Large multi-locus plastid phylogeny of the tribe Arundinarieae (Poaceae: Bambusoideae) reveals ten major lineages and low rate of molecular divergence

Jimmy Triplett

The temperate bamboos (tribe Arundinarieae) are notorious for being taxonomically extremely difficult. China contains some of the world’s greatest diversity of the tribe Arundinarieae, with most genera and species endemic. Previous investigation into phylogenetic relationships of the temperate bamboos revealed several major clades, but emphasis on the species-level relationships among taxa in North America and Japan. To further elucidate relationships among the temperate bamboos, a very broad sampling of Chinese representatives was examined. We produced 9463 bp of sequences from eight non-coding chloroplast regions for 146 species in 26 genera and 5 outgroups. The loci sequenced were atpI/H, psaA-ORF170, rpl32-trnL, rpoB-trnC, rps16-trnQ, trnD/T, trnS/G, and trnT/L. Phylogenetic analyses using maximum parsimony and Bayesian inference supported the monophyly of Arundinarieae. The two major subtribes, Arundinariinae and Shibataeinae, defined on the basis of different synflorescence types, were indicated to be polyphyletic. Most genera in this tribe were confirmed to be paraphyletic or polyphyletic. The cladograms suggest that Arundinarieae is divided into ten major lineages. In addition to six lineages suggested in a previous molecular study (Bergbamboes, the African alpine bamboos, Chimonocalamus, the Shibataea clade, the Phyllostachys clade, and the Arundinaria clade), four additional lineages were recovered in our results, each represented by a single species: Gaoligongshania megalothyrsa, Indocalamus sinicus, Indocalamus wilsonii, Thamnocalamus spathiflorus. Our analyses also indicate that (1) even more than 9000 bp of fast-evolving plastid sequence data cannot resolve the inter- and infra-relationships among and within the ten lineages of the tribe Arundinarieae; (2) an extensive sampling is indispensable for phylogeny reconstruction in this tribe, especially given that many genera appear to be paraphyletic or polyphyletic. Perhaps the ideal way to further illuminate relationships among the temperate bamboos is to sample multiple nuclear loci or whole chloroplast sequences in order to obtain sufficient variation.

Molecular Phylogenetics and Evolution 56 (2010) 821–839 Contents lists available at ScienceDirect Molecular Phylogenetics and Evolution journal homepage: www.elsevier.com/locate/ympev Large multi-locus plastid phylogeny of the tribe Arundinarieae (Poaceae: Bambusoideae) reveals ten major lineages and low rate of molecular divergence Chun-Xia Zeng a,b,c,1, Yu-Xiao Zhang a,b,c,1, Jimmy K. Triplett d, Jun-Bo Yang a,c, De-Zhu Li a,c,* a Key Laboratory of Biodiversity and Biogeography, Kunming Institute of Botany, Chinese Academy of Sciences, Kunming, Yunnan 650204, PR China Graduate University of Chinese Academy of Sciences, Beijing 100049, PR China c Plant Germplasm and Genomics Center, Germplasm Bank of Wild Species, Kunming, Yunnan 650204, PR China d Department of Biology, National Museum of Natural History, MRC 166, Smithsonian Institution, Washington, DC 20013-7012, USA b a r t i c l e i n f o Article history: Received 30 December 2009 Revised 31 March 2010 Accepted 31 March 2010 Available online 8 April 2010 Keywords: Arundinarieae China Chloroplast DNA regions Large sample size Phylogenetic analysis a b s t r a c t The temperate bamboos (tribe Arundinarieae) are notorious for being taxonomically extremely difficult. China contains some of the world’s greatest diversity of the tribe Arundinarieae, with most genera and species endemic. Previous investigation into phylogenetic relationships of the temperate bamboos revealed several major clades, but emphasis on the species-level relationships among taxa in North America and Japan. To further elucidate relationships among the temperate bamboos, a very broad sampling of Chinese representatives was examined. We produced 9463 bp of sequences from eight non-coding chloroplast regions for 146 species in 26 genera and 5 outgroups. The loci sequenced were atpI/H, psaA-ORF170, rpl32-trnL, rpoB-trnC, rps16-trnQ, trnD/T, trnS/G, and trnT/L. Phylogenetic analyses using maximum parsimony and Bayesian inference supported the monophyly of Arundinarieae. The two major subtribes, Arundinariinae and Shibataeinae, defined on the basis of different synflorescence types, were indicated to be polyphyletic. Most genera in this tribe were confirmed to be paraphyletic or polyphyletic. The cladograms suggest that Arundinarieae is divided into ten major lineages. In addition to six lineages suggested in a previous molecular study (Bergbamboes, the African alpine bamboos, Chimonocalamus, the Shibataea clade, the Phyllostachys clade, and the Arundinaria clade), four additional lineages were recovered in our results, each represented by a single species: Gaoligongshania megalothyrsa, Indocalamus sinicus, Indocalamus wilsonii, Thamnocalamus spathiflorus. Our analyses also indicate that (1) even more than 9000 bp of fast-evolving plastid sequence data cannot resolve the inter- and infra-relationships among and within the ten lineages of the tribe Arundinarieae; (2) an extensive sampling is indispensable for phylogeny reconstruction in this tribe, especially given that many genera appear to be paraphyletic or polyphyletic. Perhaps the ideal way to further illuminate relationships among the temperate bamboos is to sample multiple nuclear loci or whole chloroplast sequences in order to obtain sufficient variation. Ó 2010 Elsevier Inc. All rights reserved. 1. Introduction The grass subfamily Bambusoideae (true bamboos) as currently circumscribed encompasses ca. 80–90 genera and 1000–1500 species distributed in temperate regions to mountains of the tropics worldwide, with the highest species richness in Asia Pacific and South America and the least in Africa (Bystriakova et al., 2003a,b). The subfamily has been resolved as monophyletic (GPWG, 2001), consisting of members from the woody bamboo tribes Bambuseae s.s (Kunth ex Dumort.) and Arundinarieae Nees ex Ascherson and * Corresponding author at: Key Laboratory of Biodiversity and Biogeography, Kunming Institute of Botany, Chinese Academy of Sciences, Kunming, Yunnan 650204, PR China. Fax: +86 871 5217791. E-mail addresses: dzl@mail.kib.ac.cn, dzl2005@hotmail.com (D.-Z. Li). 1 These authors contributed equally to this work. 1055-7903/$ - see front matter Ó 2010 Elsevier Inc. All rights reserved. doi:10.1016/j.ympev.2010.03.041 Graebner, and their herbaceous allies in tribe Olyreae Kunth ex Spenner (Clark et al., 1995; GPWG, 2001; Bouchenak-Khelladi et al., 2008; Sungkaew et al., 2009). The temperate bamboo tribe Arundinarieae is primarily distributed in the North Temperate Zone or at high elevations in the Old World tropics. There are approximately 32 genera and 600 temperate bamboo species, most of which are distributed in China and Japan (Li, 1999; Ohrnberger, 1999). Arundinarieae is a highly diversified group with different habits (e.g., erect, arching, scandent, twining, and decumbent) and complex features of morphology, including pachymorph or leptomorph rhizomes, solitary to many branches, semelauctant or iterauctant synflorescences, 3–6 stamens, and bacoid, nucoid or basic caryopsis (Keng and Wang, 1996; Li et al., 2006; Yang et al., 2008; Yi et al., 2008). Based on morphological and anatomical characters, the temperate bamboos are usually divided into two subtribes, Arundinariinae and 822 C.-X. Zeng et al. / Molecular Phylogenetics and Evolution 56 (2010) 821–839 Table 1 Classification system of temperate bamboos by Li (1997). Tribe Bambuseae Subtribe Arundinariinae Acidosasa (Metasasa), Ampelocalamus, Arundinaria (incl. Bashania, Pleioblastus), Chimonocalamus, Drepanostachyum (incl. Himalayacalamus), Ferrocalamus, Gaoligongshania, Gelidocalamus, Indocalamus, Oligostachyum, Pseudosasa, Sasa, Sinarundinaria (incl. Borinda, Yushania), Thamnocalamus (Fargesia) Subtribe Shibatainae Chimonobambusa, Indosasa, Phyllostachys, Qiongzhuea, Semiarundinaria (Brachystachyum), Shibataea, Sinobambusa Shibataeinae, but with different treatments of genera within these subtribes (Soderstrom and Ellis, 1987; Dransfield and Widjaja, 1995; Li, 1997). Various molecular data sets, including sequence data from the chloroplast genome (Ní Chonghaile, 2002; Triplett, 2008; Sungkaew et al., 2009) and nuclear GBSSI and ITS regions (Guo et al., 2001, 2002; Guo and Li, 2004; Zhuge et al., 2004; Peng et al., 2008), as well as amplified fragment length (AFLP) data (Triplett, 2008; Triplett et al., 2010) have been utilized to analyze the temperate bamboos. These molecular phylogenetic studies support Arundinarieae as a natural group, but relationships within the tribe remain unclear. Most recently, phylogenetic analyses based on chloroplast DNA regions (including rpoB-trnC, rps16trnQ, trnD/T, and trnT/L intergenic spacers) provided additional insights into the relationships within Arundinarieae (Triplett, 2008; Triplett and Clark, 2010). The tribe was resolved to include six major lineages: Bergbamboes, the African alpine bamboos, Chimonocalamus, the Shibataea clade, the Phyllostachys clade, and the Arundinaria clade. That study also emphasized species-level relationships among taxa in Japan and North America, but had relatively limited sampling of Chinese species. In total, about 25 genera and 380 species of Arundinarieae occur in China (Keng and Wang, 1996; Li et al., 2006), representing approximatively 4/5 and 2/3 of the total number of genera and species in the tribe, respectively. Of these taxa, most genera and species are endemic to China. Therefore, the inclusion of these Chinese taxa in molecular systematic studies of Arundinarieae is indispensable for producing a comprehensive, phylogeny-based classification of the tribe. To date, no phylogenetic analysis has been performed utilizing a comprehensive sampling of these species. In this paper, representatives from all subtribes and most genera of Arundinarieae in China according to Li (1997; Table 1) were sequenced for eight chloroplast DNA regions (atpI/H, psaA-ORF170, rpl32-trnL, rpoB-trnC, rps16-trnQ, trnD/T, trnS/G, and trnT/L intergenic spacers) for a combined phylogenetic analysis. The aim of this study was to generate and analyze a large multigene sequence matrix that includes a better representation of the tribe than previous studies. The main goals were: (1) to identify the major clades and inter-relationships of these clades within tribe Arundinarieae, (2) to study molecular variation among different chloroplast regions and to assess their value for phylogenetic studies in this group, and (3) to identify potential sources of information for further clarifying the phylogeny of the temperate bamboos. 2. Materials and methods 2.1. Terminology Most scientific names of species follow Suzuki (1978), Li et al. (2006) and Clark and Triplett (2007). Those of Bashania, Brachystachyum, Metasasa, Pseudosasa guanxianensis and P. hirta follow Keng and Wang (1996), and Pseudosasa nanningensis follows Zhang and Li (in press). Five recently described species were included in our study: Bashania abietina (Yi and Yang, 1998), Bashania aristata (Ren et al., 2003), Bashania qiaojiaensis (Yi et al., 2007a), Indocal- amus jinpingensis (Yi et al., 2007b), and Indosasa jinpingensis (Yi, 2001). Subtribal assignments in the classification of Li (1997; Table 1) were adopted for this study. 2.2. Taxon sampling Based on prior studies (Clark et al., 1995; GPWG, 2001; Bouchenak-Khelladi et al., 2008; Triplett, 2008; Sungkaew et al., 2009), Bonia amplexicaulis, Bonia levigata, Neomicrocalamus prainii, Bambusa ventricosa, and Dendrocalamus farinosus of the tribe Bambuseae were chosen as outgroups. The ingroup taxa were chosen in order to include representatives for as many taxonomic groups as possible within the tribe Arundinarieae. Type species for genera and other subdivisions were included whenever material was available. DNA sequences from a total of 160 taxa in 30 genera were generated for this study from herbarium specimens or silica-dried plant material. In addition, sequences of Yushania alpina (K. Schumann) Lin were retrieved from GenBank (Triplett and Clark, 2010). Table 2 lists all species sequenced for this study and their sources. 2.3. Choice of markers In order to obtain phylogenetic resolution at species and generic levels within the ingroup, fast-evolving markers are needed. Triplett (2008) and Triplett and Clark (2010) identified twelve chloroplast regions that were useful for the study of the temperate bamboos, including the intergenic spacers atpI/H, ndhF (30 end), psaAORF170, rpl32-trnL, rpoB-trnC, rps16-trnQ, trnD/T, trnG intron, trnH-psbA, trnK-rps16, trnT/L, and trnV-ndhC. After several pilot studies, we also identified atpI/H, psaA-ORF170, rpl32-trnL, rpoBtrnC, rps16-trnQ, trnD/T, and trnT/L as being especially useful for our target group, plus the region trnS/G. Because of the low apparent evolutionary rate in the temperate bamboos, there is a substantial advantage in combining chloroplast regions to provide sufficient information to supported resolution within genera. Thus, each accession was sequenced for all eight of these chloroplast regions. 