 – EF456110 EF456384 HG530588 Ceropegieae– Heterostemminae Kamble 1130 (SUK) India: Sindhudurg, Maharashtra EU196278 (ACC96782) – – Ceropegieae– Leptadeniinae Ceropegieae– Leptadeniinae Huber s.n. (UBT) Gambia HG530551 HG530591 Kamble 2167 (SUK)/Schäffler 01 (UBT) India: Solapur, Maharashtra/ Tamil Nadu HG530592 s.coll. 20816053 (E) Nepal: Manaslu EU196282 (ACC96786) identical to HG530568 JQ933437 AJ410056 AJ410057 HG530572 – – Laulhé s.n. (ex hort.) Řičánek & Hanáček 210 (BOL) Kamble 1113 (SUK)/ Sarkaria sub K 781 (MSUN) Kamble 2131 (SUK) Canary Islands / Morocco EU196257 (ACC96762) HM475478 HG530593 India: Satara, Maharashtra EU196274 (ACC96778) AJ488325 AJ488326 HG530594 India: Maharashtra EU196258 (ACC96763) EU267099 EU267089 – Pentasachme wallichii Wight Apteranthes burchardii (N.E.Br.) Plowes Ceropegieae– Leptadeniinae Ceropegieae– Stapeliinae Boucerosia frerei (Rowley) Liede & Meve Boucerosia indica (Wight & Arn.) Plowes Ceropegieae– Stapeliinae Ceropegieae– Stapeliinae © 2014 The Linnean Society of London, Botanical Journal of the Linnean Society, 2014, 174, 601–619 606 S. SURVESWARAN ET AL. Table 2. Continued Taxon Boucerosia umbellata (Haw.) Wight & Arn. Brachystelma bourneae Gamble Brachystelma edule Collett & Hemsl. Caralluma adscendens (Roxb.) Haw. var. attenuata (Wight) Gravely & Mayur. Ceropegia juncea Roxb. Taxonomic placement Ceropegieae– Stapeliinae Ceropegieae– Stapeliinae Ceropegieae– Stapeliinae Ceropegieae– Stapeliinae Ceropegieae– Stapeliinae Cosmostigma racemosum Wight Gymnema cuspidatum (Thunb.) Kuntze Gymnema latifolium Wall. ex Wight Dischidia chinensis Champ. ex Benth. Hoya manipurensis Deb Marsdenieae Hoya retusa Dalzell Marsdenieae Hoya wightii Hook.f. Marsdenia tenacissma Hook. & Arn. Marsdenieae Voucher SUK 27964/ Sarkaria 81–75 (ex hort. UBT) SSK 31 (SUK) Kamble 1134 (SUK) Kamble 1193 (SUK) Kamble 2135 (SUK)/Řičánek & Hanáček 92 (UBT) SUK 1138 (SUK) Marsdenieae Surveswaran 24 (SUK) Marsdenieae Kamble 1120 (SUK)/Sardesai 705 (UBT) HK19057 (HK) Marsdenieae Marsdenieae Marsdenieae Treutlera insignis Hook.f. Wattakaka volubilis Stapf Marsdenieae Araujia sericifera Brot. Asclepiadeae– Oxypetalinae Asclepias curassavica L. Asclepiadeae– Asclepiadinae Marsdenieae Bremer et al. 3010 (UPS)/ Seidenfaden s.n. (K) Kamble 1160 (SUK)/Wanntorp 580 (S) Kamble 1162 (SUK) Kamble 1145 (SUK)/Schneidt & Liede 96–103 (ABD) Akiyama et al., 20100315 (E) Kamble 1141 (SUK)/Schäffler 02 (UBT) Bremer 3006 (UPS)/ Liede & Conrad 3007 (ULM) Surveswaran s.n. (UBT)/Rapini 933 (SPF) Origin (country of origin) rbcL trnL-F region (trnL intron, trnL-F spacer) India: Tumkur, Karnataka EU196259 (ACC96764) AJ488328 AJ488329 HG530595 India: Shimoga, Karnataka India: Kolhapur, Maharashtra India: Satara HG530552 HG530573 HG530596 EU196252 (ACC96757) EU196256 (ACC96761) EU120013 EU127982 EU127987 EU267083 HG530597 India: Marudamalai, Tamil Nadu EU196264 (ACC96769) AJ428799 AJ428800 AJ699322 India: Kolhapur, Maharashtra India: Maharashtra HG530553 HG530574 HG530599 HG530554 – HG530600 India: Maharashtra EU232692 (ABX60151) HG530575 HG530601 Hong Kong EU196273 (ACC96777) – – in cult. Copenhagen/ Thailand AJ419750 (CAD20909) AJ431765 AJ431766 HG530602 India: Kolhapur, Maharashtra/ex hort. Uppsala India: ex hort. Kolhapur India: Pune, Maharashtra/ Philippines EU196280 (ACC96784) DQ334532 – EU196281 (ACC96785) EU196283 (ACC96787) HG530576 HG530603 AJ431759 HG530604 JQ933509 – – EU196296 (ACC96799) HG530577 HG530605 AJ419734 (CAD20893) AJ428793 AJ428794 AJ699352 EU916742 (ACL12044) (identical to X91774 of Sennblad and Bremer (1996) AY163664 AJ704459 Nepal: Bagmati zone India: Tamil Nadu in cult. Copenhagen/ Argentina Hong Kong/Brazil rps16 HG530598 © 2014 The Linnean Society of London, Botanical Journal of the Linnean Society, 2014, 174, 601–619 ASIAN ASCLEPIADOIDEAE 607 Table 2. Continued Taxon Taxonomic placement Asclepias syriaca L. Asclepiadeae– Asclepiadinae Aspidoglossum heterophyllum E.Mey. Astephanus triflorus R.Br. Asclepiadeae– Asclepiadinae Asclepiadeae– Astephaninae Calciphila gillettii Liede & Meve Calotropis procera (Aiton) W.T.Aiton Asclepiadeae– Asclepiadinae Asclepiadeae– Asclepiadinae Cynanchum acutum L. Cynanchum callialatum Buch.-Ham. ex Wight Cynanchum ellipticum (Harv.) R.A.Dyer Cynanchum laeve Pers. Asclepiadeae– Cynanchinae Asclepiadeae– Cynanchinae Cynanchum obovatum (Decne.) Choux Cynanchum tunicatum (Retz.) Alston Cynanchum viminale (Bassi) L. aff. Asclepiadeae– Cynanchinae Voucher Livschultz 03–33 (BH)/ex hort. Münster Bruyns 6855 (RBGK 3293, K) rbcL trnL-F region (trnL intron, trnL-F spacer) USA DQ660631 (ACK76555) AJ410178 AJ410179 DQ660564 South Africa AM234830 (CAJ86701) AM295702 AM295703 HG530606 South Africa AM234831 (CAJ86702) AJ410188 AJ410189 AJ699324 Somalia HG530555 HG530607 India: Kolhapur, Maharashtra/ Gambia in cult. Lisboa EU196255 (ACC96760) AM22966 AM229663 AJ428795 AJ428796 Origin (country of origin) rps16 Logie FBG 34 (NBG)/Williams 659 (MO) Thulin et al. 10122 (UPS) Kamble 1136 (SUK)/Huber s.n. (UBT) BG Lisbon s.n. (UBT) Kamble 1138 (SUK)/Huber s.n. (UBT) India: Anuskura, Maharashtra/ Mauritius EU196270 Asclepiadeae– Cynanchinae Liede 2933 (UBT) South Africa HG530557 AJ290846 AJ290845 AJ699327 Asclepiadeae– Cynanchinae Beyersdorfer 124 (US)/Liede s.n. (UBT) Mangelsdorff M14 (UBT) USA DQ00605 (AAY64481) AJ428652 AJ428653 HG530610 Madagascar HG530558 AJ428802 AJ428803 HG530611 HG530556 AJ428583 AJ428584 HG530578 HG530608 AJ699326 HG530609 Asclepiadeae– Cynanchinae Kamble 1155 (SUK) India: Kolhapur, Maharashtra EU196271 (ACC96775) HG530579 – Asclepiadeae– Cynanchinae Kamble 1154 (SUK)/Řičánek & Hanáček 017 (UBT) Liede & Newton 3239 (ULM)/ Rowaished 3014 (RBGK 15764, K) Bruyns? s.n. (RBGK 3289, K)/Drewe 534 (K) India: Maharashtra EU196289 (ACC96793) HG530580 HG530612 Kenya/Yemen HG530559 AJ428805 AJ428806 AJ704462 South Africa AM234835 (CAJ86706) AM295766 AM295767 HG530613 Glossonema boveanum Decne. Asclepiadeae– Cynanchinae Gomphocarpus cancellatus (Burm.f.) Nicholas & P.I.Forst. Graphistemma pictum (Champ. ex Benth.) Benth. & Hook.f. ex Maxim. Holostemma ada-kodien Schult. Kanahia laniflora (Forssk.) R.Br. Asclepiadeae– Asclepiadinae Asclepiadeae– Cynanchinae Surveswaran s.n. (UBT) Hong Kong: EU196275 (ACC96779) HG530581 HG530614 Asclepiadeae– Cynanchinae Grierson & Long 2351 (E) Bhutan JQ933364 (AFP23587) – – Asclepiadeae– Asclepiadinae Mangelsdorff RMY 116 (FR) Yemen HG530560 AM295581 AM295580 ## © 2014 The Linnean Society of London, Botanical Journal of the Linnean Society, 2014, 174, 601–619 608 S. SURVESWARAN ET AL. Table 2. Continued Taxon Taxonomic placement Macroscepis hirsuta (Vahl) Schltr. Asclepiadeae– Gonolobinae Metaplexis japonica Makino Asclepiadeae– Cynanchinae Sennblad 263 (UPS)/Heyne s.n. (UBT) BG Tartu s.n. (UBT) Metastelma parviflorum (Sw.) R.Br. ex Schult. aff. Microloma