Molecular Phylogenetics and Evolution 45 (2007) 358–376 www.elsevier.com/locate/ympev Evolution of resupination in Malagasy species of Bulbophyllum (Orchidaceae) Gunter A. Fischer a,b,*, Barbara Gravendeel c, Anton Sieder a, Jacky Andriantiana d, Paul Heiselmayer b, Phillip J. Cribb e, Eric de Camargo Smidt f, Rosabelle Samuel g, Michael Kiehn a b a Department of Biogeography and Botanical Garden, University of Vienna, Rennweg 14, 1030 Vienna, Austria Department of Organismic Biology, Ecology and Diversity of Plants, University of Salzburg, Hellbrunnerstrasse 34, 5020 Salzburg, Austria c National Herbarium of The Netherlands, Leiden University, Einsteinweg 2, P.O. Box 9514, 2300 RA Leiden, The Netherlands d Parc Botanique et Zoologique de Tsimbazaza (PBZT), Rue Fernand KASANGA, Tsimbazaza, Antananarivo 101, Madagascar e The Herbarium, Royal Botanic Gardens, Kew, Richmond, Surrey TW9 3AE, UK f Feira de Santana State University, Department of Biological Sciences, Laboratory of Molecular Systematics of Plants, Road BR 116, Km 03, Feira de Santana, Bahia 44031-460, Brazil g Department of Systematic and Evolutionary Botany, University of Vienna, Rennweg 14, 1030 Vienna, Austria Received 3 January 2007; revised 5 June 2007; accepted 22 June 2007 Available online 18 July 2007 Abstract Resupination is the orientation of zygomorphic flowers during development so that the median petal obtains the lowermost position in the mature flower. Despite its evolutionary and ecological significance, resupination has rarely been studied in a phylogenetic context. Ten types of resupination occur among the 210 species of the orchid genus Bulbophyllum on Madagascar. We investigated the evolution of resupination in a representative sample of these species by first reconstructing a combined nrITS and cpDNA phylogeny for a sectional reclassification and then plotting the different types of inflorescence development, which correlated well with main clades. Resupination by apical drooping of the rachis appears to have evolved from apical drooping of the peduncle. Erect inflorescences with resupinate flowers seem to have evolved several times into either erect inflorescences with (partly) non-resupinate flowers or pendulous inflorescences with resupinate flowers.  2007 Elsevier Inc. All rights reserved. Keywords: Bulbophyllum; nrITS; trnL–trnF; trnF–ndhJ; psbA–trnH; trnE–trnD; Orchids; Phylogeny; Resupination 1. Introduction Resupination (from the Latin resupinus, which means facing upward) is the turning of floral buds in such a way that the median petal (called a labellum or lip in orchids) becomes the lowermost part of an opening flower (Ames, 1938). The latter can be achieved by torsion of the pedicel of the flower or other processes like the drooping of parts * Corresponding author. Address: Department of Organismic Biology, Ecology and Diversity of Plants, University of Salzburg, Hellbrunnerstrasse 34, 5020 Salzburg, Austria. Fax: +43 662 8044 142. E-mail address: gunter.fischer@sbg.ac.at (G.A. Fischer). 1055-7903/$ - see front matter  2007 Elsevier Inc. All rights reserved. doi:10.1016/j.ympev.2007.06.023 of the inflorescence as well as development of pendulous inflorescences (Goebel, 1924; Ernst and Arditti, 1994). It is a common phenomenon in orchids and considered to be a diagnostic character of the family (Dressler, 1981). Although scientific evidence for its evolutionary and functional role is still lacking, resupination is generally assumed to expose the upper surface of orchid lips to light in order to emphasize colours and patterns to attract pollinators and facilitate pollination (Ernst and Arditti, 1994). Several physiological processes controlling resupination have been unraveled such as gravitropism and auxin levels (Goebel, 1924; Ernst and Arditti, 1994) but the phenomenon is still poorly understood. Even less is known about the evolution G.A. Fischer et al. / Molecular Phylogenetics and Evolution 45 (2007) 358–376 of resupination as only very few studies have examined the trait in a phylogenetic