2.4. DNA extraction, amplification and sequencing Total genomic DNA was extracted from silica gel-dried leaves or herbarium specimens using a modified CTAB procedure (Doyle and Doyle, 1987) or DNeasy Plant Mini Kits (Qiagen, Valencia, California) following the manufacturer’s protocol, with the following modifications: 40–50 mg dry leaf tissue; 500 ll lysis buffer; 20– 30 min incubation; and a final wash with ice cold 100% EtOH. The primers used for amplification and sequencing are listed in Table 3. We used several protocols for different regions. The polymerase chain reaction (PCR) parameters were as follows: for atpI/H, psaA-ORF170, rpl32-trnL, trnD/T, trnS/G, and trnT/L, initial denaturation at 95 °C for 5 min, followed by 35 cycles of 30 s at 95 °C for denaturation, primer annealing at 50 °C for 1 min, and 1 min 30 s at 72 °C for DNA extension, followed by a final extension period of 7 min at 72 °C; for rpoB-trnC and rps16-trnQ, initial denaturation at 95 °C for 2 min, followed by 35 cycles of denaturation at 95 °C for 1 min, primer annealing at 48 °C for 10 s, followed by a slow Table 2 Voucher information and GenBank accession numbers for taxa used in this study. Voucher specimens are deposited in the following herbaria: KUN = Kunming Institute of Botany, China; SAUD = SiChuan Agricultural University Dujiangyan Campus, China (or SIFS = Sichuan Forestry School Dendrological Herbarium, China). Regions not sampled are indicated by an em dash (—). Description following genus name corresponds to specific characters: L or P = leptomorph or pachymorph rhizomes; S or I = semelauctant or iterauctant synflorescences; two consecutive numbers mean stamens and branches (M = many), respectively. Taxon Arundinarieae Acidosasa (LS63) Acidosasa chinensis C.D.Chu et C.S.Chao Acidosasa chienouensis (Wen) C.S.Chao et Wen Acidosasa edulis Wen Acidosasa guangxiensis Q.H.Dai et C.F.Huang Acidosasa nanunica (MaClure) C.S. Chao et G.Y.Yang Ampelocalamus (PS3M) Ampelocalamus actinotrichus (Merr. et Chun) S.L.Chen et al. Ampelocalamus patellaris (Gamble) Stapleton Ampelocalamus scandens Hsueh et W.D.Li Source GenBank No. atpI/H psaAORF170 rpl32-trnL rpoB-trnC rps16trnQ trnD/T trnS/G trnT/L Zhang 08035 (KUN) Zhang 08065 (KUN) Zhang 08042 (KUN) Huang 07017 (KUN) Zhang & Zeng 06112 (KUN) Zhang 08061 (KUN) Zhang 07067 (KUN) Guangdong, China Fujian, China Fujian, China Guangxi, China Hunan, China GU355045 GU355047 GU355056 GU355016 GU355019 GU355365 GU355367 GU355376 GU355336 GU355339 GU355525 GU355527 GU355536 GU355496 GU355499 GU354407 GU354409 GU354418 GU354378 GU354381 GU354565 GU354567 GU354576 GU354536 GU354539 GU354725 GU354727 GU354736 GU354696 GU354699 GU355205 GU355207 GU355216 GU355176 GU355179 GU354885 GU354887 GU354896 GU354856 GU354859 Fujian, China Yunnan, China GU355049 GU355020 GU355369 GU355340 GU355529 GU355500 GU354411 GU354382 GU354569 GU354540 GU354729 GU354700 GU355209 GU355180 GU354889 GU354860 Zeng & Zhang 06054 (KUN) Zhang 07075 (KUN) Zhen-Hua Guo 013 (KUN) Hainan, China GU355081 GU355401 GU355561 — GU354601 GU354761 GU355241 GU354921 Yunnan, China Yunnan, China GU355082 GU355118 GU355402 GU355438 GU355562 GU355598 — GU354478 GU354602 GU354638 GU354762 GU354798 GU355242 GU355278 GU354922 GU354958 North Carolina, United States Arkansas, United States South Carolina, United States GU355021 GU355341 GU355501 GU354383 GU354541 GU354701 GU355181 GU354861 GU355135 GU355024 GU355455 GU355344 GU355615 GU355504 GU354495 GU354386 GU354655 GU354544 GU354815 GU354704 GU355295 GU355184 GU354975 GU354864 Arundinaria (LS33) Arundinaria appalachiana Triplett Triplett 184 (ISC) Arundinaria gigantea (Walter) Muhl. Arundinaria tecta (Walter) Muhl Zhang US1025 (KUN) Triplett 173 (ISC) Bashania (LS3(1–3 to M)) Bashania abietina T.P.Yi et L.Yang Bashania aristata Y.Ren, Y.Li et G.D.Dang Bashania fangiana (A. Camus) Keng f. et Wen Bashania fargesii (Camus) P.C.Keng et Yi Bashania qiaojiaensis Hsueh et Yi Bashania qingchengshanensis P.C.Keng et T.P.Yi Bashania spanostachya Yi Zhang 07092 Zhang 08080 Lu 071104 (KUN) Zhang 08083 (KUN) Zhang 07046 (KUN) Zhang 07085 (KUN) Zhang 07093 (KUN) Sichuan, China Shaanxi, China Sichuan, China Shaanxi, China Yunnan, China Sichuan, China Sichuan, China GU355143 GU355063 GU355017 GU355062 GU355142 GU355145 GU355144 GU355463 GU355383 GU355337 GU355382 GU355462 GU355465 GU355464 GU355623 GU355543 GU355497 GU355542 GU355622 GU355625 GU355624 GU354503 GU354425 GU354379 GU354424 GU354502 GU354505 GU354504 GU354663 GU354583 GU354537 GU354582 GU354662 GU354665 GU354664 GU354823 GU354743 GU354697 GU354742 GU354822 GU354825 GU354824 GU355303 GU355223 GU355177 GU355222 GU355302 GU355305 GU355304 GU354983 GU354903 GU354857 GU354902 GU354982 GU354985 GU354984 Zeng & Zhang 06174 (KUN) Zhejiang, China GU355127 GU355447 GU355607 GU354487 GU354647 GU354807 GU355287 GU354967 Chimonobambusa (PI33) Chimonobambusa macrophylla Wen et Ohrnb Chimonobambusa sichuanensis (T.P.Yi) T.H.Wen Chimonobambusa szechuanensis (Rendle) P.C.Keng Zhang 07091 (KUN) Zhang 07084 (KUN) Lu 2711 (KUN) Sichuan, China Sichuan, China Sichuan, China GU355122 GU355011 GU355124 GU355442 GU355331 GU355444 GU355602 GU355491 GU355604 GU354482 GU354373 GU354484 GU354642 GU354531 GU354644 GU354802 GU354691 GU354804 GU355282 GU355171 GU355284 GU354962 GU354851 GU354964 Chimonocalamus (PS33) Chimonocalamus dumosus Hsueh et Yi Chimonocalamus fimbriatus Hsueh et Yi Chimonocalamus longiusculus Hsueh et Yi Chimonocalamus montanus Hsueh et Yi Chimonocalamus pallens Hsueh et Yi Zhang 07061 (KUN) Zeng et al. 08020 (KUN) Zhang 07064 (KUN) Zhang 07057 (KUN) Zhang 07071 (KUN) Yunnan, Yunnan, Yunnan, Yunnan, Yunnan, GU355039 GU355036 GU355037 GU355038 GU355059 GU355359 GU355356 GU355357 GU355358 GU355379 GU355519 GU355516 GU355517 GU355518 GU355539 GU354401 GU354398 GU354399 GU354400 GU354421 GU354559 GU354556 GU354557 GU354558 GU354579 GU354719 GU354716 GU354717 GU354718 GU354739 GU355199 GU355196 GU355197 GU355198 GU355219 GU354879 GU354876 GU354877 GU354878 GU354899 Drepanostachyum (PS3M) Drepanostachyum ampullare (T.P.Yi) Demoly Drepanostachyum hookerianum (Munro) P.C.Keng GLM 081860 (KUN) DZL 199903 (KUN) Xizang, China Kew, Britain GU355079 GU355116 GU355399 GU355436 GU355559 GU355596 GU354441 GU354476 GU354599 GU354636 GU354759 GU354796 GU355239 GU355276 GU354919 GU354956 Brachystachyum ((L or P)I33) Brachystachyum densiflorum (Rendle) Keng China China China China China C.-X. Zeng et al. / Molecular Phylogenetics and Evolution 56 (2010) 821–839 Acidosasa notata (Z.P.Wang et G.H.Ye)S.S.You Acidosasa purpurea (Hsueh et Yi) Keng f. Voucher/herbarium Fargesia (PS3M) 823 (continued on next page) 824 Table 2 (continued) Taxon Fargesia Fargesia Fargesia Fargesia Fargesia Fargesia Fargesia Voucher/herbarium decurvata J.L.Lu edulis Hsueh et Yi; fungosa T.P.Yi macclureana (Bor) Stapleton nitida (Mitford) Keng f. et Yi qinlingensis Yi et J.X .Shao robusta Yi Ferrocalamus (LS31) Ferrocalamus rimosivaginus Wen Ferrocalamus strictus Hsueh et P.C.Keng Gelidocalamus (LS3(7–12)) Gelidocalamus rutilans Wen Gelidocalamus sp1. Gelidocalamus sp2. Gelidocalamus tessellatus Wen et J.Q.Zhang GenBank No. atpI/H psaAORF170 rpl32-trnL rpoB-trnC rps16trnQ trnD/T trnS/G trnT/L Zhang 07087 (KUN) Li & Zhang 07051 (KUN) Zhang 07048 (KUN) GLM 082064 (KUN) Zhang KMBG10 (KUN) Zhang 08079 (KUN) Zhang 08014 (KUN) Hubei, China Yunnan, China Yunnan, China Xizang, China Sichuan, China Shaanxi, China Sichuan, China GU355073 GU355130 GU355129 GU355085 GU355120 GU355086 GU355083 GU355393 GU355450 GU355449 GU355405 GU355440 GU355406 GU355403 GU355553 GU355610 GU355609 GU355565 GU355600 GU355566 GU355563 GU354435 GU354490 GU354489 GU354445 GU354480 GU354446 GU354443 GU354593 GU354650 GU354649 GU354605 GU354640 GU354606 GU354603 GU354753 GU354810 GU354809 GU354765 GU354800 GU354766 GU354763 GU355233 GU355290 GU355289 GU355245 GU355280 GU355246 GU355243 GU354913 GU354970 GU354969 GU354925 GU354960 GU354926 GU354923 Zhang 07068 (KUN) Zeng & Zhang SB1 (KUN) Yunnan, China Yunnan, China GU355095 GU355096 GU355415 GU355416 GU355575 GU355576 GU354455 GU354456 GU354615 GU354616 GU354775 GU354776 GU355255 GU355256 GU354935 GU354936 JRX 9401 (KUN) Yunnan, China GU355121 GU355441 GU355601 GU354481 GU354641 GU354801 GU355281 GU354961 Zeng & Zhang 06183 (KUN) Zeng & Zhang Jing (KUN) Zeng & Zhang 06180 (KUN) Zeng & Zhang 06200 (KUN) Zhejiang, China GU355151 GU355471 GU355631 GU354511 GU354671 GU354831 GU355311 GU354991 Guangdong, China Zhejiang, China GU355094 GU355152 GU355414 GU355472 GU355574 GU355632 GU354454 GU354512 GU354614 GU354672 GU354774 GU354832 GU355254 GU355312 GU354934 GU354992 Guangxi, China GU355155 GU355475 GU355635 GU354515 GU354675 GU354835 GU355315 GU354995 Himalayacalamus (PS3M) Himalayacalamus falconeri (Munro) P.C.Keng GLM 081524 (KUN) Xizang, China GU355080 GU355400 GU355560 GU354442 GU354600 GU354760 GU355240 GU354920 Indocalamus (LS31) Indocalamsu aff. latifolius (Keng) McClure Triplett 243 (KUN) Tennessee, United States Guangxi, China GU355146 GU355466 GU355626 GU354506 GU354666 GU354826 GU355306 GU354986 GU355093 GU355413 GU355573 GU354453 GU354613 GU354773 GU355253 GU354933 Sichuan, China GU355148 GU355468 GU355628 GU354508 GU354668 GU354828 GU355308 GU354988 Guangxi, China GU355104 GU355424 GU355584 GU354464 GU354624 GU354784 GU355264 GU354944 Sichuan, China GU355101 GU355421 GU355581 GU354461 GU354621 GU354781 GU355261 GU354941 Guangdong, China GU355099 GU355419 GU355579 GU354459 GU354619 GU354779 GU355259 GU354939 Zhejiang, China GU355103 GU355423 GU355583 GU354463 GU354623 GU354783 GU355263 GU354943 Guangxi, China Shaanxi, China, Yunnan, China Zhejiang, China GU355147 GU355107 GU355042 GU355100 GU355467 GU355427 GU355362 GU355420 GU355627 GU355587 GU355522 GU355580 GU354507 GU354467 GU354404 GU354460 GU354667 GU354627 GU354562 GU354620 GU354827 GU354787 GU354722 GU354780 GU355307 GU355267 GU355202 GU355260 GU354987 GU354947 GU354882 GU354940 Guangxi, China GU355150 GU355470 GU355630 GU354510 GU354670 GU354830 GU355310 GU354990 Hainan, China GU355089 GU355409 GU355569 GU354449 GU354609 GU354769 GU355249 GU354929 Guangxi, China GU355098 GU355418 GU355578 GU354458 GU354618 GU354778 GU355258 GU354938 Hainan, China GU355153 GU355473 GU355633 GU354513 GU354673 GU354833 GU355313 GU354993 Indocalamus barbatus McClure Indocalamus bashanensis (C.D.Chu et C.S.Chao) H.R.Zhao et Y.L.Yang Indocalamus decorus Q.H.Dai Indocalamus emeiensis C.D.Chu et C.S.Chao Indocalamus guangdongensis H.R.Zhao et Y.L. Yang Indocalamus herklotsii McClure Indocalamus Indocalamus Indocalamus Indocalamus hirsutissimus Z.P.Wang et P.X.Zhang hirtivaginatus H.R.Zhao et Y.L.Yang jinpingensis T.P.Yi et al. latifolius (Keng) McClure Indocalamus longiauritus Handel-Mazzetti Indocalamus pseudosinicus McClure Indocalamus quadratus H.R.Zhao et Y.L.Yang Indocalamus sinicus (Hance) Nakai Zeng & Zhang 06198 (KUN) Zhang 07083 (KUN) Zeng & Zhang 06208 (KUN) Zeng & SD Zhang 07001 (KUN) Zeng & Zhang 06156 (KUN) Zeng & Zhang 06147 (KUN) Zhang 07033 (KUN) Yi 06016 (SAUD = SIFS) Zeng et al. 08022 (KUN) Zeng & Zhang 06128 (KUN) Zeng & Zhang 06211 (KUN) Zeng & Zhang 06068 (KUN) Zeng & Xing 06001 (KUN) Zeng & Zhang 06081 (KUN) C.-X. Zeng et al. / Molecular Phylogenetics and Evolution 56 (2010) 821–839 Gaoligongshania (PS31) Gaoligongshania megalothyrsa (Handel-Mazzetti) D.Z.Li, Hsueh et N.H.Xia Source Indocalamus sinicus (Hance) Nakai Indocalamus tessellatus (Munro) P.C.Keng Guangdong, China Zhejiang, China GU355154 GU355149 GU355474 GU355469 GU355634 GU355629 GU354514 GU354509 GU354674 GU354669 GU354834 GU354829 GU355314 GU355309 GU354994 GU354989 Fujian, China Zhejiang, China GU355043 GU355109 GU355363 GU355429 GU355523 GU355589 GU354405 GU354469 GU354563 GU354629 GU354723 GU354789 GU355203 GU355269 GU354883 GU354949 Chongqing, China GU355105 GU355425 GU355585 GU354465 GU354625 GU354785 GU355265 GU354945 Hubei, China Guangdong, China GU355106 GU355108 GU355426 GU355428 GU355586 GU355588 GU354466 GU354468 GU354626 GU354628 GU354786 GU354788 GU355266 GU355268 GU354946 GU354948 Guangxi, China Zhejiang, China GU355066 GU355002 GU355386 GU355322 GU355546 GU355482 GU354428 GU354364 GU354586 GU354522 GU354746 GU354682 GU355226 GU355162 GU354906 GU354842 Fujian, China Guangdong, China Yunnan, China Guizhou, China Guangxi, China Guangxi, China Guangxi, China Guangdong, China GU355048 GU355006 GU355041 GU355008 GU355010 GU355012 GU355013 GU355040 GU355368 GU355326 GU355361 GU355328 GU355330 GU355332 GU355333 GU355360 GU355528 GU355486 GU355521 GU355488 GU355490 GU355492 GU355493 GU355520 GU354410 GU354368 GU354403 GU354370 GU354372 GU354374 GU354375 GU354402 GU354568 GU354526 GU354561 GU354528 GU354530 GU354532 GU354533 GU354560 GU354728 GU354686 GU354721 GU354688 GU354690 GU354692 GU354693 GU354720 GU355208 GU355166 GU355201 GU355168 GU355170 GU355172 GU355173 GU355200 GU354888 GU354846 GU354881 GU354848 GU354850 GU354852 GU354853 GU354880 Indosasa spongiosa C.S.Chao et B.M.Yang Indosasa triangulata Hsueh et Yi Zhang 07014 (KUN) Zhang & Zeng 06139 (KUN) Zhang 08067 (KUN) Zhang 08026 (KUN) Zhang et al. 08021 (KUN) Zhang 07040 (KUN) Zhang 07028 (KUN) Zhang 07030 (KUN) Zhang 07001 (KUN) Zhang & Zeng 06088 (KUN) Zhang 07022 (KUN) Zhang 07072 (KUN) Guangxi, China Yunnan, China GU355014 GU355015 GU355334 GU355335 GU355494 GU355495 GU354376 GU354377 GU354534 GU354535 GU354694 GU354695 GU355174 GU355175 GU354854 GU354855 Metasasa (LS62) Metasasa carinata W.T.Lin Zhang 08031 (KUN) Guangdong, China GU355044 GU355364 GU355524 GU354406 GU354564 GU354724 GU355204 GU354884 Zhang & Zeng 06071 (KUN) Zhang 07089 (KUN) Zhang & Zeng 06150 (KUN) Zhang & Zeng 06151 (KUN) Zhang 07011 (KUN) Zhang 07007 (KUN) DZL 09122 (KUN) Hainan, China GU355018 GU355338 GU355498 GU354380 GU354538 GU354698 GU355178 GU354858 Hubei, China Zhejiang, China GU355033 GU355035 GU355353 GU355355 GU355513 GU355515 GU354395 GU354397 GU354553 GU354555 GU354713 GU354715 GU355193 GU355195 GU354873 GU354875 Zhejiang, China GU355022 GU355342 GU355502 GU354384 GU354542 GU354702 GU355182 GU354862 Guangxi, China Guangxi, China Hongkong, China GU355004 GU355034 GU355070 GU355324 GU355354 GU355390 GU355484 GU355514 GU355550 GU354366 GU354396 GU354432 GU354524 GU354554 GU354590 GU354684 GU354714 GU354750 GU355164 GU355194 GU355230 GU354844 GU354874 GU354910 Zhang 07024 (KUN) Guangxi, China GU355023 GU355343 GU355503 GU354385 GU354543 GU354703 GU355183 GU354863 Zhang KMBG04 (KUN) PSH14 (KUN) Zhang 08078 (KUN) Zhang KMBG07 (KUN) Yunnan, Yunnan, Yunnan, Yunnan, GU355134 GU355061 GU355060 GU355133 GU355454 GU355381 GU355380 GU355453 GU355614 GU355541 GU355540 GU355613 GU354494 GU354423 GU354422 GU354493 GU354654 GU354581 GU354580 GU354653 GU354814 GU354741 GU354740 GU354813 GU355294 GU355221 GU355220 GU355293 GU354974 GU354901 GU354900 GU354973 Zhang Zhang Zhang (KUN) Zhang 07082 (KUN) 07080 (KUN) & Zeng 06157 Sichuan, China Yunnan, China Zhejiang, China GU355132 GU355069 GU355025 GU355452 GU355389 GU355345 GU355612 GU355549 GU355505 GU354492 GU354431 GU354387 GU354652 GU354589 GU354545 GU354812 GU354749 GU354705 GU355292 GU355229 GU355185 GU354972 GU354909 GU354865 08056 (KUN) Fujian, China GU355054 GU355374 GU355534 GU354416 GU354574 GU354734 GU355214 GU354894 Zhejiang, China GU355026 GU355346 GU355506 GU354388 GU354546 GU354706 GU355186 GU354866 Zhejiang, China GU355046 GU355366 GU355526 GU354408 GU354566 GU354726 GU355206 GU354886 Indocalamus tongchunensis K.F.Huang et Z.L.Dai Indocalamus victorialis P.C.Keng Indocalamus wilsonii (Rendel) C.S.Chao et C.D.Chu Indocalamus wilsonii (Rendel) C.S.Chao et C.D.Chu Indocalamus wuxiensis Yi Indosasa (LI63) Indosasa crassiflora McClure Indosasa gigantea (Wen) Wen Indosasa Indosasa Indosasa Indosasa Indosasa Indosasa Indosasa Indosasa gigantea (Wen) Wen hispida McClure jinpingensis Yi lipoensis C.D.Chu et K.M.Lan patens C.D.Chu et C.S.Chao shibataeoides McClure sinica C.D.Chu et C.S.Chao sp. Oligostachyum ((L or P)S(3 or 4 (5))3) Oligostachyum gracilipes (McClure) G.H.Ye et Z.P.Wang Oligostachyum hupehense (J.L.Lu) Z.P.Wang et G.H.Ye Oligostachyum lubricum (Wen) Keng f. Oligostachyum oedogonatum (Z.P.Wang et G.H.Ye) Q.F.Zhang et K.F.Huang Oligostachyum paniculatum G.H.Ye et Z.P.Wang Oligostachyum scabriflorum (McClure) Z.P.Wang et G.H.Ye Oligostachyum shiuyingianum (Chia et But) G.H.Ye et Z.P.Wang Oligostachyum sulcatum Z.P.Wang et G.H.Ye Phyllostachys (LI32) Phyllostachys edulis (Carriere) Houzeau Phyllostachys heteroclada Oliver Phyllostachys nidularia Munro Phyllostachys nigra (Loddiges ex Lindley) Munro Pleioblastus (LS3(3–7)) Pleioblastus amarus (Keng) P.C.Keng Pleioblastus argenteostriatus (Regel.)Nakai Pleioblastus gramineus (Bean) Nakai Pleioblastus hsienchuensis var. subglabratus (S.Y.Chen) C.S.Chao et G.Y.Yang Pleioblastus intermedius S.Y.Chen Pleioblastus juxianensis Wen et al. Zhang & Zeng 06188 (KUN) Zhang & Zeng 06136 China China China China 825 (continued on next page) C.