tenuifolium K.Schum. Oncinema lineare (L.f.) Bullock Orthosia angustifolia (Turcz.) Liede & Meve Oxypetalum coeruleum (D.Don ex Sweet) Decne. Asclepiadeae– Metastelmatinae Liede & Meve 3328 (UBT) Asclepiadeae– Astephaninae Bruyns s.n. (RBGK 3297)/Albers s.n. (MSUN) Bruyns s.n. (RBGK 3290, K) Reyes A–5219 (XAL) Oxystelma esculentum (L.f.) Sm. Pentacyphus lehmannii (Schltr.) Liede Pentarrhinum insipidum E.Mey. Pentatropis nivalis (J.F.Gmel.) D.V.Field & J.R.I.Wood Pergularia daemia (Forssk.) Chiov. Raphistemma pulchellum (Roxb.) Wall. Schizostephanus alatus Hochst. ex K.Schum. Seshagiria sahyadrica Ansari & Hemadri Solenostemma argel (Delile) Hayne Tylophora dalzellii Hook.f. Tylophora mollissima Wall. ex Wight Asclepiadeae– Astephaniae Asclepiadeae– Orthosiinae Voucher Origin (country of origin) rbcL trnL-F region (trnL intron, trnL-F spacer) in cult. Meise/ Guatemala AJ419747 (CAD20906) AJ704268 AJ704267 AJ704265 in cult. Tartu (China, Japan and Korea) Venezuela HG530561 AJ428811 AJ428812 HG530615 HG530562 AJ428778 AJ428779 AJ699342 South Africa AM234837 (CAJ86708) AJ410221 AJ410222 AJ699325 South Africa AM234838 (CAJ86709) HG530563 AJ410230 AJ410231 HE611754 HG530617 AJ704354 AJ704356 AJ704357 HG530582 HG530618 Mexico rps16 HE611849: Asclepiadeae– Oxypetalinae Liede & Conrad s.n. (ULM) Argentina Asclepiadeae– Asclepiadinae Kamble 1143 (SUK) India: Kolhapur, Maharashtra AJ419765 Sennblad and Bremer (2002) EU196284 (ACC96788) Asclepiadeae Liede 3333 (UBT) Ecuador HG530564 AJ290889 AJ290888 AJ704928 Asclepiadeae– Cynanchinae Asclepiadeae– Tylophorinae Liede 2940 (UBT) South Africa HG530565 HG530619 Kamble 1178 (SUK)/Meve 949 (B, MSUN, UBT) India: Ahmednagar, Maharashtra/ Kenya India: Kolhapur, Maharashtra/ Kenya Thailand EU196285 (ACC96789) AJ410233 AJ410234 AJ410239 AJ410240 EU196286 (ACC96790) AJ290892 AJ290893 AJ699323 HG530566 HG530583 HG530620 Asclepiadeae– Asclepiadinae AJ699329 Asclepiadeae– Cynanchinae Kamble 1153 (SUK)/Masinde 888 (UBT) Middleton et al. 5359 (E) Asclepiadeae– Cynanchinae Noltee s.n. sub IPPS 8111 (UBT) Kenya AJ419758 (CAD20917) AJ410248 AJ410249 HF547220 Asclepiadeae– Cynanchinae Kamble 2122 (SUK) India: Kolhapur, Maharashtra EU196291 HG530584 HG530621 Asclepiadeae– Asclepiadinae Aziz sn. (MO)/ Boulos & Wacher 19142 (RBGK 15763, K) Kamble 1148 (SUK) Egypt HG530567 AJ428832 AJ428833 AJ704458 India: Kolhapur, Maharashtra India: Kerala EU196293 (ACC96796) HG530569 HG530585 HG530622 HG530586 HG530628 Asclepiadeae– Tylophorinae Asclepiadeae– Tylophorinae Surveswaran 06 (SUK) © 2014 The Linnean Society of London, Botanical Journal of the Linnean Society, 2014, 174, 601–619 ASIAN ASCLEPIADOIDEAE 609 Table 2. Continued Taxon Taxonomic placement Tylophora ovata Hook. ex Steud. Asclepiadeae– Tylophorinae Tylophora rotundifolia Buch.-Ham. ex Wight Tylophora sylvatica Decne. Asclepiadeae– Tylophorinae Vincetoxicum hirundinaria Medik. Xysmalobium undulatum (L.) W.T.Aiton Voucher Asclepiadeae– Tylophorinae Asclepiadeae– Tylophorinae Asclepiadeae– Asclepiadinae Yamashiro 4118 (TUS)/ Surveswaran s.n. (UBT) Kamble 1129 (SUK)/Sebastian s.n. (UBT) Carvalho 3935 (UPS)/Valck s.n. (UBT) Sennblad 257 (UPS)/Meve 970 (UBT) Balkwill 10846 (RBGK 10545, K) Nicholas 2830 (UDW) rbcL trnL-F region (trnL intron, trnL-F spacer) Hong Kong EU196294 (ACC96797) AB109918 AB109950 HG530623 India: Gujarat EU196295 (ACC96798) GU060630 HG530624 Equatorial Guinea X91780 (CAA62895) AJ410266 AJ410267 HG530625 Sweden / Germany AJ419769 (CAD20928) AJ410275 AJ410276 HG530626 South Africa AM234842 (CAJ86713) AM295679 AM295680 HG530627 Origin (country of origin) rps16 Table 3. Primers for amplification and sequencing of the rbcL gene Primer 5′ Nucleotide sequence 3′ Designed by/source rbcL rbcL rbcL rbcL ATGTCACCACAAACAGAGAC CATTACTTGAATGCTACGCAGGTAC AGCTCGTATTTGCAGTGAATCC CTTTCCATACTTCACAAGCAGCAG Reeves et al. (2001) This study This study This study 1F 700F 800R 1390R nucleotides from 686 to 713 in the rbcL gene. The primer rbcL800R corresponds to nucleotides between 791 and 812 in the complementary strand of rbcL. The amplified product was c. 1.4 kb in total length. Sequence alignment was performed manually for all the regions (matrix parameters given in Table 4; TreeBase accession number 14891). PHYLOGENETIC ANALYSES On the combined dataset, maximum parsimony (MP) analysis was performed using Fitch parsimony as implemented in PAUP* v. 4.0b10 (Swofford, 2003) with heuristic searches, with 10 000 addition sequence replicates, random stepwise addition, MULTREES off and tree bisection–reconnection (TBR) branch swapping. The resulting trees were then used as starting trees for a second round of search with MULTREES on. The sets of equally mostparsimonious trees recovered from the analyses were summarized by strict consensus. To estimate branch support, a bootstrap analysis was run with 10 000 replicates, keeping a single tree per replicate that was optimized using TBR swapping with MULTREES deactivated (following the suggestion of Müller, 2005). Maximum likelihood (ML) trees were inferred using GARLI 2.0 (Zwickl, 2006) and RAxML v. 7.2.6 (Stamatakis, 2006); Bayesian inference (BI) relied on MrBayes 3.2 (Huelsenbeck & Ronquist, 2001; Ronquist & Huelsenbeck, 2003). For each of the three partitions, the best model of DNA evolution was established using the program jmodeltest v. 0.1.1 (Guindon & Gascuel, 2003; Posada, 2008). Taxa missing a particular locus were removed from the model selection analysis for that locus. As options for model optimization, ‘ML optimized’ and ‘Best’ base tree search were selected. We calculated the best model under the Akaike information criterion (AIC; Akaike, 1974), the AIC corrected for small datasets (AICc; Sugiura, 1978; Hurvich & Tsai, 1989) and the Bayesian information criterion (BIC; Schwarz, 1978). Following Posada & Buckley (2004), the model suggested by AICc was finally implemented in the analysis in cases in which different algorithms suggested different models, because our dataset is relatively small. Preliminary runs using models selected by AIC © 2014 The Linnean Society of London, Botanical Journal of the Linnean Society, 2014, 174, 601–619 610 S. SURVESWARAN ET AL. Table 4. Sequence characteristics and models of DNA evolution rbcL trnL-F region rps16 Length (bp) Median length (bp) Aligned length (bp) New sequences Missing partial sequences Percentage of missing data cells and gaps 645–1271 1266 1269 22 2 1.04% 520–856 825 942 17 7 16.88% (after exclusion of gene regions) Variable characters Potentially parsimony informative characters Number of distinct alignment patterns Best-fit model of nucleotide substitution (24 models tested) Best-fit model of nucleotide substitution (88 models tested) 181 105 270 136 498–1034 762 789 41 13 7.09% (after exclusion of isolated insertions/ duplications) 283 143 274 