context (Clark and Zimmer, 2003; Lavin et al., 2003). The genus Bulbophyllum has recently been estimated to comprise  2400 species (Sieder et al., 2007). Its mostly epiphytic species are found in different habitats ranging from (sub)tropical dry forests to wet montane cloud forests and most of them are adapted to fly pollination (Bartareau, 1994; Borba and Semir, 1998; Tan et al., 2002; Nishida et al., 2004; Teixeira et al., 2004). In contrast with the majority of the orchids, an extremely large variation in ways of inflorescence development leading to resupination is present in the 210 species of Bulbophyllum currently described from Madagascar. Inflorescences are either pendulous or erect and resupination can be achieved through torsion of the pedicel and/or rachis (the part of the inflorescence containing flowers) or apical drooping of the peduncle (the sterile part of the inflorescence). This makes the genus an excellent model to study the evolution of development of resupination. For studying the evolution of resupination in Madagascan Bulbophyllum, a good phylogeny is needed. In recent years, several molecular phylogenetic studies of orchids have been published (Hedren et al., 2001; Pridgeon and Chase, 2001; Pridgeon et al., 2001b, 2003; Bateman et al., 2003; Cameron, 2004; Van den Berg et al., 2005; Carlsward et al., 2006) placing Bulbophyllum as sister to the genus Dendrobium within tribe Dendrobieae in the higher Epidendroids clade of subfamily Epidendroideae. Detailed molecular phylogenetic studies of Bulbophyllum have not been published to date but several are being prepared (Gravendeel et al., in preparation; Smidt et al., in preparation). The main objectives of the present study are to (1) reconstruct a multi-gene based phylogeny of Bulbophyllum on Madagascar; (2) test the monophyly of Madagascan Bulbophyllum; (3) compare this phylogeny with the infrageneric classifications of Madagascan Bulbophyllum proposed in the past and (4) reconstruct the evolution of resupination in this group of orchids using a phylogenetic framework. We investigated the phylogenetic relationships of the species of Bulbophyllum on Madagascar by analysing DNA sequences of the plastid trnL–trnF, trnF–ndhJ, psbA–trnH, trnE–trnD and nrITS regions. The trnL–trnF and nrITS regions are widely used within Orchidaceae to reconstruct phylogenetic relationships and have been 359 shown useful for detecting DNA sequence divergence at the rank of species (Pridgeon et al., 1999, 2001a, 2003, 2005). Recently, the psbA–trnH region was proposed to be suitable for DNA bar-coding (Kress et al., 2005). The usefulness of the regions of trnF–ndhJ, psbA–trnH, and trnE–trnD for the reconstruction of phylogenetic relationships between closely related orchid species has not been reported previously (Fig. 1). 2. Materials and methods 2.1. Taxon sampling Species representing all sections of Madagascan Bulbophyllum as described by Schlechter (1924), Perrier de la Bâthie (1939), Bosser (1965, 1969, 1971, 1989, 2000, 2004) and Du Puy et al. (1999) were sampled except for the small sections Lyperocephalum [one species] and Lyperostachys [two species] for which it was not possible to obtain material (see Appendix A). A total of 65% of the species currently described for Madagascar was sampled. From all specimens investigated and from all types, drawings were prepared for identification. For sections Loxosepalum and Ploiarium, whose members are very difficult to distinguish from one other, it was not always possible to identify all accessions to species or to apply a valid name. Further taxonomic and nomenclatural work is necessary for these taxa. Living or silica dried samples were collected in Madagascar in the wild or taken from plants in the living collections at the Parc Botanique et Zoologique de Tsimbazaza (PBZT) in Antananarivo, Madagascar, or at the Botanical Gardens of the Universities of Vienna and Salzburg, all with the appropriate permission. Additional DNA samples were obtained from the Jodrell Laboratories, Kew. Voucher specimens for all accessions have been deposited in one or several of the following herbaria: Parc Botanique et Zoologique Tsimbazaza (TAN, Madagascar), University of Vienna (WU, Austria), University of Salzburg (SZU, Austria) or Royal Botanic Gardens Kew (K, UK). A total of 29 species of Bulbophyllum representing all major continents where the genus occurs, i.e., Africa, South America and Southeast Asia, were chosen as outgroups based on phylogenetic analyses of the Bulbophyllinae worldwide (Gravendeel et al., in preparation). 