-X. Zeng et al. / Molecular Phylogenetics and Evolution 56 (2010) 821–839 Zhang 08034 (KUN) Zeng & Zhang 06176 (KUN) Zhang 08075 (KUN) Zeng & Zhang 06152 (KUN) Zeng & SD Zhang 07119 (KUN) Zhang 07088 (KUN) Zeng & Zhang 06094 (KUN) 826 Table 2 (continued) Taxon Voucher/herbarium Pleioblastus maculatus (McClure) C.D.Chu et C.S.Chao Pleioblastus pygmaeus (Miquel) Nakai Pleioblastus sanmingensis S.Y.Chen et G.Y.Sheng Pleioblastus solidus S.Y.Chen Pleioblastus sp. Pleioblastus wuyishanensis Q.F.Zheng et K.F.Huang Pleioblastus yixingensis S.L.Chen et S.Y.Chen Pseudosasa amabilis (McClure) Keng f. Pseudosasa amabilis var. convexa Z.P.Wang et G.H.Ye Pseudosasa cantorii (Munro) Keng f. Pseudosasa gracilis S.L.Chen et G.Y.Sheng Pseudosasa Pseudosasa Pseudosasa Pseudosasa Pseudosasa guanxianensis Yi hindsii (Munro) C.D.Chu et C.S.Chao hirta S.L.Chen et G.Y.Sheng japonica (Sieb. et Zucc.) Makino japonica var. tsutsumiana Pseudosasa Pseudosasa Pseudosasa Pseudosasa longiligula Wen maculifera J.L.Lu nanningensis (Q.H.Dai) D.Z.Li et Y.Z.Zhang orthotropa S.L.Chen et Wen Pseudosasa viridula S.L.Chen et G.Y.Sheng Sasa (LS61) Sasa guangxiensis C.D.Chu et C.S.Chao Sasa kurilensis (Ruprecht) Makino et Shibata Sasa longiligulata McClure Zhang & Zeng 06186 (KUN) Zhang & Zeng 06140 (KUN) Zhang 08054 (KUN) Zhang & Zeng 06045 (KUN) Zhang & Zeng 06107 (KUN) Zhang 07081 (KUN) Zhang 07013 (KUN) Peng 07096 (KUN) Zhang 07023 (KUN) Zhang & Zeng 06011 (KUN) Zhang 07021 (KUN) Ha 07094 (KUN) Zhang 07002 (KUN) Zhang & Zeng 06161 (KUN) Zhang & Zeng 06164 (KUN) Zeng & Zhang 06197 (KUN) Triplett 223 (KUN) Sasa magnonoda Wen et G. L. Liao Sasa oblongula C.H.Hu Sasa oshidensis Makino et Uchida Zeng & Zhang 06123 (KUN) Yi 06024 (SAUD = SIFS) Zeng & Zhang 06055 Triplett 161 (KUN) Sasa palmata (Mitford) Camus Triplett 228 (KUN) Sasa qingyuanensis (C.H.Hu) C.H.Hu Zeng & Zhang 06182 (KUN) Triplett 146 (KUN) Sasa senanensis (Franchet et Savatier) Rehder GenBank No. atpI/H psaAORF170 rpl32-trnL rpoB-trnC rps16trnQ trnD/T trnS/G trnT/L Yunnan, China Guangdong, China GU355057 GU355088 GU355377 GU355408 GU355537 GU355568 GU354419 GU354448 GU354577 GU354608 GU354737 GU354768 GU355217 GU355248 GU354897 GU354928 Fujian, China Zhejiang, China GU355053 GU355131 GU355373 GU355451 GU355533 GU355611 GU354415 GU354491 GU354573 GU354651 GU354733 GU354811 GU355213 GU355291 GU354893 GU354971 Zhejiang, China GU355087 GU355407 GU355567 GU354447 GU354607 GU354767 GU355247 GU354927 Fujian, China Zhejiang, China GU355055 GU355058 GU355375 GU355378 GU355535 GU355538 GU354417 GU354420 GU354575 GU354578 GU354735 GU354738 GU355215 GU355218 GU354895 GU354898 Zhejiang, China GU355007 GU355327 GU355487 GU354369 GU354527 GU354687 GU355167 GU354847 Zhejiang, China GU355064 GU355384 GU355544 GU354426 GU354584 GU354744 GU355224 GU354904 Fujian, China Guangdong, China GU355050 GU355071 GU355370 GU355391 GU355630 GU355551 GU354412 GU354433 GU354570 GU354591 GU354730 GU354751 GU355210 GU355231 GU354890 GU354911 Guangdong, China GU355029 GU355349 GU355509 GU354391 GU354549 GU354709 GU355189 GU354869 Sichuan, China Guangxi, China Jiangxi, China Guangxi, China Zhejiang, China GU355005 GU355030 GU355065 GU355027 GU355028 GU355325 GU355350 GU355385 GU355347 GU355348 GU355485 GU355510 GU355545 GU355507 GU355508 GU354367 GU354392 GU354427 GU354389 GU354390 GU354525 GU354550 GU354585 GU354547 GU354548 GU354685 GU354710 GU354745 GU354707 GU354708 GU355165 GU355190 GU355225 GU355187 GU355188 GU354845 GU354870 GU354905 GU354867 GU354868 Guangxi, China Henan, China Guangxi, China Zhejiang, China GU355067 GU355068 GU355009 GU355001 GU355387 GU355388 GU355329 GU355321 GU355547 GU355548 GU355489 GU355481 GU354429 GU354430 GU354371 GU354363 GU354587 GU354588 GU354529 GU354521 GU354747 GU354748 GU354689 GU354681 GU355227 GU355228 GU355169 GU355161 GU354907 GU354908 GU354849 GU354841 Zhejiang, China GU355003 GU355323 GU355483 GU354365 GU354523 GU354683 GU355163 GU354843 Guangxi, China GU355092 GU355412 GU355572 GU354452 GU354612 GU354772 GU355252 GU354932 California, United States Guangdong, China GU355137 GU355457 GU355617 GU354497 GU354657 GU354817 GU355297 GU354977 GU355090 GU355410 GU355570 GU354450 GU354610 GU354770 GU355250 GU354930 Jiangxi, China Guangdong, China Tennessee, United States California, United States Zhejiang, China GU355091 GU355112 GU355136 GU355411 GU355432 GU355456 GU355571 GU355592 GU355616 GU354451 GU354472 GU354496 GU354611 GU354632 GU354656 GU354771 GU354792 GU354816 GU355251 GU355272 GU355296 GU354931 GU354952 GU354976 GU355141 GU355461 GU355621 GU354501 GU354661 GU354821 GU355301 GU354981 GU355097 GU355417 GU355577 GU354457 GU354617 GU354777 GU355257 GU354937 Tennessee, United States GU355111 GU355431 GU355591 GU354471 GU354631 GU354791 GU355271 GU354951 C.-X. Zeng et al. / Molecular Phylogenetics and Evolution 56 (2010) 821–839 Pseudosasa (LS(3(4 or 5))(1–3 to M)) Pseudosasa acutivagina Wen et S.C.Chen (KUN) Zhang 07049 (KUN) Zeng & Zhang 06059 (KUN) Zhang 08074 (KUN) Zhang & Zeng 06190 (KUN) Zeng & Zhang 06141 (KUN) Zhang 08062 (KUN) Zhang & Zeng 06134 (KUN) Source Sasa sinica Keng Triplett 126 (KUN) Sasaella (LS61) Sasaella ramosa (Makino) Makino Triplett 140 (KUN) Tennessee, United States GU355113 GU355433 GU355593 GU354473 GU354633 GU354793 GU355273 GU354953 Shibataea (PI3(3 to5)) Shibataea chinensis Nakai Shibataea hispida McClure Shibataea lanceifolia C.H.Hu Shibataea nanpingensis Q.F.Zheng et K.F.Huang PSH s.n. (KUN) PSH 10 (KUN) Zhang 08064 (KUN) Zhang 08060 (KUN) Yunnan, China Zhejiang, China Fujian, China Fujian, China GU355115 GU355114 GU355051 GU355052 GU355435 GU355434 GU355371 GU355372 GU355595 GU355594 GU355531 GU355532 GU354475 GU354474 GU354413 GU354414 GU354635 GU354634 GU354571 GU354572 GU354795 GU354794 GU354731 GU354732 GU355275 GU355274 GU355211 GU355212 GU354955 GU354954 GU354891 GU354892 Zhang & Zeng 06133 (KUN) Zhang & Zeng 06090 (KUN) Zhejiang, China GU355032 GU355352 GU355512 GU354394 GU354552 GU354712 GU355192 GU354872 Guangdong, China GU355031 GU355351 GU355511 GU354393 GU354551 GU354711 GU355191 GU354871 Kew, Britain GU355119 GU355439 GU355599 GU354479 GU354639 GU354799 GU355279 GU354959 spathiflorus (Trin.) Munro spathiflorus var. crassinodus (T.P.Yi) Mcbeath 19901722 (KUN) GLM 081775 (KUN) DZL 199902 (KUN) Xizang, China Kew, Britain GU355074 GU355117 GU355394 GU355437 GU355554 GU355597 GU354436 GU354477 GU354594 GU354637 GU354754 GU354797 GU355234 GU355277 GU354914 GU354957 spathiflorus var. crassinodus (T.P.Yi) GLM 081578 (KUN) Xizang, China GU355076 GU355396 GU355556 GU354438 GU354596 GU354756 GU355236 GU354916 spathiflorus var. crassinodus (T.P.Yi) GLM 081593 (KUN) Xizang, China GU355075 GU355395 GU355555 GU354437 GU354595 GU354755 GU355235 GU354915 tessellatus (Nees) Soderstrom et Ellis DZL 199901 (KUN) Kew, Britain GU355125 GU355445 GU355605 GU354485 GU354645 GU354805 GU355285 GU354965 Zhejiang, China FJ643705 GU355123 FJ643759 GU355443 FJ643788 GU355603 FJ643971 GU354483 FJ643878 GU354643 FJ644064 GU354803 — GU355283 FJ644215 GU354963 Hunan, China GU355126 GU355446 GU355606 GU354486 GU354646 GU354806 GU355286 GU354966 Sichuan, China Yunnan, China Sichuan, China Yunnan, China Xizang, China GU355072 GU355077 GU355084 GU355128 GU355078 GU355392 GU355397 GU355404 GU355448 GU355398 GU355552 GU355557 GU355564 GU355608 GU355558 GU354434 GU354439 GU354444 GU354488 GU354440 GU354592 GU354597 GU354604 GU354648 GU354598 GU354752 GU354757 GU354764 GU354808 GU354758 GU355232 GU355237 GU355244 GU355288 GU355238 GU354912 GU354917 GU354924 GU354968 GU354918 Zeng & Zhang SB5 (KUN) Zeng & Zhang 06076 (KUN) Yunnan, China Hainan, China GU355160 GU355159 GU355480 GU355479 GU355640 GU355639 GU354520 GU354519 GU354680 GU354679 GU354840 GU354839 GU355320 GU355319 GU355000 GU354999 Bambusa (PI6M) Bambusa ventricosa McClure Zhang KMBG09 (KUN) Yunnan, China GU355158 GU355478 GU355638 GU354518 GU354678 GU354838 GU355318 GU354998 Dendrocalamus (PI6M) Dendrocalamus farinosus (Keng et Keng f.)Chia et H. L.Fung Zhang SB2701 (KUN) Yunnan, China GU355157 GU355477 GU355637 GU354517 GU354677 GU354837 GU355317 GU354997 Neomicrocalamus (PI6M) Neomicrocalamus prainii (Gamble) Keng f. LL07236 (KUN) Xizang, China GU355156 GU355476 GU355636 GU354516 GU354676 GU354836 GU355316 GU354996 Sasa sp2. Sinobambusa (LI33) Sinobambusa intermedia McClure Sinobambusa tootsik (Sieb.) Makino Thamnocalamus (PS3(3 to M)) Thamnocalamus spathiflorus (Trin.) Munro Thamnocalamus Thamnocalamus Stapleton Thamnocalamus Stapleton Thamnocalamus Stapleton Thamnocalamus Yushania (PS3 (1 to M)) Yushania alpina (K.Schumann) Lin Yushania baishanzuensis Z.P.Wang et G.H.Ye Yushania basihirsuta (McClure) Z.P.Wang et G.H.Ye Yushania Yushania Yushania Yushania Yushania brevipaniculata (Hand.-Mazz.) Yi crassicollis Yi maculata Yi qiaojiaensis Hsueh et T.P.Yi yadongensis Yi Bambuseae Bonia (PI61) Bonia amplexicaulis (L.C.Chia et al.) N.H.Xia Bonia levigata (L.C.Chia et al.) N.H.Xia Triplett and Clark (2010) Zeng & Zhang 06181 (KUN) Zeng & Zhang 06108 (KUN) Zhang 08005 (KUN) Liuj 08032 (KUN) Zhang 08006 (KUN) Zhang 07044 (KUN) GLM 081767 (KUN) GU355102 GU355422 GU355582 GU354462 GU354622 GU354782 GU355262 GU354942 Guangdong, China GU355110 GU355430 GU355590 GU354470 GU354630 GU354790 GU355270 GU354950 Guangdong, China GU355140 GU355460 GU355620 GU354500 GU354660 GU354820 GU355300 GU354980 Tennessee, United States Tennessee, United States GU355139 GU355459 GU355619 GU354499 GU354659 GU354819 GU355299 GU354979 GU355138 GU355458 GU355618 GU354498 GU354658 GU354818 GU355298 GU354978 827 Sasa veitchii (Carriere) Rehder Sasa sp1. Zhejiang, China C.-X. Zeng et al. / Molecular Phylogenetics and Evolution 56 (2010) 821–839 Sasa tsuboiana Makino Zeng & Zhang 06175 (KUN) Zeng & Zhang 06098 (KUN) Zeng & Zhang 06092 (KUN) Triplett 133 (KUN) 828 C.-X. Zeng et al. / Molecular Phylogenetics and Evolution 56 (2010) 821–839 Table 3 Chloroplast DNA primers used for amplification (A) and sequencing (S). Region Name UUC Primer sequence (50 –30 ) Source Amp/Seq trnS/G trnG trnSGCU GTAGCGGGAATCGAACCCGCATC AGATAGGGATTCGAACCCTCGGT Shaw et al. (2005) Shaw et al. (2005) A, S A, S trnD/T trnD-for trnT-rev trnE-for trnY-rev ACCAATTGAACTACAATCCC CCCTTTTAACTCAGTGGTA GCCTCCTTGAAAGAGAGATG CTCTTTGCTTTGGATCTAG Demesure et al. (1995) Triplett (2008) and Triplett and Clark (2010) Doyle et al. (1992) Triplett (2008) and Triplett and Clark (2010) A A S S rpoB-trnC trnC rpoB Jt400-for Jt700-rev TGGGGATAAAGGATTTGCAG ATTGTGGACATTCCCTCRTT CAGGTCCGAACAGCATTA CGTAGTAGTAGAATTGCTAG Yamane and Kawahara (2005) Yamane and Kawahara (2005) Triplett (2008) and Triplett and Clark (2010) Triplett (2008) and Triplett and Clark (2010) A A S S trnT/L trnTL for trnTL rev CATTACAAATGCGATGCTCT TCTACCGATTTCGCCATATC Taberlet et al. (1991) Taberlet et al. (1991) A, S A, S psaA-ORF170 psaA ORF170 TCGAAATCGTGAGCATCAGC TCTCAAGTACGGTTCTAGG Saltonstall (2001) Saltonstall (2001) A, S A, S rpl32-trnL trnLUAG rpl32-F CTGCTTCCTAAGAGCAGCGT CAGTTCCAAAAAAACGTACTTC Shaw et al. (2007) Shaw et al. (2007) A, S A, S atpI/H atpI atpH TATTTACAAGYGGTATTCAAGCT CCAAYCCAGCAGCAATAAC Shaw et al. (2007) Shaw et al. (2007) A, S A, S rps16-trnQ 1F 1574R 334F 628R GCACGTTGCTTTCTACCACA ATCCTTCCGTCCCAGATTTT CGAGATGGTCAATCCTGAAATG CTTTTGGTATTCKAGTCGAAG Triplett Triplett Triplett Triplett ramp of 0.3 °C/s to 65 °C, and primer extension at 65 °C for 5 min. A final extension step consisted of 5 min at 65 °C. Alternative protocols for atpI/H, psaA-ORF170, rpl32-trnL, rps16-trnQ, trnD/T, trnS/G, and trnT/L were 1 cycle of 2 min at 95 °C, followed by 35 cycles of 1 min at 95 °C, 10 s at 48 °C or 50 °C, ramped to 65 °C at 0.3 °C/s, and 1 min 30 s at 65 °C, followed by 1 cycle of 10 min at 65 °C; for rpoB-trnC 1 cycle of 2 min at 95 °C, followed by 35 cycles of 1 min at 95 °C, 10 s at 46 °C, ramped to 65 °C at 0.1 °C/s, and 1 min 30 s at 65 °C, followed by 1 cycle of 10 min at 65 °C. Reactions were performed with 0.2 lM of each primer, 10 mM Tris– HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2, 200 lM of each dNTP, 1 U Taq DNA polymerase, and 10–50 ng of template DNA per 25 ll reaction volume. Reaction products were purified using Watson’s purification kit prior to sequencing. Double-stranded and purified PCR products were sequenced by the dideoxy chain termination method with ABI PRISM Bigdye Terminator Cycle Sequencing Ready Reaction Kit with AmpliTaq DNA polymerase FS (Perkin-Elmer). Reactions and programs were chosen according to the recommendations of the handbook, with slight modification in some cases. Samples were electrophoresed in an ABI 3700, ABI 3730 or ABI 3730xl automated sequencer. 