438 394 GTR + I + G (AIC, AICc) K80 + I + G (BIC) GTR + G GTR + G TVM + I + G (AIC) TPM1uf + I + G (AICc) TPM1 + I + G (BIC) TVM + G (AIC) TPM1uf + G (AICc, BIC) TVM + G and BIC showed no changes in tree topology. The best model for each of the three partitions retrieved from the test of 24 models of substitution was implemented for BI, whereas, for implementation in GARLI 2.0 (Zwickl, 2006), the whole set of 88 models of substitution was tested (Table 4). Bayesian analyses used 10 000 000 generations on ten simultaneous runs and one (cold) chain each; chains were sampled every 1000 generations. ML bootstrap support was established using the fast bootstrap option implemented in RAxML (Stamatakis, Hoover & Rougemont, 2008); the number of necessary bootstrap replicates was determined by the extended majority rule criterion (Pattengale et al., 2009). To test for cumulative effects or incompatibility in the signal from the individual regions, multiple ML analyses were run: run with RAxML (option -f a, simultaneous tree inference and bootstrapping): four including all taxa (all partitions; rbcL + trnL/trnL-F; rbcL + rps16; trnL/trnL-F + rps16); four excluding six taxa for which only rbcL sequence data were available (all three partitions; rbcL + trnL/trnL-F; rbcL + rps16; trnL/trnL-F + rps16); and three single-locus analyses (rbcL; trnL/trnL-F; rps16). RAxML does not allow a substitution model other than GTR for nucleotide data to be pre-set; therefore, tree inferences and bootstrapping analysis used the per-site rates approximation of the Gamma (Γ) distribution to model site rate variation (-m GTRCAT; Stamatakis, 2006) with only the final tree optimized under GTR + Γ. Analyses were run un-partitioned and partitioned (-q), treating each rbcL codon position, the spacer (trnL-F) and the two introns (rps16, trnL) as distinct partitions. Pairwise ML-based distances between taxa were calculated with PAUP using the final model parameters as optimized by GARLI. The program PBC (Göker & Grimm, 2008) was used to calculate minimum, average and maximum intra-clade and inter-clade pairwise (Hamming) distances for Asclepiadeae, Ceropegieae, Marsdenieae and Secamonoideae and for Stapeliinae and non-stapelioid Ceropegieae. Branch lengths in dichotomous trees may be distorted, e.g. a chimera, hybrid or intermediate between two subtrees would be placed in one subtree, but would produce an artificially elongated terminal branch. Distance matrices are, however, not affected by this. The distances represent differentiation values obtained from the primary data, not a secondary value obtained via a reconstruction, such as minimum and maximum root-tip or internode patristic distance calculated from the tree. All input and result files are included in the electronic supplement archive (ESA) hosted at http://www .palaeogrimm.org/data. RESULTS The dataset yielded 734 variable characters, 384 of which were potentially parsimony informative (Table 4). Parsimony analysis resulted in 4508 shortest trees of 921 steps each [consistency index (CI) = 0.56; retention index (RI) = 0.81; rescaled con- © 2014 The Linnean Society of London, Botanical Journal of the Linnean Society, 2014, 174, 601–619 ASIAN ASCLEPIADOIDEAE sistency index (RC) = 0.45]. All inferences (ML with GARLI and RAxML, Bayesian analysis, and ML and MP non-parametric bootstrapping) favoured the same basic topology and produced ample support for most of the deeper phylogenetic relationships (Fig. 1). No strongly incongruent signals were present in the concatenated regions. With few exceptions in the leaves, branches with high ML bootstrap support (BSML ≥ 80) inferred in the single-locus analyses were also present in the preferred ML topology based on the concatenated data. Alternative (competing) taxon bipartitions to those in the three-locus tree never received BSML ≥ 80 in any of the single-locus or twolocus analyses (Fig. 2; Supporting Information, Table S3; full data can be found in the ESA). The generally known tribal and subtribal structure described from Asclepiadoideae is supported by our dataset. A deviating position is found for Eustegia minuta (L.f.) N.E.Br. (covered by all three markers), which is here placed as sister to all Asclepiadeae, whereas it was retrieved as sister to Asclepiadeae + (Marsdenieae + Ceropegieae) in previous studies (e.g. Rapini et al., 2007). This general structure was also retrieved from the separately analysed partitions (Fig. 2), for which rbcL was the most conservative and rps16 the most divergent (Tables S1, S2, see Supporting Information). The jackknifing analyses showed that any combination of two of the three used markers favoured the alternative in Figure 1 over the others (Table S3). There are two exceptions: the trnL/L-F and trnL/L-F + rbcL analyses favour a placement of Eustegia as sister to Ceropegieae and Marsdenieae, but with low support (BSML = 51/53), and rps16 data produced equally low bootstrap support for an Anistominae–Leptadenia– Heterostemma clade (BSML = 50; Fig. 2C). Cosmostigma racemosum (complete data coverage) and Treutlera insignis (partial rbcL data only) are clearly members of Marsdenieae, in which they are members of the non-Hoya subclade of the tribe. Pentasachme is a member of Ceropegieae, but is not grouped with Leptadenia. Instead, it takes an earlybranching position in Stapeliinae based on its (partial) rbcL sequence (so far, the only data available for this taxon). The other four Asian small genera studied [Graphistemma, Raphistemma, Seshagiria (all three markers covered) and Holostemma (partial rbcL data only)] are all members of Cynanchinae, where they fall in the same subtree as the American Cynanchum laeve Pers., and the small genera Glossonema, Metaplexis and Pentarrhinum. Relationships within this subtree are not unambiguously resolved, independent of locus sampling (Fig. 3). The two Indian Cynanchum spp. included form a weakly supported clade with the type species of Cynanchum, C. acutum L., whereas 611 the African–Madagascan clade of C. ellipticum (Harv.) R.A.Dyer, C. obovatum (Decne.) Choux and the stemsucculent C. viminale (Bassi) L. is placed as sister to the other species. The jackknifing results show that it is mostly signal from the newly sequenced rps16 intron that differentiates between members of this clade and provides a first phylogenetic structure. DISCUSSION PHYLOGENETIC POSITION OF NEWLY SEQUENCED ASIAN SPECIES Using data from three plastid regions, the seven small enigmatic Asian genera studied integrate well into the phylogenetic tree for Asclepiadoideae (Fig. 1). The position of Cosmostigma racemosum as a member of the non-Hoya clade of Marsdenieae is expected from the morphology of the plant with clearly erect pollinia without a translucid margin. The previously published sequences EU196268 