2.2. DNA extraction, amplification, and sequencing Fig. 1. Overview of the trnL–trnF and the flanking ndhJ region sequenced. Arrows indicate the position and direction of primers used. The total length of the amplified region comprised 2272 bp. DNA was extracted from silica gel preserved, herbarium or fresh material using the 2· CTAB (cetyltrimethyl ammonium bromide) procedure of Doyle and Doyle (1987). PCR amplification was performed using GoTaq DNA Polymerase, 5· Green GoTaq Reaction Buffer, PCR Nucleotide Mix (all Promega GmbH, Vienna, Austria) following the manufacturer’s protocol and 2–8 ng template DNA for a 50 ll reaction mixture. 360 G.A. Fischer et al. / Molecular Phylogenetics and Evolution 45 (2007) 358–376 Multiple Sequence alignments were performed using ClustalX (Thompson et al., 1997) and VectorNTI (Invitrogen Corp.) with default settings. Verified sequences were visually inspected and manually adjusted using MacClade 4.08 OSX (Maddison and Maddison, 2005). In the trnL– trnF matrix, an unalignable 64 bp part of the spacer region had to be excluded from the phylogenetic analyses for all of the species analysed. Due to the presence of multiple copies, the complete trnL–trnF region had to be excluded for all species of sections Bifalcula and Calamaria. Indel coding was done manually following the simple coding method of Simmons and Ochoterena (2000) and with the aid of the program Seqstate (Müller, 2003b). PAUP* 4.0b10 (Swofford, 2002) and PRAP (Müller, 2003a), which generate a command file for conducting parsimony ratchet searches with PAUP*. For each of the ten random additions, 200 ratchet iterations were performed. Each iteration comprised two rounds of TBR swapping, saving one shortest tree, which was used to compute a strict consensus. No further cycles had to be added since the same tree score was soon reached. Support was estimated using 1000 bootstrap replicates, saving 100 trees per replicate. Bootstrap percentages were interpreted as weak (50– 74%), moderate (75–84%) or high (85–100%). Congruence between nrITS and the combined cpDNA data sets were tested using the incongruence length difference (ILD) test (Farris et al., 1995) as implemented by the partition homogeneity test in PAUP* for 100 replicates (heuristic search, simple addition, TBR branching swapping), each saving a maximum of 1000 most parsimonious trees per replicate. This method has been criticized recently (Dolphin et al., 2000; Reeves et al., 2001; Yoder et al., 2001; Norup et al., 2006), therefore we combined the two data sets to explore whether resolution and support would be improved by increasing the amount of sequencing data. This ‘‘hard’’ incongruence test was performed by directly visually comparing the support and resolution of each of the clades of the separate analyses with a higher bootstrap and posterior probability than BP > 75 and PP > 90 (Wiens, 1998; Sheahan and Chase, 2000; Norup et al., 2006). Bayesian Inference (BI) was generated for the individual markers, for the combined cpDNA dataset and for all molecular markers combined using MrBayes 3.2.1 (Huelsenbeck and Ronquist, 2001) using default settings. The best fitting model of sequence evolution (GTR + I + G) was chosen based on the result of a hierarchical likelihood ratio test conducted with Modeltest 3.7 (Posada and Crandall, 1998, 2001). Four Markov chains were run simultaneously for 1,000,000 generations and every 10th generation was sampled. After 250,000 generations, a stable