2.5. Sequence alignment and phylogenetic analyses Base determination was complete and unambiguous in all cases. DNA sequences were edited with SeqMan (DNASTAR Package), aligned by Clustal X (Jeanmougin et al., 1998), and adjusted (2008) (2008) (2008) (2008) and and and and Triplett Triplett Triplett Triplett and and and and Clark Clark Clark Clark (2010) (2010) (2010) (2010) A, S A. S S S manually where necessary. Substitution and indels were used as equally probable events. Potentially informative indels that were located in regions of unambiguous alignment were scored following the ‘‘simple indel coding” method (Simmons and Ochoterena, 2000) and added to the matrix as binary presence/absence characters. This provides a useful method to utilize indels as phylogenetically information (Kawakita et al., 2003; Guo and Li, 2004). All data matrices are available in TreeBASE (study accession number SN4974) and all sequences obtained in the present study have been deposited in Genbank (accession numbers are listed in Table 2). To test the phylogenetic effects of analyzing different regions of the chloroplast genome, we ranked the eight intergenic spacers according to the proportion of parsimony-informative (PI) characters as a function of analyzed, aligned sequence length for each gene (Table 4). Based on the PI characters/sequences length, we analyzed the following data partitions for all data sets: (1) rpl32trnL intergenic spacer; (2) rpl32-trnL and trnT/L intergenic spacers; (3) rpl32-trnL, trnT/L, and rps16-trnQ intergenic spacers; (4) rpl32trnL, trnT/L, rps16-trnQ, and rpoB-trnC intergenic spacers; (5) rpl32trnL, trnT/L, rps16-trnQ, rpoB-trnC, and trnD/T intergenic spacers; (6) rpl32-trnL, trnT/L, rps16-trnQ, rpoB-trnC, trnD/T, and atpI/H intergenic spacers; (7) rpl32-trnL, trnT/L, rps16-trnQ, rpoB-trnC, trnD/T, atpI/H, and psaA-ORF170 intergenic spacers; (8) all eight intergenic spacers. Maximum parsimony (MP) analysis was performed with PAUP* 4.0b10 (Swofford, 2003). Heuristic tree searches were conducted with 1000 random addition sequence replicates and TBR branch Table 4 Properties of data partitions used in this study and statistical characteristics resulting from MP analyses. Partition Aligned length Variable characters Informative characters (percentage of total) Tree length CI RI RC Indels rpl32-trnL trnT/L rps16-trnQ rpoB-trnC trnD/T atpI/H psaA-ORF170 trnS/G Combined 966 945 1805 1441 1399 999 983 925 9463 101 89 162 109 106 66 50 56 739 60 (6.21%) 52 (5.50%) 86 (4.76%) 66 (4.58%) 60 (4.29%) 38 (3.80%) 35 (3.56%) 31 (3.35%) 428 (4.52%) 125 118 205 142 131 77 65 70 1037 0.864 0.780 0.834 0.817 0.855 0.909 0.892 0.800 0.756 0.959 0.924 0.943 0.934 0.946 0.959 0.981 0.944 0.912 0.829 0.721 0.786 0.763 0.809 0.871 0.875 0.755 0.690 3 11 21 11 9 5 4 8 72 829 C.-X. Zeng et al. / Molecular Phylogenetics and Evolution 56 (2010) 821–839 Table 5 Best-fitting models and parameter values for separate (trnS/G, trnD/T, rpoB-trnC, trnT/L, psaA-ORF170, rpl32-trnL, atpI/H and rps16-trnQ) and combined datasets in this study. Region AIC selected model trnS/G trnD/T rpoB-trnC trnT/L psaA-ORF170 rpl32-trnL atpI/H rps16-trnQ Combined TVM+G TVM+I+G TVM+I+G TVM+I+G K81uf+I TVM+G K81uf+G K81uf+I+G TVM+I+G Base frequencies Substitution model (rate matrix) A C G T A-C A-G A-T C-G C-T G-T 0.3457 0.3413 0.3412 0.4014 0.3015 0.3634 0.3342 0.3781 0.3522 0.1841 0.1757 0.1577 0.0990 0.1841 0.1445 0.1386 0.1475 0.1543 0.1494 0.1686 0.1518 0.1572 0.1482 0.1326 0.1756 0.1394 0.1522 0.3209 0.3144 0.3490 0.3424 0.3663 0.3595 0.3516 0.3350 0.3413 0.4432 0.3145 0.7091 0.3789 1.0000 1.2315 1.0000 1.0000 0.6177 2.2574 1.2887 1.5560 0.8749 2.2241 2.0040 1.5722 1.4265 1.2584 0.1300 0.1816 0.0195 0.0986 0.4646 0.3587 0.3374 0.3677 0.1828 0.9519 0.8289 0.6449 0.0503 0.4646 1.2344 0.3374 0.3677 0.5385 2.2574 1.2887 1.5560 0.8749 2.2241 2.0040 1.5722 1.4265 1.2584 1.0000 1.0000 1.0000 1.0000 1.0000 1.0000 1.0000 1.0000 1.0000 swapping, multrees option not in effect. All characters in the data matrix were unordered and equally weighted and gaps were treated as missing data. All of the most parsimonious trees were summarized into a strict consensus tree. Nodal support was evaluated using the bootstrap method (Felsenstein, 1985) with 1000 replicates, TBR branch swapping, and multrees option not in effect, saving 1 tree for each replicate. Bootstrap proportions >70% are considered well supported (Hillis and Bull, 1993). Tree statistics including consistency index and the retention index were calculated using PAUP. Bayesian analyses were performed using the program MrBayes version 3.1.2 (Ronquist and Huelsenbeck, 2003). The best-fitting models were determined using the Akaike Information Criterion (Posada and Buckley, 2004) as implemented in the program Modeltest 3.7 (Posada and Crandall, 1998). The best-fitting models and parameter values are shown in Table 5. All priors were set according to the chosen model. For example, Bayesian analyses of the combined data sets were run with default priors as follows: statefreqpr = fixed (0.3522, 0.1543, 0.1522, 0.3413); revmat = fixed (0.6177, 1.2584, 0.1828, 0.5385, 1.2584, 1.0000); shapepr = fixed (1.0687); pinvar = fixed (0.6538). The Bayesian analyses started from random trees sampling one tree every 100th generation with four incrementally heated chains. The Markov chain Monte Carlo (MCMC) algorithm was run for 50,00,000 generations for each data set. Stationarity of the Markov chain was ascertained by plotting likelihood values against number of generations for apparent stationarity. The first 5000 trees corresponding to the ‘‘burn-in” period were discarded, and the remaining trees were used to construct majority-rule consensus tree. We consider posterior probabilities >0.95 to indicate significant probability for a clade. Congruence of datasets was assessed using the incongruence length difference (ILD) test (Farris et al., 1994) implemented in PAUP* ver. 4.0b10 (Swofford, 2003). We used 1000 homogeneity replicates. Heuristic search with initial trees obtained by random addition, NNI (nearest-neighbor interchange) branch swapping, and ten random addition sequences following Sjolin et al. (2005). Uninformative characters were excluded prior to ILD tests as they may overestimate the level of incongruence (Cunningham, 1997; Lee, 2001). Different combinations of datasets were also analyzed. Comparisons among the eight individual chloroplast sequences using the ILD test indicated that none of them was significantly incongruent (P = 0.086–0.675). The ILD value for the entire dataset was 0.675, suggesting congruence among the datasets. The eight datasets were accordingly analyzed separately and concatenated. 3. Results 3.1. Analysis of individual cpDNA regions A summary of the Maximum Parsimony statistics for each data partition is presented in Table 4. The rpl32-trnL sequence had the I G 0 0.5924 0.5919 0.5341 0.8356 0 0 0.5771 0.6538 0.4248 0.9755 0.9620 0.9909 Equal 0.4894 0.3237 1.1345 1.0687 highest percentage of informative characters with 6.21%, whereas the trnS/G region has the lowest with only 3.35%. Furthermore, sequences between nucleotide sites 376 and 441 of the rpl32-trnL intergenic spacer contained a pair of 24 bp exact inverted repeats, which are separated by 6 bases (Fig. 1). Five types of sequences can be recognized. Type I and II sequences can be converted into each other by inversions of sequences bordered by the inverted repeats. We examined the phylogeny of the individual or combined matrix with or without the inversions, respectively, and the results were almost identical. Therefore, in subsequent analyses we retained the inversions, and introduced gaps aligned with the uninverted sequences. Those gaps were not scored and treated as missing data. Each individual cpDNA region provided very low resolution within the tribe, with most branches unresolved in the eight separate MP strict consensus trees (data not shown). However, the temperate bamboos formed a monophyletic group in every analysis. Bayesian analyses were also performed for individual DNA regions. The results (trees not shown) were similar to those obtained using MP. In the Bayesian analyses, the tribe Arundinarieae received 1.00 PP support values for all eight regions. 3.2. Analysis of combined data The final combined data matrix, after excluding ambiguously aligned regions, consisted of 9463 characters for 161 accessions, of which 999 derived from the atpI/H region, 983 from the psaAORF170 region, 966 from the rpl32-trnL region, 1441 derived from the rpoB-trnC region, 1805 from rps16-trnQ region, 1399 from the trnD/T region, and 925 from the trnS/G, and 945 from the trnT/L region, respectively. The matrix also included 72 binary coded indel characters (Table 4). Maximum parsimony analysis of the combined matrix produced 986 most parsimonious trees of 1037 steps in length, with a consistency index of 0.756 and a retention index of 0.912. The strict consensus of all the maximum parsimony trees is shown in Fig. 2. The majority-rule consensus of 45,000 trees derived from Bayesian analyses with accompanying posterior probability values is presented in Fig. 3. 3.3. Phylogenetic relationships The strict consensus MP tree agreed with the Bayesian tree at nearly all nodes; only minor differences appeared at some terminal nodes that were not well-supported by bootstrap values. Of the nodes discussed below, only Gaoligongshania megalothyrsa (IX) and Yushania alpina (II) differed in placement in the MP phylogeny as compared with the BI tree. Unless otherwise stated, therefore, discussions of the concatenated phylogeny are based on the topology of the MP strict consensus tree. Many well-supported clades were recovered in this study (e.g., Clades I–X; Fig. 2). The monophyly of the temperate bamboo tribe 830 C.-X. Zeng et al. / Molecular Phylogenetics and Evolution 56 (2010) 821–839 Type I ACTTTTCATAATAGAATCCTCATA TTTTAT TATGAGGATTCTATTATGAAAAGT Type II ACTTTTCATAATAGAATCCTCATA ATAAAA TATGAGGATTCTATTATGAAAAGT Type III ----------TCATAATAGAATCCTCATA TTTTAT TATGAGGATTCTATTATGAAAAGT Type IV ACTTTTCATAATAGAATCCTCATA ATAAAAATAAAA TATGAGGATTCTATTATGAAAAGT Type V ACTTTTCATAATAGAA-----TCCTCATA TTTTAT TATGAGGATTCTATTCTATTATGAAAAAGT Fig. 1. Five types of sequences of region between nucleotide sites 376 and 441 of rpl32-trnL intergenic spacer. Lines and arrows below sequences indicate inverted repeats. Nucleotides (boldface letters) that are bordered by inverted repeats which have undergone inversions. Arundinarieae was strongly supported (100% BP; 1.00 PP). Ten major clades of temperate bamboos (Clades I–X; Fig. 2) were recovered congruently by both Bayesian and Maximum Parsimony methods (Figs. 2 and 3). In addition to the six clades (I) Bergbamboes, (II) the African alpine bamboos, (III) Chimonocalamus, (IV) the Shibataea clade, (V) the Phyllostachys clade and (VI) the Arundinaria clade corresponding to those obtained earlier in previous study (Triplett and Clark, 2010), another four clades were newly recognized, and designated (VII) Thamnocalamus, (VIII) Indocalamus wilsonii, (IX) Gaoligongshania, and (X) Indocalamus sinicus. (I) Bergbamboes, including only Thamnocalamus tessellatus, (II) the African alpine bamboos, consisting of Yushania alpina, (VIII) Indocalamus wilsonii, (IX) Gaoligongshania, a monotypic genus, and (X) Indocalamus sinicus formed distinct lineages, respectively. (III) Chimonocalamus. This clade was strongly supported (100% BP; 1.00 PP), and comprised most of the sampled taxa of Chimonocalamus, plus Ampelocalamus actinotrichus. However, Chimonocalamus pallens (the type species of Chimonocalamus) and C. fimbriatus were not part of this clade, instead nesting within the Phyllostachys clade. (IV) The Shibataea clade. Shibataea, Pseudosasa gracilis, Gelidocalamus, Indocalamus, Ferrocalamus, and Chinese accessions of Sasa subgen. Sasa clustered in this clade with strong support (99% BP; 1.00 PP). (V) The Phyllostachys clade. A total of 69 species were encompassed in this clade (1.00 PP), including representatives of Phyllostachys and other 16 genera. Despite the fact is that these species represent all of the morphological diversity among three subtribes of Arundinarieae, little resolution or genetic divergence was apparent. However, several clusters can be identified, including Pseudosasa guanxianensis and Bashania qingchengshanensis (100% BP; 1.00 PP), Indocalamus decorus and Indocalamus longiauritus (89% BP; 1.00 PP), and a lineage consisting of Pseudosasa amabilis var. contexa and Pseudosasa maculifera (85% BP; 1.00 PP). Bashania fargesii was revealed to be more similar to four accessions of Fargesia than to other accessions of Bashania (87% BP; 1.00 PP). Yushania crassicollis and Yushania baishanzuensis formed a monophyletic lineage with support of 87% BP and 1.00 PP. Drepanostachyum and Himalayacalamus formed a clade with support of 97% BP and 1.00 PP. Furthermore, the following lineages were supported with high posterior probability values: a subclade consisted of Bashania fangiana and Bashania abietina was supported with 0.99 PP; Oligostachyum oedogonatum was indicated to be sister to Pleioblastus sanmingensis (1.00 PP); Acidosasa notata was nested within a clade with two accessions of Pleioblastus (0.99 PP); and a subclade with Gelidocalamus tessellatus and Gelidocalamus sp2. together with four accessions of Indocalamus was supported with 0.96 PP. Within this subclade, Indocalamus guangdongensis and Indocalamus herklotsii formed a sister relationship with support of 95% BP and 1.00 PP. In addition, the Bayesian analysis recovered a robust but unresolved subclade with 21 species representing Acidosasa, Brachystachyum, Indocalamus, Oligostachyum, Phyllostachys, Pleioblastus, Pseudosasa, and Sasa (1.00 PP) (Fig. 3). (VI) The Arundinaria clade. This clade received strong support with 94% BP and 1.00 PP. Four subclades can be identified. These four subclades are designated as the Sasa subclade, the North American subclade, the Medake subclade and the Sinicae subclade. The Sasa subclade (99% BP; 1.00 PP) consisted of Sasa, Sasaella, and Pleioblastus. The North American subclade (0.99 PP), comprised three accessions of the genus Arundinaria s.s. (N. America). Within this subclade Arundinaria appalachiana and Arundinaria tecta were resolved as sister species with support of 100% BP and 1.00 PP. The Medake subclade (100% BP; 1.00 PP) included three accessions of Pleioblastus s.s. (Japan archipelago), within which were nested the Japanese taxa Pleioblastus sp. and Pseudosasa japonica (including one variety). This subclade can be divided into two lineages: one consisting of Pleioblastus gramineus, Pseudosasa japonica and its variety (100% BP; 1.00 PP), and the other consisting of Pleioblastus argenteostriatus, Pleioblastus sp., and Pleioblastus pygmaeus (99% BP; 1.00 PP). The Sinicae subclade received support of 99% BP and 1.00 PP but was poorly resolved at the generic level. Acidosasa nanunica and two additional lineages formed a polytomy within this subclade. These two lineages were (1) Pseudosasa orthotropa Pseudosasa cantorii (‘‘” signifies the inclusion of all species between the two on our trees) and (2) Oligostachyum paniculatum Pseudosasa longiligula. Within the first lineage, one clade (95% BP; 1.00 PP) and two other clades with support of 1.00 PP for both were recovered, each of which was a heterogeneous assemblage of taxa. (VII) Thamnocalamus. The newly-recognized Thamnocalamus clade was represented by five accessions of Thamnocalamus spathiflorus, including one variety (100% BP; 1.00 PP). Within this clade, C.