and ACC96773 have probably been acquired from misidentified material and have been removed from GenBank. The relationships of Cosmostigma in Marsdenieae, particularly in relation to the large and probably polyphyletic Marsdenia (Omlor, 1998), are being studied in more detail elsewhere (T. Livshultz, pers. comm.). Treutlera insignis, however, is placed in a strongly supported clade with the two species of Gymnema in the analysis, despite the limited data currently available for this taxon. Because it is still not clear whether Gymnema is a genus in its own right or should be merged with a wide Marsdenia, as suggested by Forster (1995), no nomenclatural action is taken before Marsdenieae as a whole has been more thoroughly studied (T. Livshultz, pers. comm.). A corolline corona of five lobes with denticulate or lobed apical appendages, combined with the absence of a gynostegial corona and the regular formation of a single mericarp per flower, led Meve & Liede (2004) to associate Pentasachme with subtribe Leptadeniinae of Ceropegieae. The present results suggest that the genus is not most closely related to Leptadenia, but rather constitutes the sister to subtribe Stapeliinae. However, this placement needs to be ascertained in a more detailed analysis using additional sequence data. The four other enigmatic genera are deeply nested in Cynanchinae. Our results suggest that they form part of the large pantropical genus Cynanchum. The other small genera retrieved inside Cynanchum here, Glossonema, Metaplexis and Pentarrhinum, were found in this position by Liede & Kunze (2002), but, because of the low support values in this study, no formal inclusion in Cynanchum was suggested. These genera are quite variable in floral morphology, but they share usually club-shaped, thick-walled, often ornamented © 2014 The Linnean Society of London, Botanical Journal of the Linnean Society, 2014, 174, 601–619 612 S. SURVESWARAN ET AL. Aspidoglossum heterophyllum Xysmalobium undulatum Gomphocarpus cancellatus Asclepias curassavica Asclepias syriaca 95/97/* Calotropis procera 84/98/0.99 Kanahia lanilora Pergularia daemia 64/67/0.98 */*/* 93/98/* 82/94/* 52/74/0.69 37/45/0.79 Asclepiadinae Oxystelma esculentum ASCLEPIADEAE CEROPEGIEAE Calciphila gillettii 23/40/0.52 Solenostemma argel Tylophora dalzellii 36/64/0.53 57/74/0.99 31/32/0.62 Tylophora ovata Tylophora rotundifolia 52/53/0.60 Tylophora sylvatica 98/99/* Tylophorinae Vincetoxicum hirundinaria */*/* Tylophora mollissima Pentatropis nivalis Schizostephanus alatus 50/52/0.44 Holostemma annularium 53/53/0.59 Raphistemma pulchellum 46/46/0.46 Seshagiria sahyadrica 84/88/* Cynanchum laeve 42/51/0.99 59/45/0.6 Metaplexis japonica 39/56/0.95 Graphistemma pictum Pentarrhinum insipidum 83/83/* 68/71/* Glossonema boveanum Cynanchinae Cynanchum callialatum 94/97/* 87/98/* Cynanchum tunicatum 48/60/0.96 Cynanchum acutum 99/*/* Cynanchum ellipticum 97/*/* Cynanchum viminale aff. Cynanchum obovatum 94/98/* 99/*/* Araujia sericifera Oxypetalum coeruleum Oxypetalinae 81/85/* 82/94/* Metastelma parvilorum af. Metastelmatinae 97/99/* Macroscepis hirsuta Gonolobinae Orthosia angustifolia Orthosiinae 99/*/* 58/76/0.99 Pentacyphus lehmannii 98/99/* Microloma tenuifolium */*/* Astephanus trilorus Astephaninae Oncinema lineare Eustegia minuta EUSTEGIEAE 63/76/0.99 Caralluma adscendens attenuata 67/87/* Boucerosia indica 70/81/* Boucerosia umbellata Stapeliinae Boucerosia frerei 96/90/* 37/59/0.96 Apteranthes burchardii 96/87/0.99 Brachystelma edule 91/97/* 94/93/0.99 Brachystelma bourneae 64/66/0.94 Ceropegia juncea 58/65/0.94 Pentasachme wallichii Riocreuxia torulosa 96/*/* 89/98/* Anisotominae Anisotoma cordifolia Leptadenia hastata 98/*/* Leptadeniinae 94/89/* Leptadenia reticulata Heterostemma tanjorense 56/93/0.98 */*/* Heterostemma dalzellii Heterostemmatinae Heterostemma piperifolium 97/*/* Dischidia chinensis 33/44/0.26 94/98/* Hoya manipurensis 99/*/* Hoya wightii Hoya retusa Gymnema cuspidatum 20/58/0.84 MARSDENIEAE Treutlera sp. 42/70/0.98 97/*/* Gymnema latifolium Cosmostigma racemosum 96/98/* Marsdenia tenacissima Wattakaka volubilis 32/91/0.5 Fockea capensis */*/* Fockea edulis FOCKEEAE Cibirhiza albersiana 98/98/* Secamone emetica 86/87/0.91 Secamone elliptica 89/*/0.99 Toxocarpus wightianus Secamonoideae Secamone geayi Pervillaea tomentosa 0.01 expected subst./site Figure 1. See caption on next page. © 2014 The Linnean Society of London, Botanical Journal of the Linnean Society, 2014, 174, 601–619 ASIAN ASCLEPIADOIDEAE 613 Figure 1. Maximum likelihood (ML) tree obtained with RAxML based on combined rbcL, trnL- F region and rps16 intron data. Numbers indicate maximum parsimony bootstrap support (BSMP)/maximum likelihood bootstrap support (BSML)/ Bayesian posterior probability (PP); BSMP/BSML = 100 and PP = 1.0 indicated by asterisks. Taxa shown in colour indicate species found in India and samples originating from India are shown in bold (other samples derived from another Asian country). Tribes and subtribes are plotted onto the figure. Thickest lines indicate branches with unambiguous support by all methods (BSMP ≥ 80, BSML ≥ 90, PP ≥ 0.9). The grey shading marks the thick-fruited clade in Cynanchinae. Brackets linking paraphyletic groups (e.g. Seshagiria– Raphistemma) indicate support for topological alternatives not represented in the best-known ML topology. At this hierarchical level, it is not unusual for bootstrapping to favour topological alternatives not visible in the inferred tree. When both alternatives received (almost) equal support (in contrast with other branches with lower support), this fact is considered worth depicting. ◀ follicles, in contrast with the slender, more or less spindle-shaped follicles considered to be typical for Cynanchum. The thick-walled follicle type is also known from American Cynanchum spp., a strongly supported clade (Liede & Täuber, 2002), here represented by C. laeve. In addition, the laminar, highly fused gynostegial corona, usually considered to be synapomorphic for Cynanchum, is absent in all taxa, and the corona is mostly fused at the base only. The clade comprising the thick-fruited species is poorly supported [BSMP = 39, BSML = 56, posterior probability (PP) = 0.95], but firmly nested in the Cynanchum subtree (unambiguously supported with BSMP = 97, BSML = 100, PP = 1.0). Thick-walled fruits are otherwise rare in Cynanchum (and Cynanchinae), and the only species hitherto analysed with molecular data (C. ovalifolium Wight; Liede & Täuber, 2002) possesses the typical highly fused laminar corona of Cynanchum and was retrieved as a member of a clade of species with slender follicles (Liede & Täuber, 2002). The type species of Cynanchum, C. acutum, is sister to the ‘typical’ Indian Cynanchum species C. callialatum Buch.