probability was reached. All non-significant generations (p < 0.5) were discarded for the consensus tree. In total, 25 vegetative and floral characters (binary and multistate) were scored for the species from which DNA sequences could be obtained (see Table 1) based on observations from living material, alcohol preserved specimens and photographs. If a section or clade showed more than one character state or if the character state was unclear, the assumption ‘‘equivocal’’ was assigned. Character state optimization was reconstructed using a maximum parsimony assumption (ACCTRAN and DELTRAN optimization) in the Trace Character feature in MACCLADE version 4.08 (Maddison and Maddison, 2005). 2.4. Phylogenetic analysis 3. Results Maximum parsimony (MP) analyses were undertaken for the individual markers (nrITS, trnL–trnF, ndhJ, psbA–trnH and trnE–trnD), for the combined cpDNA dataset and for all molecular markers combined using 3.1. Analysis of chloroplast sequence data The Primers 26SE and 17SE of Sun et al. (1994) where used for the amplification of the nrITS regions with the following PCR program: an initial 2 min premelt at 94 C and 34 cycles of 1 min denaturation at 94 C, 1 min annealing at 50 C and 1 min extension at 72 C followed by a final extension for 7 min. For sequencing, the primers ITS4 (TCCTCCGCTTATTGATATGC) and ITS5 (GGAAGT AAAAGTCGTAACAAGG) (White et al., 1990) were used. The cpDNA trnL–trnF intron was amplified using a newly designed primer F1 (CGCTACGGACTTGATTGG AT) and primer F (Taberlet et al., 1991). The trnF–ndhJ intron was amplified using the primers E (Taberlet et al., 1991) and ndhJ of Vijverberg and Bachmann (1999), psbA–trnH using the primers psbA of Sang et al. (1997) and trnHGUG of Tate and Simpson (2003) and trnE–trnD using the primers trnDGUC and trnEUUC of Demesure et al. (1995). Amplification was carried out with an initial 3 min premelt at 94 C and 30 cycles of 30 s denaturation at 94 C, 30 s annealing at 55 C and 1 min 40 s extension at 72 C followed by a final extension for 7 min at 72 C. PCR products were purified using Wizard PCR Preps DNA Purification System (Promega GmbH, Vienna, Austria) and sequenced at Macrogen Inc., Korea. PCR products of nrITS and trnL–trnF were cloned using the TOPO-TA Cloning Kit (Invitrogen Corp.), following the manufacturer’s protocol because multiple copies were found. Resulting colonies were screened and at least five positive clones were sequenced. The program VectorNTI (Invitrogen Corporation) was used to edit and assemble the sequences. All DNA sequences produced for this study were submitted to GenBank. For several species it was not possible to amplify all molecular markers (see Appendix A). 2.3. DNA sequence alignment The combined alignment of all chloroplast markers consisted of 3898 positions (3690 nucleotides and 41 G.A. Fischer et al. / Molecular Phylogenetics and Evolution 45 (2007) 358–376 Table 1 Morphological characters analysed 1 Size of the plant: 0 = minute (<1 cm)/ 1 = small/ 2 = intermediate/ 3 = large 2 Spiral vessels in tissue: 0 = present/1 = absent 3 Fresh sheaths or remnants of fresh sheaths covering the rhizome and part of the pseudobulbs: 0 = present/1 = absent 4 Pseudobulbs: 0 = crowded (distance between bulbs is less than the diameter of a bulb)/ 1 = moderately spaced (distance between bulbs is 1–10 times the diameter of a bulb/ 2 = widely spaced (more than ten times the diameter of a bulb) 5 Pseudobulbs: 0 = adaxially flattened/1 = laterally flattened/ 2 = otherwise 6 Number of leafs per pseudobulbs: 0 = 1/1 = 2 7 Type of inflorescence: 0 = synanthous/1 = hysteranthous 8 Rhachis zigzagging: 0 = yes/1 = no 9 Development of inflorescence types: 0 = A/1 = B/2 = C/3 = D1/ 4 = D2/5 = E1/6 = E2/7 = F/8 = G/9 = H 10 Peduncle setaceous (bristle like): 0 = yes/1 = no 11 Inflorescence: 0 = single-flowered/1 = multi-flowered 12 Length of pedicel: 0 = very short (flowers sit on the rhachis)/ 1 = moderate to long 13 Dorsal sepal margin ornamentation: 0 = with long hairs/ 1 = glabrous/2 = papillose 14 Surface