-X. Zeng et al. / Molecular Phylogenetics and Evolution 56 (2010) 821–839 831 Fig. 2. Strict consensus of 986 equally most parsimonious trees based on the 8-region cpDNA dataset (rpl32-trnL, trnT/L, rps16-trnQ, rpoB-trnC, trnD/T, atpI/H, psaA-ORF170, trnS/G). Numbers above the branches indicate bootstrap (BP)/posterior probability (PP) support values. Clade and subclade names correspond to those described in previous studies or newly recognized in this study. Alternate accessions of Indocalamus sinicus, Indocalamus wilsonii, Indosasa gigantea, Thamnocalamus spathiflorus and its variety are indicated by voucher numbers. 832 C.-X. Zeng et al. / Molecular Phylogenetics and Evolution 56 (2010) 821–839 Fig. 3. Phylogram of the majority-rule consensus tree from the Bayesian analysis of the 8-region cpDNA dataset (rpl32-trnL, trnT/L, rps16-trnQ, rpoB-trnC, trnD/T, atpI/H, psaAORF170, trnS/G). Numbers above and beside the branches are posterior probability (PP) values. Clade and subclade names correspond to those described in previous studies or newly recognized in this study. Alternate accessions of Indocalamus sinicus, Indocalamus wilsonii, Indosasa gigantea, Thamnocalamus spathiflorus and its variety are indicated by voucher numbers. C.-X. Zeng et al. / Molecular Phylogenetics and Evolution 56 (2010) 821–839 individuals from Tibet and Kew Garden (introduced from Nepal) formed a pair with support of 96% BP and 1.00 PP. Likewise, all accessions of T. spathiflorus var. crassinodus formed a clade with support of 84% BP. 4. Discussion The temperate bamboos have long been considered a complex and taxonomically difficult group. With the exception of strong support for the monophyly of the temperate bamboos (tribe Arundinarieae), phylogenetic relationships within the tribe have remained for the most part enigmatic. Peng et al. (2008) focused on the generic-level phylogenetic relationships and indicated the temperate bamboos as highly heterogeneous groups. Triplett and Clark (2010) presented a robust multi-locus chloroplast phylogeny of the temperate bamboos. It revealed that the temperate bamboos were resolved to include six major lineages. But the study emphasizes the specieslevel relationships among taxa in Japan and North America, with relatively limited sampling of Chinese species. With a very broad sampling of Chinese taxa, ten major lineages within the tribe Arundinarieae were revealed in the current study (Figs. 2 and 3). The Chinese species was confirmed as a very complicated and confusing group in accordance with their diverse morphological characters. Those species were clustered within eight of the total ten lineages. Some species had closer relationships with taxa from North America and Japan than sympatric species (i.e., Arundinaria clade). Species examined in this study assembled into lineages that were largely incongruent with current taxonomic circumscriptions. Moreover, relationships among ten lineages were represented in unresolved polytomies (Figs. 2 and 3). This poor resolution and the extremely short internal branches may be attributed to low rate of molecular divergence and a complicated evolutionary history possibly involving rapid radiation and reticulate evolution. Molecular dating of major clades of the grass family by Bouchenak-Khelladi et al. (2009) indicated that the Arundinarieae was a relatively young group in the Bambusoideae, their origin dating back to the Miocene, approximately 15 mya. Within the temperate bamboos, in contrast to other clades, the relationships among species in the Phyllostachys clade and the Sinicae subclade of the Arundinaria clade remain largely unresolved. These two monophyletic lineages mainly occur in China, encompass about 60% of the diversity in the temperate bamboos, and span a wide range of vegetative and reproductive morphology. This may imply that two episodes of recent or rapid radiation happened independently among the Chinese taxa. According to the phylogeny and distribution of the species in the Phyllostachys clade and the Sinicae subclade of the Arundinaria clade (see above; Fig. 2), we infer that lineage diversification is possibly correlated with the geological history of Chinese mainland and the adjacent areas, particularly the uplift of Tibetan Plateau and the subsequent habitat change. Additional evidence combinated with fossils is needed to confirm this inference. On the basis of the recent molecular phylogeny and previous morphological and molecular evidence, Triplett and Clark (2010) suggested that reticulate evolution may be more significant in the temperate bamboos than previously suspected. Furthermore, AFLP data considered in conjunction with morphology and cpDNA haplotypes provide unequivocal evidence of hybridization among species of Arundinaria in North America (Triplett, 2008; Triplett et al., 2010) as well as among several genera in East Asia (Triplett, 2008; Triplett and Clark, 2010). Potential events of the allopolyploidy of the temperate bamboos are being analyzed by Zhang et al. (in preparation) based on the incongruence between separate phylogenies derived from chloroplast and nuclear low-copy gene sequences. 833 Life history may significantly affect the rate of molecular evolution (Smith and Donoghue, 2008). The flowering cycles from decades to 120 years in temperate bamboos have been reported (Janzen, 1976). Long generation times for woody bamboos have been considered as another explanation for poor resolution of molecular phylogenetic tree (Gaut et al., 1997). The effect of flowering cycles on evolutionary rates of temperate woody bamboos is needed to test in the future. 4.1. The Thamnocalamus group and subtribes Arundinariinae and Shibataeinae Guo et al. (2002), Guo and Li (2004) concluded that the Thamnocalamus group and its allies were monophyletic based on the phylogenetic analyses of the ITS and GBSSI sequences. With extensive sampling, Peng et al. (2008) indicated that most species of the Thamnocalamus group and its allies displayed a close relationship in both the analysis of GBSSI sequences and the combined analysis of ITS and GBSSI data. However, the Thamnocalamus group was not resolved as monophyletic. In our study, the Thamnocalamus group was indicated to be polyphyletic. However, it is interesting to note that Thamnocalamus spathiflorus and its variety are strongly supported as a distinct lineage (Fig. 2, clade VII), which is consistent with previous results (Guo and Li, 2004). According to our results, neither of the two major subtribes of the temperate bamboos (Arundinariinae nor Shibataeinae; Li, 1997; Table 1) is indicated to be a monophyletic group. Taxa belonging to these subtribes are distributed randomly among three major clades, i.e., the Shibataea clade, the Phyllostachys clade, and the Arundinaria clade (Fig. 2). Unequivocal morphological synapomorphies have not been identified to delimitate these molecularbased clades. This implies that morphological characters used in the traditional classification of subtribes, such as rhizomes, synflorescences, ovaries, branches and culm sheaths, may not have significant phylogenetic meanings, and that the subdivision of Arundinarieae should be reevaluated. 4.2. Genera within the tribe Arundinarieae Peng et al. (2008) suggested that most genera within the temperate bamboos were highly heterogeneous. This opinion was confirmed again by Triplett and Clark (2010). In their study, the monophyly of 19 temperate genera was tested. Of these, only four were supported as monophyletic, while ten were indicated to be paraphyletic or polypheletic, and the remaining genera were ambiguous due to little resolution. In our study, we sampled 156 accessions representing 26 genera. At least two species per genus were sampled, with the exception of monotypic genera Brachystachyum and Gaoligongshania, and the genera Himalayacalamus, Metasasa, and Sasaella, for which only one sample was available. Only four genera (Arundinaria, Drepanostachyum, Ferrocalamus, and Shibataea) were found to be monophyletic (Figs. 2 and 3), although additional taxa should be sampled to fully test the monophyly of Drepanostachyum and Shibataea. Fifteen genera (Acidosasa, Ampelocalamus, Bashania, Chimonocalamus, Fargesia, Gelidocalamus, Indocalamus, Indosasa, Oligostachyum, Phyllostachys, Pleioblastus, Pseudosasa, Sasa, Sinobambusa, and Yushania) were confirmed to be paraphyletic or polyphyletic. The genera Chimonobambusa and Thamnocalamus were represented in unresolved polytomies (Figs. 2 and 3). 4.3. Major lineages within the tribe Arundinarieae Several major lineages within the tribe Arundinarieae are strongly supported (Figs. 2 and 3). This study confirms the six clades found earlier (Triplett and Clark, 2010) and delineates 834 C.-X. Zeng et al. / Molecular Phylogenetics and Evolution 56 (2010) 821–839 several other distinct lineages for the first time. While the branching order among these ten major lineages was still unresolved, a possible association was indicated among the African alpine bamboos, Gaoligongshania megalothyrsa, and the Chimonocalamus clade in the BI tree with support of 1.00 PP (Fig. 3). Moreover, the possible sister relationships between Indocalamus sinicus and the Phyllostachys clade received support of 0.96 PP. We also conducted an approach according to the criteria used by Triplett and Clark (2010) to select taxa for the 12-region analysis. MP and BI trees (not show) were consistent with the above results. The inter-relationships of the ten major clades were still unclear. To reconstruct the phylogeny of the temperate bamboos and reveal the deep-level relationships, work is currently underway to add other more useful characters such as a single-copy nuclear gene and whole chloroplast genome (Zhang et al., in preparation). 4.3.1. Bergbamboes (I) and African alpine bamboos (II) Thamnocalamus tessellatus is from South Africa, where it is called Bergbamboes, or mountain bamboo. This species was tentatively placed in Thamnocalamus by Soderstrom and Ellis (1982) on the basis of morphological features, such as pachymorph rhizomes and a condensed synflorescence, while the terminal synflorescences, with a series of spadix-shaped bracts, are more similar to Fargesia. The position of Thamnocalamus tessellatus was unresolved due to limited information by Guo and Li (2004) using nuclear ITS and GBSSI. In combined 4-region and 12-region analyses of cpDNA sequences, bergbamboes was revealed to be a divergent lineage (Triplett and Clark, 2010) and was suggested to be described as a new genus. The current molecular results are consistent with previous study. Relationships with other lineages are still unclear. Yushania alpina is from central and east Africa. This species was indicated to have a possible affiliation with Chimonocalamus or Gaoligongshania, but with low support values by Guo and Li (2004) examining in GBSSI or an combined analysis of ITS and GBSSI, respectively. Triplett and Clark (2010) retested the placement of this species, the results indicated that Yushania alpina clustered with Chimonocalamus in the 12-region analysis. In our study, Yushania alpina was found to cluster with Gaoligongshania and the Chimonocalamus clade and the lineage was supported with support of 1.00 PP. Additional work is required to confirm the phylogenetic affinities among the African bamboos. 4.3.2. Chimonocalamus (III) Chimonocalamus was established by Hsueh and Yi (1979) and encompasses 11 species distributed in subtropical to warm temperate regions of Southernwest China, the eastern Himalayas, and northern Myanmar. This genus is characterized by pachymorph rhizomes, three branches per node, a ring of root thorns especially dense at lower nodes, and semelauctant synflorescences with three stamens. In general it has been recognized as a good genus (Soderstrom and Ellis, 1987; Dransfield and Widjaja, 1995; Keng and Wang, 1996; Li, 1997; Li et al., 2006), except that it was treated as a section of Sinarundinaria (a synonym of Fargesia) by Chao and Renvoize (1989). The monophyly of Chimonocalamus was strongly supported by Guo et al. (2002) and Guo and Li (2004) based on analyses of GBSSI and ITS sequences. Triplett and Clark (2010) reinforced this result. In our study, we sampled five species of Chimonocalamus, and the results indicate that Chimonocalamus is polyphyletic. Chimonocalamus longiusculus, C. dumosus, and C. montanus were indicated to be a distinct lineage, consistent with the Chimonocalamus clade (Triplett and Clark, 2010). Surprisingly, C. fimbriatus and C. pallens were nested within the Phyllostachys clade. This placement contrasts the results of Triplett and Clark (2010), in which an accession of C. pallens in cul- tivation in the US was found to belong to the Chimonocalamus clade. Another surprising result is the position of Ampelocalamus actinotrichus, the type species of Ampelocalamus, which was revealed to be part of the Chimonocalamus clade. Ampelocalamus is distinguished by pendulous or scrambling culms, geniculate branches with a dominant central branch, and semelauctant synflorescences clustering as pendulous panicles on leafy or leafless flowering branches. Ampelocalamus was indicated to be a good genus in previous studies using nuclear regions (Guo et al., 2002; Guo and Li, 2004). However, in this study the genus is indicated to be polyphyletic (Figs. 2 and 3), although the same three species were used to reconstruct the phylogeny. This may reflect different evolutionary histories between nuclear and chloroplast genomes. In order to confirm and further test our results, additional taxa of Chimonocalamus and Ampelocalamus (possibly including population sampling) should be collected and additional molecular markers should be explored. 4.3.3. Shibataea clade (IV) The Shibataea clade was considered one of the more surprising results by Triplett and Clark (2010) based on the multi-locus chloroplast phylogeny. The reason is the position of Shibataea from East Asia and its relationship with morphologically distinctive and geographically endemic species from Southeastern China. With wider taxon sampling, the current molecular results confirm the Shibataea clade, currently represented as a polytomy of four monophyletic lineages: (1) Ferrocalamus, (2) Shibataea and Gelidocalamus tessellatus, (3) Indocalamus and Gelidocalamus sp1., and (4) Sasa, Pseudosasa gracilis, and Indocalamus jinpingensis. As such, this clade represents not only species from Southeastern China, but also species from Southwestern China. The monophyly of both Ferrocalamus and Shibataea are supported, while the genera Pseudosasa, Sasa, Indocalamus, and Gelidocalamus are indicated to be polyphyletic. On the basis of morphology, Shibataea is considered to be close to Phyllostachys. Nonetheless, current data provide that Gelidocalamus tessellastus was the close relative of Shibataea. Thus accessions from two subtribes, Arundinariieae (semelauctant, leptomorph species) and Shibataeinae (iterauctant, leptomorph species), were nested within this one clade. Although a relationship between the Arundinaria clade and this clade was weakly supported in this study, more work is necessary to ascertain its position among lineages. Additional work is currently underway (1) to retest the monophyly of Shibataea by increasing taxon sampling, and (2) to collect all Chinese species of Sasa subgen. Sasa in order to test the monophyly of this group and to discuss the necessity of describing a new genus, as suggested by Triplett and Clark (2010). 