&lt;p&gt;&lt;strong&gt;A new species of &lt;em&gt;Boesenbergia&lt;/em&gt; and rediscovery of &lt;em&gt;B. rotunda&lt;/em&gt; (Zingiberaceae) from India&lt;/strong&gt;&lt;/p&gt;

mamiyil sabu

A new species of Boesenbergia from northeast India is described and illustrated. Besides, the rediscovery of B. rotunda from India after a century is reported. In addition to morphology, data from anatomy, molecular biology and pollen morphology are also used.

Phytotaxa 197 (3): 186–196 www.mapress.com/phytotaxa/ Copyright © 2015 Magnolia Press ISSN 1179-3155 (print edition) Article PHYTOTAXA ISSN 1179-3163 (online edition) http://dx.doi.org/10.11646/phytotaxa.197.3.2 A new species of Boesenbergia and rediscovery of B. rotunda (Zingiberaceae) from India AISHWARYA, K.1, M.R. VINITHA2, GEORGE THOMAS2 & M. SABU1* 1 Department of Botany, University of Calicut, Kerala 673635, India. Plant Molecular Biology, Rajiv Gandhi Centre for Biotechnology, Thiruvananthapuram, Kerala 695014, India, *Email: msabu9@gmail.com 2 Abstract A new species of Boesenbergia from northeast India is described and illustrated. Besides, the rediscovery of B. rotunda from India after a century is reported. In addition to morphology, data from anatomy, molecular biology and pollen morphology are also used. Introduction The genus Boesenbergia Kuntze (1891: 685) comprises about 80 species throughout tropical Asia (Saensouk & Larsen, 2002). Baker (1890) described 6 species and recorded three taxa under imperfectly known and undescribed species [as Gastrochilus Wallich (1829: 22)]. In addition, B. rotunda Linnaeus (1753: 2) Mansfield (1958: 239) was also described, but as Kaempferia pandurata Roxburgh (1810: 328). Das & Sikdar (1982) described six species from India occurring mainly in North-eastern and Peninsular India, and Andaman and Nicobar Islands. Sabu et al. (2004) transferred Kaempferia siphonantha King ex Baker (1890: 222), described from Andaman Islands, to Boesenbergia. Recently, in the review of B. longiflora Wallich (1829: 22) Kuntze (1891: 685), Mood et al. (2013) added five new related species out of which three are represented in India. As part of the revision of Zingiberaceae in India, a few specimens were collected, which do not match with any of the known species. To confirm the novelty of the species, anatomical, molecular and palynological aspects were also studied in addition to morphology. The species B. rotunda was first reported by Linnaeus (1753) as Curcuma rotunda (1753: 2) as native of India based on the material of Rheede (1690: t.10) cited as ‘Manja-kua’. Based on that Nicolson et al. (1988) and thereafter Manilal (2003) reported it to be occurring on forest margins in Malabar. A specimen sent by Dr. Charles Cambell from Sumatra to the Botanic Garden at Calcutta which Roxburgh (1810, 1820) described as K. pandurata along with icons via., Roxburgh’s icon no.1765 (K!) and t.2 (1810). Graham (1839), on the authority of Nimmo, noted this as occurring in Konkans and Gujarat. But, Dalzell & Gibson (1861: suppl. 87) inserted this species as not indigenous to Western India and added “K. pandurata being described as found in South Concan by Nimmo, we beg on this head to solicit information, as we have been unable to trace it”. Baker (1890) included this species based on the specimens of Graham (from Concan & Gujarat) and Kurz (from South Andaman Islands). Probably, based on the above literature Schumann (1904) reported the species as native of India. Cooke (1907) also described this species, but with the note that they haven’t seen any specimen. Later, Das & Sikdar (1982) described the species in ‘Review on the genus Boesenbergia from India’ based on a specimen from Manipur but left it untraceable without furnishing the details of the herbarium in which it is deposited. Under these circumstances, it can be concluded that B. rotunda was not reported from India based on original material after 1869 (collection of Kurz from South Andaman), although it was reported to be cultivated there (Holtum, 1950 and Burtt & Smith, 1983) We could collect a number of specimens of Boesenbergia from different parts of India. After a detailed study, the specimen collected from Umran, Meghalaya is identified as B. rotunda. A thorough perusal of literature and a comparison of the present specimen with the relevant herbaria and illustrations were carried out. The illustrations or 186 Accepted by Zhi-Qiang Zhang: 7 Jan. 2015; published: 16 Feb. 2015 Molecular study A phylogenetic analysis was carried out based on nucleotide sequences (Tab. 3) of the plastid matK and nuclear internal transcribed spacer (ITS) regions. For that, we sequenced eight species of Boesenbergia from India. Etlingera linguiformis (Roxb.) Smith (1986: 246) was chosen as outgroup. Only six species (including the outgroup) yielded ITS sequence by direct sequencing. TABLE 3. Primers used for sequencing Gene Primer name Annealing Temp. Sequence matK F 45ºC, 50ºC CGATCTATTCATTCAATATTTC R 45ºC, 50ºC TCTAGCACACGAAAGTCGAAGT ITS F5 58ºC AATGGTCCGGTGAAGTGTTC ITS R2 58ºC CTCGCCGTTACTAGGGGAAT ITS Phylogenetic trees constructed using matK (Fig. 4) and ITS (Fig. 5) sequence data are highly supportive to consider B. meghalayensis (Boesenbergia sp. 72.2 in the trees) as a new species. This species is nesting in a distinct clade along with B. rotunda in both the trees, supported by a bootstrap value of 100 % for ITS and 94 % for matK. In the tree constructed using ITS sequences, the two species differs from each other at a much higher level than that between B. hamiltonii Mood et al. (2013: 80) and B. maxwellii Mood et al. (2013: 72); the clade formed by B. hamiltonii and B. maxwellii is also supported by 100% bootstrap value. In the tree constructed using matK sequences, B. meghalayensis differs from B. rotunda at the same level as B. hamiltonii and B. kingii Mood & Prince (Mood et al., 2013) differs from each other; the clade consisting of B. hamiltonii and B. kingii is supported by 86 % bootstrap value. Acknowledgement The authors are grateful to the Department of Science and Technology, Government of India, for the INSPIRE fellowship (No.DST/INSPIRE Fellowship/2012), the Department of Biotechnology, Government of India, for the financial support (BT/PR15275/PBD/16/917/2011) and the Director, Rajiv Gandhi Centre for Biotechnology for all supports to carry out the molecular work. Thanks are due to all the specimen collectors for their collections and the reviewers for their valuable comments and guidance. References Alston, A.H.G. (1931) Scitamineae. In: Trimen, H. (Ed.) Handbook to the Flora of Ceylon. Vol. 6 (Suppl.). Dulau & Co., Ltd., 32 Old Bond St., W. 1, London, pp. 280–284. Backer, C.A. & Bakhuizen Van Den Brink, R.C. (1968) Flora of Java. Vol. 3. Wolters- Noordhoff N.V.- Groningen, The Netherlands, 69 pp. Baker, J.G. (1890) Scitamineae. In: Hooker, J.D. (Ed.) Flora of British India. Vol. 6. L. Reeve & Co., Ltd. London, pp. 198–264. Burtt, B.L. (1980) Cardamoms and other Zingiberaceae in Hortus Malabaricus. In: Manilal, K.S. (Ed.) The Botany and history of Hortus Malabaricus. A. A. Balkema, Rotterdam, Netherlands/Oxford & IBH, New Delhi, pp. 144–146. Burtt, B.L. & Smith, R.M. (1972) Key species in the taxonomic history of Zingiberaceae. notes from the Royal Botanic Garden, Edinburgh 31: 177–228. Burtt, B.L. & Smith, R.M. (1983) Zingiberaceae. In: Dassanayake, M.D. (Ed.) A revised handbook to the Flora of Ceylon. vol. 4. Amerind Publishing Co. Pvt. Ltd., New Delhi, pp. 488–532. Cooke, T. (1907) Flora of Presidency of Bombay. vol. 3. Botanical Survey of India, Calcutta, 232 pp. Dalzell, N.A. & Gibson, A. (1861) The Bombay Flora. Supplement. Education Society’s Press, Byculla, 87 pp. Dan, H.N., Suresh, C.R. & Manilal, K.S. (1988) An interpretation of Van Rheede’s Hortus Malabaricus. Koelz Scientific Books D-6240 Konigstein, Federal