of dorsal sepal: 0 = with long hairs/1 = glabrous/ 2 = papillose/3 = warty 15 Lateral sepal margin ornamentation: 0 = with long hairs/ 1 = glabrous/2 = papillose 16 Surface of lateral sepal: 0 = glabrous/1 = papillose/2 = warty 17 Petal apex margin ornamentation: 0 = with long hairs/1 = glabrous/ 2 = papillose/3 = erose 18 Petal apex surface ornamentation: 0 = with long hairs/1 = glabrous/ 2 = papillose 19 Lateral sepals fused (from the column-foot to the middle): 0 = yes/ 1 = no 20 Lip moveable: 0 = yes/1 = no (lip enclosed by lateral sepals) 21 Upper margins of column with a tooth: 0 = yes/1 = no 22 Lip with basal acute teeth: 0 = present/1 = absent 23 Hairs on the lip: 0 = present/1 = absent 24 Column-foot with basal tooth: 0 = present/1 = absent 25 Lip apex: 0 = recurved/1 = straight autapomorphic indels varying in size from 1 to 587 bp) and contained 364 phylogenetic informative substitutions. Mean pairwise distance in the ingroup ranged from 0% to 10%. MP analyses yielded >10,000 most parsimonious trees (MPTs) with a length of 1265 steps, a Consistency Index (CI) of 0.65 and a Retention Index (RI) of 0.80. The strict consensus tree and the BI trees were highly congruent (data not shown). In both analyses, Madagascan Bulbophyllum were strongly supported (BP99/PP100) as monophyletic with the exception of B. longiflorum (widespread in tropical Africa, Madagascar, the Mascarenes, tropical Asia and the south-west Pacific islands), which was deeply nested within the Asian Cirrhopetalum clade. In all trees, seven main clades (A–H) were present. Clade A (BP87/PP100) consisted of taxa assigned to section Alcistachys, clade B (BP74/PP97) of section Kainochilus, and clade C of sections Bifalcula, Humblotiorchis and Calama- 361 ria (<BP50/PP51). Clade F comprised members of sections Lichenophylax, Trichopus and Pantoblepharon (BP55/ PP91), and clade G was made up of section Loxosepalum (BP87/PP95). Clade H consisted of some of the species of section Ploiarium, and clade E (<BP50/PP73) comprised a large polytomy containing clades F, G, H and taxa from sections Elasmotopus, Hymenopsepalum, Micromonanthe, Lepiophylax, Pachychlamys along with the species of section Ploiarium outside clade G. Clades A–G were positioned on a basal polytomy together with B. cardiobulbum (section Calamaria) and B. petrae (section Polyradices). 3.2. Analysis of nuclear sequence data The total alignment consisted of 906 positions (766 nucleotides and 140 indels varying in size from 1 to 31 bp) and contained 294 phylogenetically informative characters. Mean pairwise distance in the ingroup was similar to the chloroplast dataset. MP analyses yielded >10,000 MPTs with a length of 1724 steps, CI of 0.44 and RI of 0.83. The strict consensus tree and the BI trees were highly congruent with the cpDNA trees and internal nodes received similar statistical support. The monophyly of Malagasy Bulbophyllum with the exception of B. longiflorum was supported by BP88/PP98. 3.3. Combined molecular analysis The partition homogeneity test for the nrITS and cpDNA datasets indicated that the partitions were significantly different from random partitions (p = 0.01). The visual node by node comparison, however, revealed no major incongruencies for the nodes with higher bootstrap support and posterior probability than BP > 75 and PP > 90. The much better resolved tree of the combined analysis compared to the separate analysis of the datasets supports our assumptions that the partition homogeneity test sometimes reveals unreliable results (Dolphin et al., 2000; Reeves et al., 2001; Yoder et al., 2001; Norup et al., 2006), especially for large datasets. The combined MP analyses yielded >10,000 MPTs with a length of 2312 steps, a CI of 0.57 and a RI of 0.81. The total alignment consisted of 4456 characters and resulted in a similar topology that was, however, more fully resolved and better supported than the combined cpDNA and nrITS trees with the exception of B. cardiobulbum which ended up in clade C instead of on the basal polytomy. The MP strict consensus tree (not shown) was highly congruent with the BI tree (see Fig. 2). Monophyly of Madagascan Bulbophyllum (with the exception of B. longiflorum) was supported by BP100/ PP100, and of clades A–H with BP97/PP99, BP100/PP99, BP87/PP80, BP100/PP100, BP67/PP99, BP84/PP99, BP71/PP98, and BP < 50/PP53, respectively. 