4.3.4. Phyllostachys clade (V) After adding more representatives of Chinese taxa, the Phyllostachys clade now comprises about 17 genera and 69 species. This clade unites species from different genera and subtribes (Figs. 2 and 3; Table 1) with the most diversified morphological features, such as iterauctant or semelauctant synflorescences, pachymorph or leptomorph rhizomes, various numbers of branches (1, 2 , 3 or more), and three or six stamens. However, the more surprising aspect is the low variation of chloroplast DNA regions, which does not correspond to the high morphological heterogeneity in this clade. Although none of the 17 genera were resolved to be monophyletic, several subclades with moderate to strong support were obtained. Pseudosasa guanxianensis and Bashania qingchengshanensis constitute a small clade with support of 100% BP and 1.00 PP. These two shrubby bamboos are both distributed in Dujiangyan or the adjacent area, Sichuan, and share some morphological characters, such as sheath rings with culm sheath remnants and black setae, C.-X. Zeng et al. / Molecular Phylogenetics and Evolution 56 (2010) 821–839 branches 3 to many, and culm sheaths persistent or tardily deciduous with black setae. Evidence from molecular data, geography and morphology imply that these two species are closely related, and may originate from the same progenitors. In the light of this result, the taxonomic revision of these species may be needed. Pseudosasa guanxianensis was treated as a synonym of Indocalamus longiauritus in the Flora of China (Li et al., 2006), however, there are several differences to distinguish them, such as the number of branches (3 to many for the former, and 1–3 for the later). Indocalamus longiauritus has pale red-brown tomentose rings below the nodes, while B. qingchengshanensis is characterized by gray-yellow waxy powder below the nodes, and flowers with three stamens and two stigmas. Many of the features found in B. qingchengshanensis resemble Gelidocalamus. Further study will be necessary to understand morphology in light of our molecular results. A subclade of two accessions of Drepanostachyum and Himalayacalamus falconeri was supported with 97% BP and 1.00 PP. Drepanostachyum is medium size clumping, mountain bamboos with a lax falcate synflorescence and occurs in habitats similar to those of Ampelocalamus, which is regarded as a related genus (Li et al., 1996) on the basis of morphology. Their sister relationship was generally supported by Guo et al. (2002) and Guo and Li (2004) using the ITS and GBSSI sequences. Himalayacalamus is clumpforming bamboos of the lower altitudes of the Himalayan Mountains. The morphological differences between Drepanostachyum and Himalayacalamus are subtle; for example, Drepanostachyum has many equal branches per node, while Himalayacalamus has many subequal branches and a central dominant one. A close relationship between Drepanostachyum and Himalayacalamus was indicated by Triplett and Clark (2010). Here, we retrieved two accessions of Drepanostachyum as a monophyletic group, and Himalayacalamus was recovered to be sister to Drepanostachyum rather than Ampelocalamus. However, the monophyly of Drepanostachyum was not supported by Triplett and Clark (2010) based on different representative species. These results suggest that extensive taxon sampling is essential in future studies. A lineage consisting of four accessions of Fargesia plus Bashania fargesii was recovered with moderate support (87% BP; 1.00 PP). Those taxa are distributed in western Sichuan, western Hubei or Qingling Mountains. Within this lineage, F. nitida was indicated to be a close relative of F. robusta with support of 95% BP and 1.00 PP, whereas the previous study (Triplett and Clark, 2010) indicated that F. nitida was sister to Thamnocalamus spathiflorus with support of 94% BP and 1.00 PP. This conflict may be caused by a misidentification of the plants in cultivation in the U.S. as T. spathiflorus (see below for details of Thamnocalamus (VII)). A surprising subclade consisting of 21 species was recovered only in the BI tree (Fig. 3). This subclade includes at least two genera from Shibataeinae (Brachystachyum and Phyllostachys), six from the Arundinariinae (Acidosasa, Indocalamus, Oligostachyum, Pleioblastus, Pseudosasa, and Sasa). A corresponding subclade was also indicated with support of 71% MPBS (maximum parsimony bootstrap analysis), 71% MLBS (maximum likelihood bootstrap analysis) and 1.00 PP by Triplett and Clark (2010), although with different representatives and fewer samples. Within this subclade, close relationships of four groups, i.e., O. oedogonatum + Pl. sanmingensis, A. notata + Pl. wuyishanensis + Pl. solidus, Ps. amabilis var. convexa + Ps. maculifera, and I. latifolius + I. victorialis were revealed. Most of these species occur in eastern China (Fujian and Zhejiang) except for Ps. maculifera in Henan. Oligostachyum oedogonatum is the only species of Oligostachyum nested in Phyllostachys clade to date, although one accession tentatively identified as Oligostachyum sp. (and cultivated in the US as Pleioblastus oleosus) nested in this clade in Triplett and Clark (2010). Oligostachyum oedogonatum was first described as Pleioblastus oedogonatus (Wang and Ye, 1981), and then due to its distinctive morphological char- 835 acters (especially the swollen nodes) a new genus Clavinodum was proposed with this species as type (Wen, 1984). Finally, this species was transferred to Oligostachyum (Liang et al., 1987) and adopted by Flora Reipublicae Popularis Sinicae (Keng and Wang, 1996) and Flora of China (Li et al., 2006). Acidosasa notata is the only representative of Acidosasa nested in the Phyllostachys clade in this study. It is also notable that Ps. amabilis var. convexa and Ps. amabilis (the Arundinaria clade) do not occur in the same major clades. We speculate that (1) we made a misidentification of Ps. amabilis var. convexa, or (2) morphological homoplasy led taxonomists to consider these plants as conspecifics. Pseudosasa amabilis var. convexa was collected around its type locality; therefore, we consider the second inference to be more likely. Many of the subclades discussed above have geographic implications. Pseudosasa guanxianensis, Bashania qingchengshanensis, four accessions of Fargesia, and B. fargesii are distributed at the eastern edge of Tibetan Plateau; two accessions of Drepanostachyum and Himalayacalamus falconeri occur in the Himalayan mountains; and the subclade of 21 species are mainly from eastern China. Although they bear different morphology, the same plastid genome donors may be shared among these taxa in the process of speciation. Many problems remain in the Phyllostachys clade. In order to enhance our understanding of its phylogeny, more species from Ampelocalamus, Drepanostachyum, Fargesia, Phyllostachys, Yushania and so on should be sampled, and the development of markers with improved resolution at and below the genus level, such as low-copy nuclear regions or the whole chloroplast genome, is required. 4.3.5. Arundinaria clade (VI) Within the Arundinaria clade, four major subclades were resolved, which we refer to as the Sasa subclade, the North American subclade, the Medake subclade, and the Sinicae subclade. The former two subclades were indicated as the Sasa/cane subclade with moderate support in the previous study, while the latter two correspond to the previous results (Triplett and Clark, 2010). There are at least two possible explanations for this soft incongruence: (1) different taxa were sampled; (2) the molecular characters supporting the Sasa/cane clade were not present in the cpDNA regions sampled in the current study. Although the Arundinaria clade is united by rhizome type (leptomorph), it exhibits high morphological diversification, for example iterauctant or semelauctant synflorescences, various numbers of branches (1 or 3), and three or six stamens. The delimitation of the genus Arundinaria based on morphology has been disputed for a long time. In the broad sense, Arundinaria is usually treated to include some narrowly defined East Asian genera, such as Bashania, Oligostachyum, Pleioblastus, and Pseudosasa, as well as the North American species (Chao et al., 1980; Clayton and Renvoize, 1986; Soderstrom and Ellis, 1987; Watson and Dallwitz, 1992 onwards; Yang and Zhao, 1993, 1994). Other authors treat the genus as endemic to eastern North America, with the East Asian genera as its closest relatives (Suzuki, 1978; Li, 1997; Stapleton, 1997; Judziewicz et al., 1999; Li et al., 2006). In this study, the three species of Arundinaria s.s. formed a moderately supported lineage, while its relationship with the other three subclades was unresolved. Oligostachyum, Pleioblastus, and Pseudosasa were revealed to be close to Arundinaria s.s., while Bashania was nested in Phyllostachys clade. Acidosasa, Indosasa, Metasasa, Sasa s.s. (Japan), Sasaella, and Sinobambusa were clustered within the same clade. Therefore, our results conflict significantly with existing classifications. We suggest that Arundinaria should be treated in the strict sense to consist of three species in eastern North America. Triplett and Clark (2010) tentatively suggested that Arundinaria s.s. may in fact be closer to Sasa or Sasamorpha. But this 836 C.-X. Zeng et al. / Molecular Phylogenetics and Evolution 56 (2010) 821–839 relationship did not receive robust support in this study. Further work will be needed to clarify the phylogeny of the East Asian species. However, whatever the relationships are between the North American subclade and the other three subclades, it is clear that there is a disjunction between temperate bamboo species in Eastern Asia and North America. The subclades Medake and Sinicae were monophyletic lineages that correlated with geography, i.e., the Medake subclade in Japan and the Sinicae subclade in China. This is consistent with previous results (Triplett and Clark, 2010). Japanese species of Pleioblastus and Pseudosasa were clustered in the subclade Medake in this study as well as the previous study by Triplett and Clark (2010). The Sinicae subclade is composed of Acidosasa, Indosasa, Metasasa, Oligostachyum, one species of Pleioblastus (from China), Pseudosasa subg. Sinicae, and Sinobambusa. Those species are mainly distributed in central, southern and southeastern China. Their vegetative characters are so similar that it is quite difficult to distinguish them based on vegetative organs or tissues for some species, and some misidentifications have been made, such as Acidosasa purpurea, which was originally described as a member of Indosasa (Hsueh and Yi, 1983), then was transferred to Acidosasa due to the semelauctant synflorescences (Keng, 1986). Pleioblastus maculatus is the only Chinese representative of Pleioblastus nested in the Arundinaria clade in this study, and it has the broadest distribution among the Chinese species of Pleioblastus, from southwestern to southeastern China. The other Chinese species of Pleioblastus were clustered in the Phyllostachys clade, and are primarily distributed in eastern China. Representatives of Pseudosasa subgen. Sinicae were separated into three divergent clades, i.e., Shibataea clade, Phyllostachys clade and Arundinaria clade, with most in the Arundinaria clade. Those results imply that we should reevaluate the Chinese and Japanese Pleioblastus and Pseudosasa. Two species of Sinobambusa were included in this study, one of which is the type species (S. tootsik). These were nested in the Sinicae subclade, a result that is consistent with Peng et al. (2008), while one unnamed species of this genus clustered in the Phyllostachys clade in the study by Triplett and Clark (2010), and S. rubroligula was close to Chimonobambusa sichuanensis (a synonym of Menstruocalamus sichuanensis) in Peng et al. (2008). Therefore, more species should be sampled to ascertain the position of Sinobambusa. Nakai (1931) established the genus Sasamorpha as distinct from Sasa, according to the characters of flat nodes (versus prominent in Sasa), culm sheaths shorter than internodes (versus longer in Sasa), and auricles and fimbriae undeveloped (versus developed in Sasa). Hu (1985) proposed that Sasamorpha should not recognize as a distinct genus, and divided Sasa into Sasa subgen. Sasa and Sasa subgen. Sasamorpha. The subgenera Sasa and Sasamorpha were adopted by FRPS and grass volume of the Flora of China. Based on molecular data, S. qingyuanensis and S. sinica (representatives of Sasa subgen. Sasamorpha), were nested within the Phyllostachys clade, three Chinese taxa of Sasa subgen. Sasa (i.e., S. longiligulata, S. magnonoda, and S. guangxiensis) were embedded within the Shibataea clade, Sasa oblongula cultivated in Guangzhou (but original locality unknown) was indicated to be sister to the Japanese taxa of Sasa, Sasaella, and Pleioblastus in the Sasa subclade. These observations indicate that both the monophyly of Sasa and the classification of subgenera based on morphology are rejected by molecular results. The placement of Chinese Sasa species should be fully examined in future studies. 4.3.6. Thamnocalamus (VII) Thamnocalamus is distinguished by pachmorph rhizomes, initially 5 branches in the mid-culm, semelauctant synflorescences with spathelike bracts, three stamens. There are about 4 species distributed in Bhutan, Northeast India, Nepal, South Tibet, South Africa and Madagascar (Ohrnberger, 1999; Li et al., 2006). In our study, T. spathiflorus and its variety, collected from Tibet and Nepal, formed a distinct lineage with support of 96%BP and 1.00 PP. This result is consistent with those based on ITS and GBSSI sequences by Guo and Li (2004), but conflicts with Triplett and Clark (2010), in which T. spathiflorus was found to be sister to Fargesia nitida, and those two taxa were nested within the Phyllostachys clade (Figs. 2 and 3). This study did not find an association between T. spathiflorus and T. tessellatus, instead suggesting that these species are part of divergent lineages. 