-Ham. ex Wight and C. tunicatum (Retz.) Alston, but also with weak support (BSMP = 48, BSMP = 60, PP = 0.96). Cynanchum acutum, an extremely widespread species and the only Cynanchum sp. extending into Europe, has evolved rapidly inside Cynanchum, as indicated by its long branch, which is apparent in all three partial datasets. The present data also support the inclusion of the former stem-succulent Sarcostemma in Cynanchum (Meve & Liede-Schumann, 2012) and the origin of the stemsucculent group in Madagascar (Liede & Kunze, 2002), with Indian C. viminale aff. placed in a sister group position to the Madagascan C. obovatum. A more detailed analysis of Cynanchum and its relatives, presently in progress by R. Khanum et al. (unpubl. data), is needed to further clarify the phylogenetic relationships of Cynanchum and the generic structure of Cynanchinae. IMPLICATIONS FOR THE PHYLOGENETICS ASCLEPIADOIDEAE OF Beyond clarifying the position of these enigmatic Indian genera, our dataset allows some conclusions regarding the tribal and subtribal structure of Asclepiadoideae. The position of Eustegia here, as sister to the remaining Asclepiadeae, is not unambiguously supported in the present study (BSMP = 58, BSML = 76, PP = 0.99), but its position as sister to Marsdenieae + Ceropegieae in Rapini et al. (2007) and other phylogenetic analyses is essentially without support (BSML/MP < 20; PP < 0.01; Table S3). Eustegia + Asclepiadeae receives moderate support for all combinations involving rps16, whereas Eustegia + Ceropegieae + Marsdenieae receives negligible support (Table S3). The latter alternative is only preferred by the trnL/trnL-F data (Fig. 2, Table S3). Morphologically, the pendent pollinia of Eustegia (Bruyns, 1999: Fig. 3) also suggest a closer relationship to Asclepiadeae than to Marsdenieae + Ceropegieae. In the light of currently available information (conflicting rps16 and trnL/trnL-F signal, rbcL generally ambiguous), it is best to treat Eustegia (and the closely related Emicocarpus) as a separate tribe, Eustegieae, as suggested by Rapini et al. (2007) and recently formalized by Endress, Liede-Schumann & Meve (2014), to reflect the position of this relictual genus. Thus, Asclepiadoideae could be understood to comprise five tribes, two of which, Eustegieae and the first-branching Fockeeae, comprise only two small African genera each. Inside the well-supported (BSMP = 84, BSML = 88, PP = 1.0) Old World Asclepiadeae, four major lineages can be recognized: Schizostephanus alatus Hochst. ex K.Schum., Cynanchinae, Tylophorinae and Asclepiadinae. Schizostephanus Hochst. ex K.Schum., a genus of two species from Africa (Bruyns & Klak, 2009), is commonly considered to be a member of Cynanchinae, because of its highly fused tubular outer corona. The molecular support for its inclusion in Cynanchinae in previous studies (Rapini et al., 2007; Bruyns & Klak, 2009; Liede-Schumann et al., 2012), however, was weak at best. Bootstrapping and Bayesian PP show a slight preference for a sister relationship with Asclepiadinae and Tylophorinae based on our dataset; all other phylogenetic alternatives are essentially without support (Fig. 2, inset; Table S3). The genus probably represents a relictual African lineage of Asclepiadeae. The relationships of the three more © 2014 The Linnean Society of London, Botanical Journal of the Linnean Society, 2014, 174, 601–619 614 S. SURVESWARAN ET AL. A 100 85/82/92 77 <10/<20/61 Tylophorinae Asclepiadinae ASCLEPIADEAE 56 41/<20/<20 91 <10/73/<91 Schizostephanus alatus 100 63/<20/94 100 64/73/98 Cynanchinae 87 <10/51/89 100 <20/90/96 81 <10/<10/81 New World clade 100 96/100/100 Eustegia minuta 95 33/93/18* 100 59/99/29* 100 94/93/94 99 41/84/51 100 98/100/68 100 92/84/68 100 99/99/<20* 98 94/95/48* EUSTEGIEAE 100 84/100/100 99 30/96/na* 100 100/100/100 Stapeliinae Anisotominae 100 94/100/100 Leptadenia Heterostemma Hoya MARSDENIEAE Non-Hoya subclade 100 100/94/98 FOCKEEAE 0.01 expected subst./site Secamonoideae 95 B 100 59/99/29 (100/96/1.0) 33/93/18 C (65/58/0.94) 81 <10/<10/81 (76/58/0.99) Stap. AS. Anis. EU. 13 <10/51/<10 (17/10/–) MA.+CE. FO. Lept. Other Het. Sec. CEROPEGIEAE 97 51/79/37 Astephaninae D <10 <10/<10/16 (13/23/0.28) 54 <10/<10/31 (57/34/0.45) Ascl. Tyl. Schiz. Cyn. – <10/<1/50 (–/<5/–) 19 <10/<10/18 (13/15/0.27) Other Figure 2. A, Maximum likelihood (ML) tree obtained with RAxML based on combined rbcL, trnL/L- F region and rps16 intron data, but excluding six taxa that are only represented by rbcL data. Numbers indicate maximum likelihood bootstrap support (BSML) based on the concatenated matrix (above branches) and based on the single-locus matrices (below branches) in the following order: rbcL; trnL/L- F; rps16. *, rps16-based support probably affected by missing data for a number of taxa. B, Phylogenetic signals competing for the placement of Eustegia (EU.) between Asclepiadeae (AS.) and Ceropegieae + Marsdenieae (MA.+CE.), indicating the strong influence of rps16. C, Phylogenetic signals competing for the placement of Leptadenia (Lept.) between Anisotominae (Anis.) and Stapeliinae (Stap.). D, Phylogenetic signals competing for the placement of Schizostephanus (Schiz.) in the Asclepiadeae (Ascl.) crown clade. Only one alternative receives measurable support (BSML > 30; PP > 0.3). Values in parentheses refer to maximum likelihood and maximum parsimony bootstrap support and posterior probability based on the three-locus matrix including all taxa (Fig. 1). © 2014 The Linnean Society of London, Botanical Journal of the Linnean Society, 2014, 174, 601–619 ASIAN ASCLEPIADOIDEAE Three-gene analysis A All taxa Holostemma B Metaplexis Graphistemma Raphistemma Metaplexis Reduced taxon set Graphistemma Raphistemma Seshagiria C. laeve Seshagiria C. laeve C. callialatum C. tunicatum C. callialatum C. tunicatum C. acutum C. acutum Pentarrhinum Glossonema Glossonema Pentarrhinum C. ellipticum Outroot BS = 100 Two-gene analyses C D C. obovatum C. viminale aff. Metaplexis C. ellipticum C. ellipticum C. laeve Metaplexis C. acutum C. callialatum Raphistemma Seshagiria Rem. Asclepiadinae C. acutum Glossonema Pentarrhinum F Metaplexis BS = 100 C. laeve C. acutum C. callialatum C. tunicatum Graphistemma Pergularia [Ascl.] C. ellipticum C. viminale aff. Schizostephanus [unpl.] C. laeve C. acutum C. acutum Pentarrhinum Raphistemma Calciphilia [Ascl.] Solenostemma [Ascl.] C. ellipticum Seshagiria Glossonema Pentarrhinum Raphistemma Oxystelma [Ascl.] C. callialatum C. obovatum C. tunicatum Glossonema C. obovatum C. viminale aff. C. tunicatum C. callialatum Raphistemma Seshagiria C. tunicatum Graphistemma Metaplexis E G C. laeve Graphistemma Glossonema Seshagiria Graphistemma BS = 100 Outroot Outroot Pentarrhinum BS = 100 BS = 100 Outroot Single-gene analyses Holostemma Raphistemma C. obovatum C. viminale aff. C. ellipticum C. obovatum