Republic of Germany, 315 pp. Das, C.R. & Sikdar, J.K. (1982) Review on the genus Boesenbergia (Scitamineae) from India. Bulletin of the Botanical Society of Bengal B. RoTUnDA (ZINGIBERACEAE) Phytotaxa 197 (3) © 2015 Magnolia Press • 195 36: 39–46. Graham, J. (1839) Catalogue of the plants growing in Bombay and its vicinity. Government Press, Bombay, 205–211 pp. Holttum, R.E. (1950) Zingiberaceae of the Malay Peninsula. Gardens’ Bulletin Singapore 13: 1–249. Kuntze, O. (1891) Revisio Genera Plantarum. Vol. 2. Dulau & Co., London, pp. 682–698. Lindley J. (1816) The Botanical Register. Vol. 2. Ridgways, London, 173 pp. Linnaeus, C. (1753) Species Plantarum. Vol. 1. Stockholm, pp. 1–2. Loesener, T. (1930) Zingiberaceae. In: Engler, A. & K. Prantl. (Eds.) Die naturliche Pflanzenfamilien. Vol. 15 a. ed. 2. Engelmann, Leipzig, 570 pp. Manilal, K.S. (2003) Van Rheede’s Hortus Malabaricus. English ed. Vol. 11. University of Kerala, Thiruvananthapuram, t.10. Mansfield, R. (1958) Kulturpflanze. Bericht und Mitteilungen aus dem Institut für Kulturpflanzenforschung der Deutschen Akademie der Wissenschaften zu Berlin in Gatersleben Krs. Aschersleben. Vol. 6. Akademie-Verlag, Berlin, 239 pp. Mood, J.D., Prince, L.M., Veldkamp, J.F. & Santanu, D. (2013) The history and identity of Boesenbergia longiflora (Zingiberaceae) and descriptions of five related new taxa. Gardens’ Bulletin Singapore 65(1): 47–95. Rheede tot Drakestein, H.V. (1690) Hortus Indicus Malabaricus :continens regni Malabarici apud Indos cereberrimi onmis generis plantas rariores, latinas, Malabaricis, Arabicis, Brachmanum charactareibus hominibusque expressas. Vol. 11. Amstelaedami : sumptibus Johannis van Someren, et Joannis van Dyck, t. 10. [in Latin] Ridley, H.N. (1899) The Scitamineae of the Malay Peninsula. Journal of the Straits Branch of the Royal Asiatic Society 32: 85–184. Ridley, H.N. (1924) The Flora of the Malay Peninsula. Vol. 4. L. Reeve & Co., Ltd., London, 233–285 pp. Roscoe, W. (1807) A new arrangement of the plants of the Monandrian class usually called Scitamineae. Transactions of the linnean Society 8: 330–356. http://dx.doi.org/10.1111/j.1096-3642.1807.tb00321.x Roscoe, W. (1828) Monandrian plants of the order Scitamineae. Liverpool. Roxburgh, W. (1810) Descriptions of several of the Monandrous plants of India. [Calcutta] Asiatic Researches or Transactions of the Society 11: 318–362. t.2. Roxburgh, W. (1820) Flora Indica. Vol. 1. Today & Tomorrow’s printers & publishers. New Delhi, pp. 17–18. Saensouk, S. & Larsen, K. (2002) Boesenbergia baimaii, a new species of Zingiberaceae from Thailand. nordic Journal of Botany 21: 595–597. http://dx.doi.org/10.1111/j.1756-1051.2001.tb00818.x Schlechter, R. (1913) Die Gattungen Gastrochilus Don. Und Gastrochilus Wall. In: Fedde, F. (Ed.) Feddes Repertorium. Vol. 12. Dahlem, Berlin, pp. 313–317. Schumann, K. (1904) Zingiberaceae. In: Engler, A. (Ed.) Das Pflanzenreich. Vol. 4(46). Leipzig, pp. 1–45. Sirirugsa, P. (1992) A revision of the genus Boesenbergia Kuntze (Zingiberaceae) in Thailand. natural History Bulletin of the Siam Society 40: 67–90. Smith, R.E. (1986) New combinations in Etlingera. notes from the Royal Botanic Garden, Edinburgh 43(2): 246. Cooke, T. (1907) Flora of Presidency of Bombay. Vol. 3. Botanical Survey of India, Calcutta, pp. 228–251. Wallich, N. (1829) Plantae Asiaticae Rariores. Vol. 1. Treuttel & Würtz, Treuttel Jun. & Richter, London, pp. 22–23. Wight, R. (1853) Icones Plantarum Indiae orientalis. Vol. 6. Messrs. Ostell, Lepage & Co., Calcutta; H. Dailliere, London, 16 pp. 196 • Phytotaxa 197 (3) © 2015 Magnolia Press AISHWARYA ET Al.

Log In

<p><strong>A new species of <em>Boesenbergia</em> and rediscovery of <em>B. rotunda</em> (Zingiberaceae) from India</strong></p>

<p><strong>A new species of <em>Boesenbergia</em> and rediscovery of <em>B. rotunda</em> (Zingiberaceae) from India</strong></p>

Related Papers

RELATED PAPERS