4.3.7. Indocalamus wilsonii (VIII), Gaoligongshania (IX) and Indocal amus sinicus (X) Indocalamus Nakai was established by Nakai (1925) and is characterized by semelauctant synflorescences, leptomorph rhizomes, solitary mid-culm branches, and large leaves. It encompasses at least 23 species. Most species are endemic in China except one species distributed in Japan. This genus is especially prevalent in hills below 1000 meters, with a few species reaching 3000 meters. The current analysis demonstrates that Indocalamus is a heterogeneous, polyphyletic genus, with representatives in the Shibataea clade and the Phyllostachys clade, as well as forming distinct lineages outside of each of the previously recognized clades. Indocalamus sinicus (Hance) Nakai is the type species of this genus, and accessions from Hainan and Guangdong clustered together as a distinctive lineage. It is surprising that Indocalamus wilsonii was also indicated to be a divergent lineage in this investigation. In our study, two accessions of I. wilsonii from the provinces Sichuan and Hubei, respectively, formed a lineage that was distinct from all other representatives of Indocalamus. Indocalamus wilsonii is distinct from other congeneric taxa by its distribution at altitudes from 1700 to 3000 meters, and usually with two stigmas in the florets (versus three in other species of Indocalamus). Gaoligongshania is a recently recognized monotypic genus distributed in northwest Yunnan (Li et al., 1995). The type species, G. megalothyrsa, bears semelauctant synflorescences, pachymorph rhizomes, and solitary mid-culm branches, and is distinguished from all other temperate genera by its epiphytic habitat. Guo et al. (2002) and Guo and Li (2004) found that Gaoligongshania was unexpectedly resolved as sister to Thamnocalamus spathiflorus in the ITS-based analysis, but sister to the African Yushania alpina with low support in GBSSI and combined analyses. In a multi-locus analysis of the grass family that included a small subset of temperate species, Gaoligonshania was resolved to be sister to Chimonobambusa (Bouchenak-Khelladi et al., 2008), suggesting this species may belong in the Phyllostachys clade. However, in our analysis, Gaoligongshania was clearly revealed to be a distinct lineage. Additional molecular and morphological studies will be necessary to confirm the positions of Indocalamus sinicus, I. wilsonii, and Gaoligongshania. 4.4. Phylogenetic utility of non-coding chloroplast DNA in the tribe Arundinarieae As phylogenetic studies move to focus on lower-level taxonomic groups, it has become apparent that a multi-locus approach is necessary to obtain a sufficient number of phylogenetically informative characters, especially when using the relatively slowly evolving chloroplast genome. Many recent investigations have used the combined analysis of several non-coding cpDNA regions to obtain sufficient characters for phylogenetic resolution (e.g., Perret et al., 2003; Rouhan et al., 2004; Shaw and Small, 2004; Barfuss et al., 2005; Ickert-Bond and Wen, 2006; Smedmark et al., 2006; Fischer et al., 2007; Bellusci et al., 2008; Egan and Crandall, 2008; Panero and Funk, 2008; Yuan and Olmstead, 2008; Rex et al., 2009). At lower taxonomic levels, some non-coding cpDNA regions show sufficient variation for phylogenetic resolution while others do not (e.g., Small et al., 1998; Ohsako and Ohnishi, 2000; Shaw 837 C.-X. Zeng et al. / Molecular Phylogenetics and Evolution 56 (2010) 821–839 and Small, 2004; Shaw et al., 2005; Hughes et al., 2006; Rex et al., 2009). The eight chloroplast regions chosen for this phylogenetic investigation revealed dissimilar characteristics with respect to the amount of variability present within a particular region (Table 4). The rpl32-trnL intergenic spacer, with 6.21% parsimony-informative characters, showed the highest phylogenetic utility at resolving relationships in the temperate bamboos clade, followed by the trnT/L (5.50%) and rps16-trnQ (4.76%) regions. To further assess how many chloroplast intergenic spacers are needed to resolve relationships within the tribe Arundinarieae, we explored the relationships between the number of intergenic spacers and the bootstrap and posterior probability values of the gene trees that support the topology or clades shown in Tables 6 and 7. Although additional chloroplast markers were used, and higher resolution and support especially at some terminal levels could be obtained, the results demonstrated that regardless of methods used, at least four intergenic spacers are needed to obtain the identical gene trees of combined matrix and to recover the major lineages with support of P70% BS and P0.95 PP. These four intergenic spacers, i.e., rpl32-trnL, trnT/L, rps16-trnQ, and rpoBtrnC, can be recommended to resolve major relationships within the tribe Arundinarieae with reliable support, and can be utilized in future studies to test the position of additional species within the current phylogenetic framework. 4.5. Effect of taxon sampling in the tribe Arundinarieae Increasing taxon sampling might reduce misleading effects or systematic bias (Wiens, 1998; Zwickl and Hillis, 2002; Hillis et al., 2003; Heath et al., 2008), as it enables a better detection of multiple substitutions at the same nucleotide site. This helps counteract branch-attraction effects and therefore improves phylogenetic inference (Hillis, 1996; Graybeal, 1998; Heath et al., 2008). Some empirical studies have also found that data combination (i.e., multi-locus approaches) of multiple sequences from the same taxon does improve accuracy of phylogenetic inference (e.g., Qiu et al., 1999; Soltis et al., 1999; Bapteste et al., 2002). In our study, we conducted a very broad survey of representatives in the tribe Arundinarieae and emphasized on the Chinese taxa because it accounts for the most morphological diverse and most complex group of this tribe. Compared to the previous studies (Guo et al., 2002; Guo and Li, 2004; Bouchenak-Khelladi et al., 2008; Peng et al., 2008; Triplett and Clark, 2010), there are several conflicts about the placements of some taxa. One apparent example is the Thamnocalamus group and its allies. Because of limited taxa these bamboos were resolved as a monophyletic group (Guo et al., 2002; Guo and Li, 2004), however, with more species, Peng et al. (2008), Triplett and Clark (2010) and our study illustrated that the Thamnocalamus group and its allies are paraphyletic. This indicates that we need to fully test the positions of putative subtribes, genera, and species complexes within a broad phylogenetic context in order to obtain an accurate understanding of relationships. Moreover, Shibataea chinensis was supported as sister to Thamnocalamus spathiflorus according to Bouchenak-Khelladi et al. (2008), however, Peng et al. (2008) and our results showed that these two species were embedded within two different clades. These types of observations indicate that the true phylogeny might not be reflected if only one or two representatives of a genus were Table 6 Bayesian posterior probability for key clades under different data combinations. Chimonocalamus (III) Shibataea clade (IV) Phyllostachys clade (V) Arundinaria clade (VI) VI: North American subclade VI: Sasa subclade VI: Medake subclade VI: Sinicae subclade VI: Medake subclade sister to Sinicae subclade Thamnocalamus (VII) Indocalamus wilsonii (VIII) Bergbamboes (I) sister to Indocalamus wilsonii (VIII) Gaoligongshania (IX) sister to clade II + III Indocalamus sinicus (X) 1 2 3 Posterior probability values 4 5 6 7 8 0.89 1.00 0.55 NP NP 1.00 NP NP NP 0.85 1.00 0.89 NP 1.00 1.00 1.00 1.00 1.00 0.99 1.00 1.00 1.00 1.00 1.00 1.00 1.00 0.87 1.00 1.00 1.00 1.00 1.00 0.99 1.00 1.00 1.00 1.00 1.00 1.00 0.94 1.00 1.00 1.00 1.00 1.00 1.00 0.99 1.00 1.00 1.00 1.00 1.00 1.00 0.88 1.00 1.00 1.00 1.00 1.00 1.00 0.99 1.00 1.00 1.00 1.00 1.00 1.00 0.91 1.00 1.00 1.00 1.00 1.00 1.00 0.99 1.00 1.00 1.00 1.00 1.00 1.00 0.86 1.00 1.00 0.97 0.93 0.29 0.87 NP 0.99 NP NP NP 0.99 0.99 0.86 NP 0.99 1.00 1.00 1.00 0.98 0.94 1.00 1.00 NP 0.99 1.00 1.00 0.99 NP 1.00 NP, clade not present in tree. ‘‘1–8” means the analysis of different combined dataset according to the criterion mentioned in Section 2.5. Table 7 Parsimony bootstrap support for key clades under different data combinations. Chimonocalamus (III) Shibataea clade (IV) Phyllostachys clade (V) Arundinaria clade (VI) VI: North American subclade VI: Sasa subclade VI: Medake subclade VI: Sinicae subclade VI: Medake subclade sister to Sinicae subclade Thamnocalamus (VII) Indocalamus wilsonii (VIII) Bergbamboes (I) sister to Indocalamus wilsonii (VIII) Gaoligongshania (IX) sister to clade II + III Indocalamus sinicus (X) 1 2 Bootstrap values 3 4 5 6 7 8 NP 67 NP NP NP 76 NP NP NP NP 96 NP NP 87 95 77 59 NP NP 95 81 NP NP 92 100 NP NP 100 96 91 57 71 57 91 98 85 70 97 100 NP NP 100 98 92 52 88 65 93 100 92 75 100 100 NP NP 100 100 94 61 87 62 92 99 92 73 100 100 NP NP 100 100 99 65 92 62 96 100 99 90 100 100 NP 51 100 100 99 68 94 60 99 100 99 95 100 100 NP NP 100 57 52 NP NP NP 93 57 NP NP 64 99 NP NP 94 NP, clade not present in tree. ‘‘1–8” means the analysis of different combined dataset according to the criterion mentioned in Section 2.5. 838 C.-X. Zeng et al. / Molecular Phylogenetics and Evolution 56 (2010) 821–839 used to study the generic relationships within the temperate bamboos when a genus has not been established to be monophyletic. Extensive taxon sampling is essential for future studies. Acknowledgments This study was supported by the National Basic Research Program of China (973 Program, Grant No.: 2007CB411601) and the National Natural Science Foundation of China (Grant No: 30770154), also partly supported by the Knowledge Innovation Program of the Chinese Academy of Sciences (Grant No.: KSCX2YW-N-029), and grants from the National Geographic Society (U.S.A.) (7336-02 to Lynn G. Clark and De-Zhu Li) and the National Science Foundation (U.S.A.) (DEB-0515712 to Lynn G. Clark). We are indebted to Professor Yu-Long Ding of Nanjing Forestry University; to Professor Nian-He Xia, Dr. Yun-Fei Deng, and Mr. Ru-Shun Lin of South China Botanical Garden, Chinese Academy of Sciences (CAS); to Professor Tong-Pei Yi and Mr. Lin Yang of Sichuan Agricultural University; and to Professors Shui-Sheng You and Shi-Pin Chen of Fujian Agriculture and Forestry University for their essential and generous help during field work. We would also like to thank Drs. Zhen-Hua Guo, Han-Qi Yang, Lian-Ming Gao, Jin-Mei Lu, Hong-Tao Li and other colleagues at the Key Laboratory of Biodiversity and Biogeography of the Kunming Institute of Botany, CAS for much practical and theoretical help throughout the course of this research. We also specially thank Dr. Lei Xie at the College of Biological Sciences and Biotechnology, Beijing Forestry University for his valuable suggestions for revising the manuscript. References Bapteste, E., Brinkmann, H., Lee, J.A., Moore, D.V., Sensen, C.W., Gordon, P., Durufle, L., Gaasterland, T., Lopez, P., Muller, M., Phillippe, H., 2002. The analysis of 100 genes supports the grouping of three highly divergent amoebae: Dictyostelium, Entamoeba, and Mastigamoeba. Proc. Natl. Acad. Sci. USA 99, 1414–1419. Barfuss, M.H.J., Samuel, R., Till, W., Stuessy, T.F., 2005. Phylogenetic relationships in subfamily Tillandsioideae (Bromeliaceae) based on DNA sequence data from seven plastid regions. Am. J. Bot. 92, 337–351. Bellusci, F., Pellegrino, G., Palermo, A.M., Musacchio, A., 2008. Phylogenetic relationships in the orchid genus Serapias L. based on noncoding regions of the chloroplast genome. Mol. Phylogenet. Evol. 47, 986–991. Bouchenak-Khelladi, Y., Salamin, N., Savolainen, V., Forest, F., Van der Bank, M., Chase, M.W., Hodkinson, T.R., 2008. Large multi-gene phylogenetic trees of the grasses (Poaceae): progress towards complete tribal and generic level sampling. Mol. Phylogenet. Evol. 47, 188–505. Bouchenak-Khelladi, Y., Verboom, G.A., Hodkinson, T.R., Salamin, N., Francois, O., NíChonghaile, G., Savolainen, V., 2009. The origins and diversification of C4 grasses and savanna-adapted ungulates. Glob. Change Biol. 15, 2397–2417. Bystriakova, N., Kapos, V., Lysenko, I., Stapleton, C.M.A., 2003a. Distribution and conservation status of forest bamboo biodiversity in the Asia-Pacific region. Biodivers. Conserv. 