C. viminale aff. C. obovatum C. viminale aff. Glossonema Pentarrhinum Tylophorinae Raphistemma Seshagiria BS = 100 Graphistemma Metaplexis H Outroot C. obovatum C. viminale aff. C. laeve Seshagiria C. ellipticum Glossonema Pentarrhinum C. ellipticum C. laeve Metaplexis C. callialatum Graphistemma C. acutum C. callialatum C. tunicatum Outroot BS = 100 Outroot C. obovatum C. viminale aff. Figure 3. See caption on next page. © 2014 The Linnean Society of London, Botanical Journal of the Linnean Society, 2014, 174, 601–619 BS = 100 615 616 S. SURVESWARAN ET AL. Figure 3. Ambiguous support patterns in the Cynanchinae clade. Shown are (non-comprehensive) bipartition [maximum likelihood (ML) bootstrap] networks based on results of the three-locus, two-locus and single-locus partitioned analyses. Edge lengths are proportional to the frequency of bipartitions in the bootstrap replicate tree sample; only bipartitions are shown that occurred in 10% of bootstrap replicate trees. A, B, Concatenated, three-locus data. C, Only rbcL data. D, Excluding rbcL data. Note the more tree-like structure of the graph compared with other single- or two-locus analyses. E, Only trnL/trnL- F data. The Cynanchinae, Asclepiadinae + Tylophorinae subclades are not resolved in contrast with all other analyses. F, Excluding trnL/trnL- F data. G, Only rps16 data. H, Excluding rps16 data, showing a spider-web-like structure. Bootstrap analyses illustrated in A, C, E and G included all taxa with data. Bootstrap analyses illustrated in B, D, F and H excluded the six species represented only by rbcL data. Abbreviations: Ascl., member of Aclepiadinae; unpl., unplaced in the Asclepideae crown clade. species-rich subtribes to each other are clarified here, for the first time, mainly as a result of a signal from the newly sequenced rps16. The present phylogenetic trees suggest that Tylophorinae and Asclepiadinae are more closely related to each other than to Cynanchinae. The sister group relationship of Tylophorinae and Asclepiadinae is moderately supported (BSMP = 57, BSML = 74, PP = 0.99). Tylophorinae corresponds with the circumscription of Liede-Schumann et al. (2012), with Pentatropis R.Br. ex Wight & Arn. being sister to a large, well-supported genus Vincetoxicum s.l. (Vincetoxicum s.s. + Tylophora; BSMP, BSML = 98, PP = 1.0). Here, the species have been labelled with their names in Tylophora, because the extensive name changes resulting from Liede-Schumann et al. (2012) have not yet been formally published. Asclepiadinae, however, is not so easily circumscribed. As pointed out previously (Goyder, Nicholas & Liede-Schumann, 2007; Fishbein et al., 2011), Pergularia L., Calotropis R.Br. and Kanahia R.Br. are well supported (BSMP = 82, BSML = 94, PP = 1.0) sister to the species-rich Asclepias-type group, which receives full support with all methods. However, three small genera are found attached to core Asclepiadinae, namely Oxystelma, Calciphila and Solenostemma. The position of Oxystelma has some support (BSMP = 52, BSML = 74, PP = 0.79). Its association with Asclepiadinae was evident in the tree of Liede & Täuber (2000: Fig. 2) based on trnT-F spacer sequence data, but support was considered to be too low for inclusion of the genus in Asclepiadinae. Morphologically, the basally inflated, three-dimensional inner staminal corona lobes and the finely ciliate corolla lobes are reminiscent of Pergularia. Support for the position of Solenostemma remains weak (BSMP = 37, BSMP = 45, PP = 0.66), but no alternative placement has been suggested so far (Liede-Schumann et al., 2005, 2012; Goyder et al., 2007). For Calciphila, as for Solenostemma, support for its early-branching position in Asclepiadinae is rather weak, but no alternative placement has ever been suggested. Calciphila, Solenostemma and Oxystelma possibly constitute relics of an earlier radiation of the predecessors of Asclepiadinae in ecologically difficult niches, where they have not been displaced by the more successful ‘modern’ Asclepiadinae-type plants. The sister group relationship of Marsdenieae and Ceropegieae receives strong support with all phylogenetic methods (BSMP = 94, BSML = 98, PP = 1.0), as do Ceropegieae (BSMP = 98, BSML = 100, PP = 1.0) and Marsdenieae (BSMP = 97, BSML = 100, PP = 1.0); Asclepiadeae is somewhat less strongly supported (BSMP = 81, BSML = 85, PP = 1.0). For all three regions, Fockeeae shows least intra-clade divergence. Intra-clade divergence in Ceropegieae and Asclepiadeae is fairly similar throughout, whereas that in Marsdenieae is considerably lower (Table S1). Taking into account that Asclepiadeae has approximately 1.5 times as many species as Ceropegieae and Marsdenieae combined (S. Liede-Schumann & U. Meve, unpubl. data) and is subsequently covered by more taxa in our analyses, the high divergence in Ceropegieae is surprising. Closer analysis reveals that the reason for this disparity lies inside Ceropegieae, with the distance between non-stapeliad Ceropegieae and Stapeliinae being at least as large as that between Ceropegieae and Marsdenieae (Table S2). Little is known about the life span of the plants, but our glasshouse observations do not suggest differences in generation time. Therefore, we suggest that acceleration in sequence diversification is probably linked to the evolutionary novelties of pitfall flowers and succulence in Stapeliinae, initiating rapid radiation in the subtribe in India and in other parts of the Old World (Meve & Liede-Schumann, 2007; Surveswaran et al., 2009). ASCLEPIADOIDEAE OF INDIA With these results, a re-assessment of the asclepiadoid flora of the Indian subcontinent can be attempted. In the most recent Flora of India (Jagtap & Singh, 1999), 40 genera with 212 species are listed for the Indian subcontinent. If recently introduced species are discounted, 36 genera and 206 species remain. Applying recent nomenclatural and classifi- © 2014 The Linnean Society of London, Botanical Journal of the Linnean Society, 2014, 174, 601–619 ASIAN ASCLEPIADOIDEAE catory changes, the number of indigenous genera is reduced to 29, with 10 genera (49 species) belonging to Asclepiadeae, eight genera (85 species) to Ceropegieae and 11 genera (72 species) to Marsdenieae. Ceropegia is the most species-rich genus with 46 species, followed by Hoya R.Br. with 30 species and Vincetoxicum sensu Liede-Schumann et al. (2012) with 24 species. Ten genera are represented by a single species; of these, two are monotypic (Seshagiria and Treutlera). In the sister subfamily Secamonoideae, three genera and 14 species are found in the area. Our dataset comprises 22 of the 29 genera of Asclepiadoideae and two of the three genera of Secamonoideae. It also includes the two monotypic genera and nine of the ten genera represented by a single species in the area, albeit not