362 G.A. Fischer et al. / Molecular Phylogenetics and Evolution 45 (2007) 358–376 A 57/76 69/99 97/99 B 72/100 100/99 66/94 97/99 C1 100/100 100/100 69/97 -/93 51/98 53/96 81/99 C 87/80 69/99 60/79 C2 89/93 100/100 55/56 100/100 -/99 -/90 H1 94/100 97/100 59/100 100/100 100/100 -/67 89/100 78/99 75/100 97/100 99/100 84/100 52/97 94/100 100/99 H -/53 100/100 -/58 82/83 67/58 94/100 94/100 69/100 51/95 -/98 85/100 -/69 84/100 -/68 -/90 85/100 80/100 85/99 53/92 97/100 -/95 -/53 89/100 73/73 -/66 95/99 -/73 60/84 -/84 -/55 65/82 -/55 -/55 100/100 74/89 -/62 -/80 -/91 E G1 94/99 100/99 73/61 70/94 62/100 96/100 99/99 G D 79/99 -/97 71/98 67/99 G2 100/100 99/100 F1 F 100/99 100/99 84/99 F2 100/99 100/99 54/- 92/100 99/99 95/99 96/98 95/100 61/90 B. petrae B. variegatum B. hamelinii B. occlusum B. sulfureum B. alexandreae B. edentatum B. anjozorobeense B. horizontale B. imerinense B. minutum B. implexum B. capuronii B. complanatum B. bicoloratum B. occultum B. sp. nov. B. elliotii B. sambiranense B. samibiranese B. sambiranense B. elliotii B. quadrifarium B. sambiranense B. pervillei B. elliotii B. lecouflei B. trifarium B. obtusatum B. humblotii B. cardiobulbum B. analamazoatreae B. analamazoatreae B. oxycalyx var. rubescens B. oxycalyx B. rauhii B. rauhii var. andranobeense B. sp. nov. B. aubrevillei B. francoisii B. francoisii B. amphorimorphum B. liparidioides B. longivaginans B. longivaginans B. vestitum var. meridionale B. vestitum B. molossus B. pachypus B. pachypus B. sandrangatense B. sp. B. jackyi B. coriophorum B. aff. labatii B. turkii B. sp. nov. B. sp. nov. B. insolitum B. aggregatum B. oreodorum B. nitens B. sp. B. sp. B. sp. B. auriflorum B. sp. indet. B. henrici var. rectangulare B. sp. B. sp. B. sp. B. sp. B. humbertii B. henrici var. rectangulare B. ankaizinense B. sp. B. sp. B. sp. B. sp. B. rubiginosum B. sp. B. cyclanthum B. sp. nov. B. sp. B. peyrotii B. platypodum B. amoenum B. ambatoavense B. marovoense B. sp. B. aff. baronii B. aff. sphaerobulbum B. sp. B. sp. B. aff. sphaerobulbum B. aff. baronii B. sp. B. sp. B. nutans B. nutans B. nutans B. nutans B. ventriosum B. ochrochlamys B. sp. B. approximatum B. sp. B. aff. baronii B. aff. baronii B. sp. B. melleum B. sp. B. sp. B. sp. B. sp. B. sp. B. alleizettei B. nutans B. leandrianum B. calyptropus B. conchidioides B. sciaphile B. ikongoense B. sp. nov. B. hapalanthos B. sp. nov. B. ciliatilabrum B. pleurothallopsis B. sp. B. pantoblepharon B. muscicola B. intertextum B. lupulinum B. mayombeense B. barbigerum Africa B. falcatum B. oxychilum B. sp. B. chloropterum B. plumosum South B. glutinosum America B. cribbianum B. bracteolatum B. orectopetalum B. siamense B. smitinandii B. dearei B. dearei B. lobbii B. affine B. macranthum B. patens Asia B. emiliorum B. alsiosum B. hamatipes B. membranifolium B. pileatum B. longiflorum B. longiflorum B. picturatum B. cumingii Asia B. sp. B. biflorum Polyradices Alcistachys Kainochilus Bifalcula Calamaria Humblotiorchis Calamaria Hymenosepalum Elasmotopus Pachychlamys Ploiarium Loxosepalum Micromonanthe Lepiophylax Pachychlamys Lichenophylax Trichopus Pantoblepharon Micromonanthe Outgroup Cirrhopetalum Outgroup sect. Cirrhopetalum Fig. 2. Consensus tree resulting from BI analysis of the combined (nrITS and cpDNA) data. Bootstrap support and posterior probability values are indicated above the nodes. Section names shaded refer to paraphyletic sections whereas names in bold were found to be monophyletic. G.A. Fischer et al. / Molecular Phylogenetics and Evolution 45 (2007) 358–376 4. Discussion 4.1. Monophyly and sectional relationships of Madagascan Bulbophyllum In all molecular datasets, Madagascan Bulbophyllum was found to be monophyletic with the