12, 1833–1841. Bystriakova, N., Kapos, V., Stapleton, C.M.A., Lysenko, I., 2003b. Bamboo Biodiversity: Information for Planning Conservation and Management in the Asia-Pacific Region. UNEP-World Conservation Monitoring Center and International Network for Bamboo and Rattan, Cambridge, UK. Clark, L.G., Triplett, J.K., 2007. Arundinaria. In: Flora of North America Editorial Committee (Eds.), 1993+. Flora of North America North of Mexico, 14+ vols. New York and Oxford, vol. 24. pp. 17–24. Clark, L.G., Zhang, W.P., Wendel, J.F., 1995. A phylogeny of the grass family (Poaceae) based on ndhF sequence data. Syst. Bot. 20, 436–460. Clayton, W.D., Renvoize, S.A., 1986. Genera Graminum, Grasses of the World. Her Majesty’s Stationery Office, London. Chao, C.S., Chu, C.D., Hsiung, W.Y., 1980. A revision of some genera and species of Chinese bamboos. Acta Phytotax. Sinica 18, 20–36. Chao, C.S., Renvoize, S.A., 1989. Revision of species described under Arundinaria (Gramineae) in South-east Asia and Africa. Kew Bull. 44, 349–367. Cunningham, C.W., 1997. Can three incongruence tests predict when data should be combined? Mol. Biol. Evol. 14, 733–740. Demesure, B., Sodzi, N., Petit, R.J., 1995. A set of universal primers for amplification of polymorphic non-coding regions of mitochondrial and chloroplast DNA in plants. Mol. Ecol. 4, 129–131. Doyle, J.J., Davis, J.I., Soreng, R.J., Garvin, D., Anderson, M.J., 1992. Chloroplast DNA inversions and the origin of the grass family (Poaceae). Proc. Natl. Acad. Sci. USA 89, 7722–7726. Doyle, J.J., Doyle, J.L., 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem. Bull. 19, 11–15. Dransfield, S., Widjaja, E.A., 1995. Plant Resources of South-East Asia, No. 7, Bamboos. Backhuys Publishers, Leiden. Egan, A.N., Crandall, K.A., 2008. Incorporating gaps as phylogenetic characters across eight DNA regions: ramifications for North American Psoraleeae (Leguminosae). Mol. Phylogenet. Evol. 46, 532–546. Farris, J.S., Källersjö, M., Kluge, A.G., Bult, C., 1994. Testing significance of incongruence. Cladistics 10, 315–319. Felsenstein, J., 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39, 783–791. Fischer, G.A., Gravendeel, B., Sieder, A., Andriantiana, J., Heiselmayer, P., Cribb, P.J., Smidt, E. de C., Samuel, R., Kiehn, M., 2007. Evolution of resupination in Malagasy species of Bulbophyllum (Orchidaceae). Mol. Phylogenet. Evol. 45, 358–376. Gaut, B.S., Clark, L.G., Wendel, J.F., Muse, S.V., 1997. Comparisons of the molecular evolutionary process at rbcL and ndhF in the grass family (Poaceae). Mol. Biol. Evol. 14, 769–777. Grass Phylogeny Working Group (GPWG), 2001. Phylogeny and subfamilial classification of the grasses (Poaceae). Ann. Mo. Bot. Gard. 88, 373–457. Graybeal, A., 1998. Is it better to add taxa or characters to a difficult phylogenetic problem? Syst. Biol. 47, 9–17. Guo, Z.H., Chen, Y.Y., Li, D.Z., Yang, J.B., 2001. Genetic variation and evolution of the alpine bamboos (Poaceae: Bambusoideae) using DNA sequence data. J. Plant Res. 114, 315–322. Guo, Z.H., Chen, Y.Y., Li, D.Z., 2002. Phylogenetic studies on the Thamnocalamus group and its allies (Gramineae: Bambusoideae) based on ITS sequence data. Mol. Phylogenet. Evol. 22, 20–30. Guo, Z.H., Li, D.Z., 2004. Phylogenetics of the Thamnocalamus group and its allies (Gramineae: Bambusoideae): inference from the sequences of GBSSI gene and ITS spacer. Mol. Phylogenet. Evol. 30, 1–12. Heath, T.A., Hedtke, S.M., Hillis, D.M., 2008. Taxon sampling and the accuracy of phylogenetic analyses. J. Syst. Evol. 46, 239–257. Hillis, D.M., 1996. Inferring complex phylogenies. Nature 383, 130–131. Hillis, D.M., Bull, J.J., 1993. An empirical test of bootstrapping as a method for assessing confidence in phylogenetic analysis. Syst. Biol. 42, 182–192. Hillis, D.M., Pollock, D.D., McGuire, J.A., Zwickl, D.J., 2003. Is sparse taxon sampling a problem for phylogenetic inference? Syst. Biol. 52, 124–126. Hsueh, C.J., Yi, T.P., 1979. Two new genera of Bambusoideae from S.W. China, 1: Chimonocalamus Hsueh et Yi. Acta Bot. Yunnanica 1, 74–92. Hsueh, C.J., Yi, T.P., 1983. Two new species of bamboos from China. Acta Phytotax. Sinica 21, 94–99. Hu, C.H., 1985. A revision of the genus Sasa from China. Bamboo Res. 2, 56–63. Hughes, C.E., Eastwood, R.J., Bailey, C.D., 2006. From famine to feast? Selecting nuclear DNA sequence loci for plant species-level phylogeny reconstruction. Phil. Trans. R. Soc. B 361, 211–225. Ickert-Bond, S.M., Wen, J., 2006. Phylogeny and biogeography of Altingiaceae: evidence from combined analysis of five non-coding chloroplast regions. Mol. Phylogenet. Evol. 39, 512–528. Janzen, D.H., 1976. Why bamboos wait so long to flower. Annu. Rev. Ecol. Syst. 7, 347–391. Jeanmougin, F., Thompson, J.D., Gouy, M., Higgins, D.G., Gibson, T.J., 1998. Multiple sequence alignment with Clustal X. Trends Biochem. Sci. 23, 403–405. Judziewicz, E.J., Clark, L.G., Londoño, X., Stern, M.J., 1999. American Bamboos. Smithsonian Institution Press, Washington, DC. Kawakita, A., Sota, T., Ascher, J.S., Ito, M., Tanaka, H., Kato, M., 2003. Evolution and phylogenetic utility of alignment gaps within intron sequences of three nuclear genes in Bumble Bees (Bombus). Mol. Biol. Evol. 20, 87–92. Keng, P.C., 1986. A preliminary study of the inflorescence type arising from bamboos and its variation. J. Wuhan Bot. Res. 4, 323–336. Keng, P.C., Wang, C.P., 1996. Flora Reipublicae Popularis Sinicae, vol. 9. Science Press, Beijing. Lee, M.S.Y., 2001. Uninformative characters and apparent conflict between molecules and morphology. Mol. Biol. Evol. 18, 676–680. Li, D.Z., 1997. The Flora of China Bambusoideae project—problems and current understanding of bamboo taxonomy in China. In: Chapman, G.P. (Ed.), The Bamboos. Linnean Society Symposium Series 19. Academic Press, London, United Kingdom, pp. 61–81. Li, D.Z., 1999. Taxonomy and biogeography of the Bambuseae (Gramineae: Bambusoideae). In: Rao, A.N., Rao, V.R. (Eds.), Bamboo-Conservation, Diversity, Ecogeography, Germplasm, Resource Utilization and Taxonomy. Proceeding of training course cum workshop, 10–17 May 1998, Kunming & Xishuangbanna, Yunnan, China. IPGRI-APO, Serdagn, Malaysia, pp. 14–23. Li, D.Z., Hsueh, C.J., Xia, N.H., 1995. Gaoligongshania, a new bamboo genus from Yunnan, China. Acta Phytotax. Sinica 33, 597–601. Li, D.Z., Stapleton, C.M.A., Xue, J.R., 1996. A new combination in Ampelocalamus and notes on A. patellaris (Gramineae: Bambusoideae). Kew Bull. 51, 809–813. Li, D.Z., Wang, Z.P., Zhu, Z.D., Xia, N.H., Jia, L.Z., Guo, Z.H., Yang, G.Y., Stapleton, C.M.A., 2006. Bambuseae (Poaceae). In: Wu, Z.Y., Raven, P.H., Hong, D.Y. (Eds.), Flora of China, vol. 22. Science Press and Missouri Botanical Garden Press, Beijing and St. Louis. Liang, T.G., Huang, K.F., Zheng, Q.F., Shen, R.Z., Kong, F.S., Xie, Q.M., Lin, Y.Y., 1987. Bamboos in Fujian. Fujian Science and Technology Publishing House, Fuzhou. pp. 128–131. Nakai, T., 1925. Two new genera of Bambusaceae, with special remarks on the related genera growing in eastern Asia. J. Arnold Arbor. 6, 145–153. Nakai, T., 1931. Gramineae-Bambuseae in Miybe et Kudo, Flora of Hokkaido and Saghalin II. J. Fac. Agr. Hokkaido Univ. 26, 180–195. C.-X. Zeng et al. / Molecular Phylogenetics and Evolution 56 (2010) 821–839 Ní Chonghaile, G., 2002. Systematics of the woody bamboos (Tribe Bambuseae). Unpublished Ph.D. thesis. University of Dublin, Trinity College, Ireland. Ohrnberger, D., 1999. The Bamboos of the World: Annotated Nomenclature and Literature of the Species and the Higher and Lower Taxa. Elsevier Science B.V., Amsterdam. Ohsako, T., Ohnishi, O., 2000. Intra- and interspecific phylogeny of wild Fagopyrum (Polygonaceae) species based on nucleotide sequences of noncoding regions in chloroplast DNA. Am. J. Bot. 87, 573–582. Panero, J.L., Funk, V.A., 2008. The value of sampling anomalous taxa in phylogenetic studies: major clades of the Asteraceae revealed. Mol. Phylogenet. Evol. 47, 757–782. Peng, S., Yang, H.Q., Li, D.Z., 2008. Highly heterogeneous generic delimitation within the temperate bamboo clade (Poaceae: Bambusoideae): evidence from GBSSI and ITS sequences. Taxon 57, 799–810. Perret, M., Chautems, A., Spichiger, R., Kite, G., Savolainen, V., 2003. Systematics and evolution of tribe Sinningieae (Gesneriaceae): evidence from phylogenetic analyses of six plastid DNA regions and nuclear ncpGS. Am. J. Bot. 90, 445–460. Posada, D., Buckley, T.R., 2004. Model selection and model averaging in phylogenetics: advantages of akaike information criterion and Bayesian approaches over likelihood ratio tests. Syst. Biol. 53, 793–808. Posada, D., Crandall, K.A., 1998. Modeltest: testing the model of DNA substitution. Bioinformatics 14, 817–818. Qiu, Y.L., Lee, J., Bernasconi-Quadroni, F., Soltis, D.E., Soltis, P.S., Zanis, M., Zimmer, E.A., Chen, Z., Savolainen, V., Chase, M.W., 1999. The earliest angiosperms: evidence from mitochondrial, plastid and nuclear genomes. Nature 402, 404–407. Ren, Y., Li, Y., Dang, G.D., 2003. A new species of Bashania (Poaceae: Bambusoideae) from Mt. Qingling, Shaanxi, China. Novon 13, 473–476. Rex, M., Schulte, K., Zizka, G., Peters, J., Vásquez, R., Ibisch, P.L., Weising, K., 2009. Phylogenetic analysis of Fosterella L.B. Sm. (Pitcairnioideae, Bromeliaceae) based on four chloroplast DNA regions. Mol. Phylogen. Evol. 51, 472–485. Ronquist, F., Huelsenbeck, J.P., 2003. MRBAYES 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19, 1572–1574. Rouhan, G., Dubuisson, J.Y., Rakotondrainibe, F., Motley, T.J., Mickel, J.T., Labat, J.N., Moran, R.C., 2004. Molecular phylogeny of the fern genus Elaphoglossum (Elaphoglossaceae) based on chloroplast non-coding DNA sequences: contributions of species from the Indian Ocean area. Mol. Phylogenet. Evol. 33, 745–763. Saltonstall, K., 2001. A set of primers for amplification of noncoding regions of chloroplast DNA in the grasses. Mol. Ecol. Notes 1, 76–78. Shaw, J., Lickey, E.B., Beck, J.T., Farmer, S.B., Liu, W.S., Miller, J., Siripun, K.C., Winder, C.T., Schilling, E.E., Small, R.L., 2005. The tortoise and the hare II: relative utility of 21 noncoding chloroplast DNA sequences for phylogenetic analysis. Am. J. Bot. 92, 142–168. Shaw, J., Lickey, E.B., Schilling, E.E., Small, R.L., 2007. Comparison of whole chloroplast genome sequences to choose noncoding regions for phylogenetic studies in angiosperms: the tortoise and the hare III. Am. J. Bot. 94, 275–288. Shaw, J., Small, R.L., 2004. Addressing the ‘‘hardest puzzle in American pomology:” phylogeny of Prunus Sect. Prunocerasus (Rosaceae) based on seven noncoding chloroplast DNA regions. Am. J. Bot. 91, 985–996. Simmons, M.P., Ochoterena, H., 2000. Gaps as characters in sequence-based phylogenetic analyses. Syst. Biol. 49, 369–381. Sjolin, E., Erseus, C., Kallersjo, M., 2005. Phylogeny of Tubificidae (Annelida, Clitellata) based on mitochondrial and nuclear sequence data. Mol. Phylegenet. Evol. 35, 431–441. Small, R.L., Ryburn, J.A., Cronn, R.C., Seelanan, T., Wendel, J.F., 1998. The tortoise and the hare: choosing between noncoding plastome and nuclear Adh sequences for phylogenetic reconstruction in a recently diverged plant group. Am. J. Bot. 85, 1301–1315. Smedmark, J.E.E., Swenson, U., Anderberg, A.A., 2006. Accounting for variation of substitution rates through time in Bayesian phylogeny reconstruction of Sapotoideae (Sapotaceae). Mol. Phylogenet. Evol. 39, 706–721. Smith, S.A., Donoghue, M.J., 2008. Rates of molecular evolution are linked to life history in flowering plants. Science 322, 86–89. Soderstrom, T.R., Ellis, R.P., 1982. Taxonomic status of the endemic South African Bamboo, Thamnocalamus tessellatus. Bothalia 14, 53–67. Soderstrom, T.R., Ellis, R.P., 1987. The position of bamboo genera and allies in a system of grass classification. In: Soderstrom, T.R., Hiu, K.W., Campbell, C.S., Barkworth, M.F. (Eds.), Grass Systematics and Evolution. Smithsonian Institution Press, Washington, DC, pp. 225–238. 839 Soltis, P.S., Soltis, D.E., Chase, M.W., 1999. Angiosperm phylogeny inferred from multiple genes as a tool for comparative biology. Nature 402, 402–403. Stapleton, C.M.A., 1997. The morphology of woody bamboos. In: Chapman, G.P. (Ed.), The Bamboos. Academic Press, Linnean Society of London Symposium Series, London, pp. 251–267. Sungkaew, S., Stapleton, C.M.A., Salamin, N., Hodkinson, T.R., 2009. Non-monophyly of the woody bamboos (Bambuseae; Poaceae): a multi-gene region phylogenetic analysis of Bambusoideae s.s.. J. Plant Res. 122, 95–108. Suzuki, S., 1978. Index to Japanese Bambusaceae. Gakken Co. Ltd., Tokyo. Swofford, D.L., 2003. PAUP*. Phylogenetic Analysis Using Parsimony ( And Other Methods). Version 4.0b10. Taberlet, P., Gielly, L., Pautou, G., Bouvet, J., 1991. Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Mol. Biol. 17, 1105–1109. Triplett, J.K., 2008. Phylogenetic relationships among the temperate bamboos (Poaceae: Bambusoideae) with an emphasis on Arundinaria and allies. Ph.D. thesis. Iowa State University, Ames, Iowa, USA. Triplett, J.K., Clark, L.G., 2010. Phylogeny of the temperate bamboos (Poaceae: Bambusoideae: Bambuseae) with an emphasis on Arundinaria and allies. Syst. Bot. 35, 102–120. Triplett, J.K., Oltrogge, K.A., Clark, L.G., 2010. Phylogenetic relationships and natural hybridization among the North American woody bamboos (Poaceae: Bambusoideae: Arundinaria). Am. J. Bot. 97, 471–492. Wang, Z.P., Ye, G.H., 1981. Miscellaneous notes on Chinese Bambusoideae. J. Nanjing Univ. Nat. Sci. 1, 91–108. Watson, L., Dallwitz, M.J., 1992. The Grass Genera of the World. CAB International, Wallingford, Oxon, UK. Wen, T.H., 1984. New taxa of Bamboo from China (I). J. Bamboo Res. 3, 23–47. Wiens, J.J., 1998. The accuracy of methods for coding and sampling higher-level taxa for phylogenetic analysis: a simulation study. Syst. Biol. 47, 381–397. Yamane, K., Kawahara, T., 2005. Intra and interspecific phylogenetic relationships among diploid Triticum-Aegilops species (Poaceae) based on base-pair substitutions, indels, and microsatellites in chloroplast noncoding sequences. Am. J. Bot. 92, 1887–1898. Yang, G.Y., Zhao, Q.S., 1993. A revision of the genus Arundinaria Michaux in China (I). J. Bamboo Res. 12, 1–6. Yang, G.Y., Zhao, Q.S., 1994. A revision of the genus Arundinaria Michaux in China (II). J. Bamboo Res. 13, 1–23. Yang, H.-Q., Yang, J.-B., Peng, Z.-H., Gao, J., Yang, Y.-M., Li, D.-Z., 2008. A molecular phylogenetic and fruit evolutionary analysis of the major groups of the paleotropical woody bamboos (Gramineae: Bambusoideae) based on nuclear ITS, GBSSI gene and plastid trnL-F DNA sequences. Mol. Phylogenet. Evol. 48, 809–824. Yi, T.P., 2001. A new species of the genus Indosasa McClure from Yunnan, China. J. Bamboo Res. 20, 1–3. Yi, T.P., Shi, J.Y., Ma, L.S., Wang, H.T., Yang, L., 2008. Iconographia Bambusoidearum Sinicarum. Science Press, Beijing. Yi, T.P., Shi, J.Y., Ma, L.S., Yang, L., Wang, H.T., 2007a. A report on a new bamboo species in Northeast Yunnan, China. J. Sichuan Forest. Sci. Tech. 28, 1–3. Yi, T.P., Shi, J.Y., Ma, L.S., Yang, L., Wang, H.T., 2007b. Indocalamus jinpingensis T.P. Yi and J.Y. Shi, a new species of the Gramineae from South Yunnan, China. Acta Phytotax. Sinica 45, 693–695. Yi, T.P., Yang, L., 1998. A new species of the alpine bamboo from China. J. Bamboo Res. 17, 1–3. Yuan, Y.W., Olmstead, R.G., 2008. A species-level phylogenetic study of the Verbena complex (Verbenaceae) indicates two independent intergeneric chloroplast transfers. Mol. Phylogenet. Evol. 48, 23–33. Zhang, Y.X., Li, D.Z., in press. A new combination in Pseudosasa with a revised description of Indosasa hispida (Poaceae: Bambusoideae). Ann. Bot. Fennici. Zhang, Y. X., Zeng, C. X., Li, D. Z., in preparation. Reticulate evolution of the temperate woody bamboos (Poaceae: Bambusoideae): evidences from nuclear and plastid DNA sequence data. Zhuge, Q., Ding, Y.L., Xu, C., Zou, H.Y., Huang, M.R., Wang, M.X., 2004. Phylogeny of the genus Arundinaria based on nucleotide sequences of nrDNA ITS region. Acta Genetica Sinica 31, 349–356. Zwickl, D.J., Hillis, D.M., 2002. Increased taxon sampling greatly reduces phylogenetic error. Syst. Biol. 51, 588–598.

RELATED PAPERS

RELATED TOPICS

Log In

Large multi-locus plastid phylogeny of the tribe Arundinarieae (Poaceae: Bambusoideae) reveals ten major lineages and low rate of molecular divergence

Large multi-locus plastid phylogeny of the tribe Arundinarieae (Poaceae: Bambusoideae) reveals ten major lineages and low rate of molecular divergence

Related Papers

RELATED PAPERS

RELATED TOPICS