always from Indian material (Table 2). It is therefore the most comprehensive dataset for Indian Asclepiadoideae analysed to date. It shows that, in Ceropegieae, Indian taxa are found in both the first-branching subclade (Heterostemmatinae) and in more derived positions. In Marsdenieae, the clade structure is too little understood to arrive at further conclusions. In Asclepiadeae, in contrast, the first-branching clade is African (Astephaninae). In both Tylophorinae and Asclepiadinae, a widespread, water-related genus is retrieved as an early-branching group (Oxystelma is riparian, Pentatropis is coastal). In Tylophorinae, analysed in more detail by Liede-Schumann et al. (2012), Indian taxa are found in derived parts of the tree, and the results of the present study, together with the analysis of Liede & Täuber (2002), suggest a similar position for Indian Cynanchinae. In contrast, there are no Indian taxa in the most derived clades of Asclepiadinae. Another group contributing to the sequence divergence in Ceropegieae is the monotypic Heterostemminae, like Stapeliinae forming a subtree with long branches. However, the current data should not be regarded as representative for Heterostemma, a genus with some 30 species in India, South-East Asia and Australia (Swarupanandan, Sasidharan & Mangaly, 1989; Forster, 1992), which is in need of further study of its phylogenetic history. ACKNOWLEDGEMENTS This paper is based on PhD work of the first author at the University of Hong Kong (HKU). He was funded by a PhD fellowship from HKU, Council for Scientific and Industrial Research (CSIR-India), Department of Science and Technology (DST – SR/FT/LS-100/2011). He thanks Dr Praveen Karanth (Centre for Ecological Sciences, Indian Institute of Science, Bangalore, India) for laboratory facilities and Dr S. R. Yadav, Dr Mayur Y. Kamble, Sharad S. Kamble (Department of Botany, Shivaji University, Kolhapur, India), K. 617 Subrahmanya Prasad and Xue Bine (HKU) for plant materials. S.L.-S. thanks Ulrich Meve (UBT) for help with all aspects of the manuscript, and Angelika Täuber and Margit Gebauer (both UBT) for their untiring laboratory work. G.W.G. acknowledges funding by the Swedish Research Council (VR), grant 621-2008-3726. The insightful comments of Tanya Livshultz (PH) and David Goyder (K) helped to improve the paper. REFERENCES Akaike H. 1974. A new look at the statistical model identification. IEEE Transactions on Automatic Control 19: 716– 723. Ansari MY, Hemadri K. 1971. Seshagiria Ansari et Hemadri – a new genus of Asclepiadaceae from Sahyadri Ranges, India. Indian Forester 97: 126–127. Bruyns PV. 1999. The systematic position of Eustegia R.Br. (Apocynaceae – Asclepiadoideae). Botanische Jahrbücher für Systematik, Pflanzengeschichte und Pflanzengeographie 121: 19–44. Bruyns PV, Klak C. 2009. The rediscovery of Schizostephanus gossweileri and its phylogenetic position. South African Journal of Botany 75: 532–536. Chaturvedi N, Haribal M. 1992. New larval food plants for the common tiger butterfly in India (Lepidoptera: Nymphalidae: Danainae). Tropical Lepidoptera 3: 158. Endress ME, Liede-Schumann S, Meve U. 2007. Advances in Apocynaceae: the enlightenment, an introduction. Annals of the Missouri Botanical Garden 94: 259–267. Endress ME, Liede-Schumann S, Meve U. 2014. An updated classification for Apocynaceae. Phytotaxa 159: 175– 194. Fishbein M, Chuba D, Ellison C, Mason-Gamer RJ, Lynch SP. 2011. Phylogenetic relationships of Asclepias (Apocynaceae) estimated from non-coding cpDNA sequences. Systematic Botany 36: 1008–1023. Fontella Pereira J, Konno TUP. 1999. Contribuição ao estudo das Asclepiadaceae brasileiras, XXXI. Hypolobus E. Fourn., um gênero extinto? Bradea 7: 139–144. Forster PI. 1992. A taxonomic revision of Heterostemma Wight & Arn. (Asclepiadaceae: Stapelieae) in Australia and the West Pacific. Australian Systematic Botany 5: 71–80. Forster PI. 1995. Circumscription of Marsdenia (Asclepiadaceae: Marsdenieae) with a revision of the genus in Australia and Papuasia. Australian Systematic Botany 8: 703–933. Göker M, Grimm GW. 2008. General functions to transform associate data to host data, and their use in phylogenetic inference from sequences with intra-individual variability. BMC Evolutionary Biology 8: 86. Goyder DJ. 2006. A revision of the genus Pergularia L. (Apocynaceae – Asclepiadoideae). Kew Bulletin 61: 245–256. Goyder DJ, Nicholas A, Liede-Schumann S. 2007. Phylogenetic relationships in subtribe Asclepiadinae (Apocynaceae-Asclepiadoideae). Annals of the Missouri Botanical Garden 94: 423–434. © 2014 The Linnean Society of London, Botanical Journal of the Linnean Society, 2014, 174, 601–619 618 S. SURVESWARAN ET AL. Guindon S, Gascuel O. 2003. PhyML: a simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Systematic Biology 52: 696–704. Holm RW. 1950. The American species of Sarcostemma R.Br. (Asclepiadaceae). Annals of the Missouri Botanical Garden 37: 477–560. Huelsenbeck JP, Ronquist F. 2001. MrBayes – a program for the Bayesian inference of phylogeny. Bioinformatics 17: 754–755. Hurvich CM, Tsai C-L. 1989. Regression and time series model selection in small samples. Biometrika 76: 297– 307. Jagtap AP, Singh NP. 1999. Asclepiadaceae and Periplocaceae. In: Fascicles of flora of India. Fascicle 24. Calcutta: Botanical Survey of India, 1–332. Liede S. 1996. A revision of Cynanchum (Asclepiadaceae) in Africa. Annals of the Missouri Botanical Garden 83: 283– 345. Liede S. 1997. Subtribes and genera of the tribe Asclepiadeae (Apocynaceae – Asclepiadoideae) – a synopsis. Taxon 46: 233–247. Liede S. 2001. Molecular considerations on the subtribe Astephaninae Endl. ex Meisn. (Apocynaceae – Asclepiadoideae). Annals of the Missouri Botanical Garden 88: 657– 668. Liede S, Kunze H. 2002. Cynanchum and the Cynanchinae (Apocynaceae – Asclepiadoideae) – a molecular, anatomical and latex triterpenoid study. Organisms, Diversity & Evolution 2: 239–269. Liede S, Meve U, Täuber A. 2002. What is the subtribe Glossonematinae (Apocynaceae – Asclepiadoideae)? – A phylogenetic study based on cpDNA spacer. Botanical Journal of the Linnean Society 139: 145–158. Liede S, Täuber A. 2000. Sarcostemma R.Br. (Apocynaceae – Asclepiadoideae) – a controversial generic circumscription reconsidered: evidence from trnL-F spacers. Plant Systematics and Evolution 225: 133–140. Liede S, Täuber A. 2002. Circumscription of the genus Cynanchum (Apocynaceae – Asclepiadoideae). Systematic Botany 27: 789–801. Liede-Schumann S, Kong HH, Meve U, Thiv M. 2012. Vincetoxicum and Tylophora (Apocynaceae: Asclepiadoideae: Asclepiadeae) – two sides of the same medal: independent shifts from tropical to temperate habitats. Taxon 61: 803– 825. Liede-Schumann S, Meve U. 2006. Calciphila, a new genus in African Asclepiadeae (Apocynaceae, Asclepiadoideae), and taxonomic