exception of B. longiflorum, the only species of the large section Cirrhopetalum also occurring outside Asia. The two sampled accessions, one from Madagascar and one from the island of La Réunion, were deeply nested within an Asian clade comprising 4 species of section Cirrhopetalum and 14 species from different Asian sections. The morphology of B. longiflorum supports this phylogenetic position as the umbellate inflorescence which characterizes the predominantly Asian section Cirrhopetalum is also present in B. longiflorum, justifying its taxonomic assignment to this section. Phylogenetic analyses of additional samples of this species from other parts of its distribution area such as Africa, Indonesia, Malaysia, the Philippines, Papua New Guinea and the Pacific islands and additional species of sect. Cirrhopetalum (comprising ca. 80 species) might show whether this taxon arrived in Madagascar by long distance dispersal. Only five of the 18 sections described by Schlechter (1924), form strongly supported monophyletic groups in the combined molecular analysis (viz., Alcistachys, Bifalcula, Kainochilus, Lichenophylax, and Loxosepalum). Unique morphological synapomorphies characterizing clades are scarce, but supporting combinations of characters are abundant. All species of section Alcistachys (clade A; BP97/PP99) have laterally flattened, bifoliate pseudobulbs, the plants are large, and the inflorescence is synanthous and multi-flowered. Schlechter (1924) used these same features to characterize this section along with the size of the floral bracts and the surface structure of the anther. The latter traits were not scored in this study as they could not be divided into discrete states. The majority of the species of section Kainochilus (clade B) are large to medium-sized plants with unifoliate or bifoliate, brown to red coloured pseudobulbs, multi-flowered erect inflorescences, a hairy lip, and a column with a large tooth on the upper margin. This latter feature occurs in species of section Kainochilus but also in members of the neotropical section Didactyle although this is probably a convergence as the South American species of Bulbophyllum form a distinct well-supported group (Camargo Smidt et al., in preparation). Schlechter (1924) used the majority of the above mentioned characters to recognize Kainochilus. Section Bifalcula (clade D; BP100/PP100) is characterized by small plants, bifoliate pseudobulbs, and a basal tooth on the lip, which is a unique synapomorphy for this group. All species except B. capuronii have a zigzag rachis. Schlechter (1924) used these additional characters for recognition of sect. Bifalcula. Our analyses showed that the hitherto unplaced B. complanatum clearly belongs to this section as well. 363 Section Lichenophylax (clade F1; BP99/PP100) has very tiny, bifoliate pseudobulbs and obligately single-flowered inflorescences, the last character being unique to this group in Madagascar (Fig. 3E). Bulbophyllum muscicola (sect. Micromonanthe), B. petrae (sect. Polyradices) and B. insolitum (sect. Ploiarium) can be single- or many-flowered, depending on the growing conditions. Section Loxosepalum (clade G1; BP100/PP99) is characterized by uni- or bifoliate pseudobulbs, multi-flowered inflorescences and a glabrous perianth. Six of the 18 sections circumscribed by Schlechter (1924) were found to be paraphyletic in the combined molecular analysis. The transfer of several species to other sections is necessary to make these sections monophyletic as discussed below. All characters used by Schlechter (1924) to circumscribe sections Calamaria and Humblotiorchis (subclade C2) were found to be equivocal based on a morphological analyses (Fischer et al., in preparation). The species in these sections are small to large in size, the pseudobulbs are laterally flattened or roundish and can be crowded or moderately spaced, bear one or two leaves, the inflorescence is multi-flowered, and the lip is hairy or glabrous. It was not possible to identify any character (either molecular