rectifications in Cynanchum. Novon 16: 368–373. Liede-Schumann S, Rapini A, Goyder DJ, Chase MW. 2005. Phylogenetics of the New World subtribes of Asclepiadeae (Apocynaceae-Asclepiadoideae): Metastelmatinae, Oxypetalinae, and Gonolobinae. Systematic Botany 30: 184– 200. Livshultz T, Mead JV, Goyder DJ, Brannin M. 2011. Climate niches of milkweeds with plesiomorphic traits (Secamonoideae, Apocynaceae) and the milkweed sister group link ancient African climates and floral evolution. American Journal of Botany 98: 1966–1977. Livshultz T, Middleton DJ, Endress ME, Williams C. 2007. Phylogeny of Apocynoideae and the APSA clade (Apocynaceae s.l.). Annals of the Missouri Botanical Garden 94: 324–359. Martin KP. 2003. Plant regeneration through somatic embryogenesis on Holostemma ada-kodien, a rare medicinal plant. Plant Cell, Tissue and Organ Culture 72: 79–82. Meve U, Liede S. 2004. Subtribal division of Ceropegieae (Apocynaceae-Asclepiadoideae). Taxon 53: 61–72. Meve U, Liede-Schumann S. 2007. Ceropegia (Apocynaceae, Ceropegieae, Stapeliinae): paraphyletic, but still taxonomically sound. Annals of the Missouri Botanical Garden 94: 392–406. Meve U, Liede-Schumann S. 2012. Taxonomic dissolution of Sarcostemma (Apocynaceae: Asclepiadoideae). Kew Bulletin 67: 751–758. Mitra S, Mukherjee SK. 2007. Reassessment and diversity of endemic angiospermic genera of India. Journal of Economic and Taxonomic Botany 31: 163–176. Müller KF. 2005. The efficiency of different search strategies for estimating parsimony, jackknife, bootstrap, and Bremer support. BMC Evolutionary Biology 5: 58. Omlor R. 1998. Generische Revision der Marsdenieae (Asclepiadaceae). Aachen: Shaker. Pattengale ND, Masoud A, Bininda-Emonds ORP, Moret BME, Stamatakis A. 2009. How many bootstrap replicates are necessary? In: Batzoglou S, ed. RECOMB 2009. Berlin, Heidelberg: Springer-Verlag, 184–200. Posada D. 2008. jModelTest: phylogenetic model averaging. Molecular Biology and Evolution 25: 1253–1256. Posada D, Buckley TR. 2004. Model selection and model averaging in phylogenetics: advantages of the Akaike information criterion and Bayesian approaches over likelihood ratio tests. Systematic Biology 53: 793–808. Rahman MA, Wilcock CC. 1991. A taxonomic revision of the Asiatic genus Pentasacme (Asclepiadaceae). Blumea 36: 109–121. Rapini A, Chase MW, Goyder DJ, Griffiths J. 2003. Asclepiadeae classification: evaluating the phylogenetic relationships of New World Asclepiadoideae (Apocynaceae). Taxon 52: 33–50. Rapini A, Van den Berg C, Liede-Schumann S. 2007. Diversification of Asclepiadoideae (Apocynaceae) in the New World. Annals of the Missouri Botanical Garden 94: 407– 422. Reeves G, Chase MW, Goldblatt P, Rudall P, Fay MF, Cox AV, Lejeune B, Souza-Chies T. 2001. Molecular systematics of Iridaceae: evidence from four plastid DNA regions. American Journal of Botany 88: 2074–2087. Ronquist F, Huelsenbeck JP. 2003. MRBAYES 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19: 1572–1574. Schwarz G. 1978. Estimating the dimension of a model. Annals of Statistics 6: 461–464. Shirôzu T. 1960. Butterflies of Formosa in colour. Osaka: Hoikusha. Stamatakis A. 2006. Phylogenetic models of rate heterogeneity: a high performance computing perspective. In: Pro- © 2014 The Linnean Society of London, Botanical Journal of the Linnean Society, 2014, 174, 601–619 ASIAN ASCLEPIADOIDEAE ceedings of 20th IEEE/ACM International Parallel and Distributed Processing Symposium (IPDPS2006), High Performance Computational Biology Workshop, Rhodos, Greece, April 2006. Available at: http://ieeexplore.ieee.org/xpls/ abs_all.jsp?arnumber=1639535 Stamatakis A, Hoover P, Rougemont J. 2008. A rapid bootstrap algorithm for the RAxML web servers. Systematic Biology 57: 758–771. Sugiura N. 1978. Further analysis of the data by Akaike’s information criterion and the finite corrections. Communications in Statistics–Theory and Methods A7: 13–26. Surveswaran S, Kamble MY, Yadav SR, Sun M. 2009. Molecular phylogeny of Ceropegia (Asclepiadoideae, Apocynaceae) from Indian Western Ghats. Plant Systematics and Evolution 281: 51–63. Swarupanandan K, Sasidharan N, Mangaly JK. 1989. A reconsideration of the generic circumscription of Heterostemma Wight & Arn. (Asclepiadaceae) and a new species 619 from India. Botanical Journal of the Linnean Society 101: 249–259. Swofford DL. 2003. PAUP*. Phylogenetic analysis using parsimony (*and other methods), 4th edn. Sunderland, MA: Sinauer Associates. Taberlet P, Gielly L, Pautou G, Bouvet J. 1991. Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Molecular Biology 17: 1105–1109. Turner IM. 2013. Robinson a century on: the nomenclatural relevance of Roxburgh’s Hortus Bengalensis. Taxon 62: 152– 172. Verhoeven RL, Liede S, Endress ME. 2003. The tribal position of Fockea and Cibirhiza (Apocynaceae – Asclepiadoideae): evidence from pollinium structure and cpDNA sequence data. Grana 42: 70–81. Zwickl DJ. 2006. Genetic algorithm approaches for the phylogenetic analysis of large biological sequence datasets under the maximum likelihood criterion. PhD Dissertation, University of Texas. SUPPORTING INFORMATION Additional Supporting Information may be found in the online version of this article at the publisher’s web-site: Table S1. Tabulation of inter-tribal pairwise genetic distances. Gradual cell shading reflects pairwise distances: dark green, highly similar pair; red, relatively dissimilar pair. The diagonal indicates the maximum intra-clade distance. Table S2. Tabulation of inter-tribal pairwise genetic distances, with Stapeliinae separated. Gradual cell shading reflects pairwise distances: dark green, highly similar pair; red, relatively dissimilar pair. The diagonal indicates the maximum intra-clade distance. Table S3. Results of the jackknifing experiment. Shown is the support of selected bipartitions in the taxon set (clades in a rooted tree) based on non-parametric bootstrapping under maximum likelihood (ML-BS) using the following matrices (taxa only represented by rbcL data not included): a matrix with all three combined plastid regions and one matrix each covering all two-locus combinations. Gradual shading reflects support: dark green, BSML = 100; red, BSML < 20. Splits that received BSML ≥ 80 from one or several single-locus analyses are shown in bold. It should be noted that BSML is generally highest for the combined data, but also generally higher for the two-locus matrices including rps16. This illustrates the lack of incompatible signal in the combined partitions and the high phylogenetic decision potential of rps16 regarding relationships at and above the genus level in Asclepiadoideae. The results of the comprehensive analysis (Fig. 1) are given for comparison. © 2014 The Linnean Society of London, Botanical Journal of the Linnean Society, 2014, 174, 601–619