or morphological) to distinguish sect. Humblotiorchis from sect. Calamaria. We therefore propose to merge them, the latter name having prioroity. Section Elasmotopus (clade H1) is characterized by bifoliate pseudobulbs, multi-flowered inflorescences and a lip with a recurved apex forming a cup-like structure, characters that are also present in B. analamazaoatrae. Schlechter (1924) nevertheless removed this species from section Elasmotopus and placed it in the monotypic section Hymenosepalum because of its unifoliate pseudobulbs. Our analyses clearly show, however, that B. analamazaoatrae is nested within Elasmotopus and we therefore propose to merge section Hymenosepalum with Elasmotopus to make the latter monophyletic. No morphological traits could be found to characterize the paraphyletic section Micromonanthe which comprises five species of which Bulbophyllum muscicola, B. calyptropus and B. conchidioides were analysed phylogenetically, B. moldekeanum was analysed morphologically (Fischer et al., unpublished data) and B. johannis which lacks a type specimen and therefore remains as an unclear entity. Based on the very short type description (Wendland and Kränzlin, 1894) we propose to treat it as a synonym to Bulbophyllum muscicola which (clade F2) shows features, such as a thin rhizome, crowded pseudobulbs and very polymorphic flowers that Schlechter (1924) believed best fitting sect. Micromonanthe, originally described for taxa from Papua New Guinea. However, these characters are present in many Bulbophyllum species and therefore not useful for delimiting sections. Therefore we propose to disband section Micromonanthe in Madagascar and transfer B. muscicola and B. moldekeanum to section Trichopus (clade F2) to make the latter monophyletic. The other species traditionally assigned to section Micromonathe, B. calyptropus and 364 A: pseudobulbs adaxially flattened laterally flattened otherwise equivocal C: type of inflorescence synanthous hysteranthous E: inflorescence multiflowered singleflowered equivocal G: lip moveable yes no (lip is enclosed by lateral sepals) Pantoblepharon, Micromonanthe Trichopus Lichenophylax Pachychlamys Lepiophylax, Micromonanthe Loxosepalum Ploiarium Pachychlamys Elasmotopus, Hymenosepalum Humblotiorchis Calamaria Calamaria Bifalcula Alcistachys Kainochilus Polyradices Pantoblepharon, Micromonanthe Trichopus Lichenophylax Pachychlamys Lepiophylax, Micromonanthe Loxosepalum Ploiarium Pachychlamys Elasmotopus, Hymenosepalum Humblotiorchis Calamaria Calamaria Bifalcula Alcistachys Kainochilus Polyradices G.A. Fischer et al. / Molecular Phylogenetics and Evolution 45 (2007) 358–376 B: number of leafs per pseudobulb two one equivocal D: peduncle setaceous no yes equivocal F: length of pedicel very short (flowers sit on the rhachis) moderate to long H: hairs on the lip present absent equivocal Fig. 3. Reconstruction of character state evolution of selected morphological key features mapped on the simplified combined (nrITS and cpDNA) phylogeny using a maximum parsimony assumption (ACCTRAN and DELTRAN optimization) with the Trace Character option in MacClade. G.A. Fischer et al. / Molecular Phylogenetics and Evolution 45 (2007) 358–376 B. conchidiodes (clade G2), are phylogenetically nested in clade G2 together with Bulbophyllum sciaphile which belongs to sect. Lepiophylax which is characterized by the unique combination of flattened, bifoliate pseudobulbs and a multi-flowered inflorescence with predominantly white coloured flowers (Schlechter, 1924). B. calyptropus and B. conchidiodes fit morphologically in section Lepiophylax with exception of the unifoliate pseudobulbs. However, within clade G a reversal from one- to two-leafed pseudobulbs occurred several times and should not be regarded as a taxonomic feature to define sections (Fig. 3). As clade G2 received very strong statistical support (BP99/PP100), we propose to transfer B.conchidioides and B. calyptropus to section Lepiophylax which then should be characterized by uni- or bifoliate pseudobulbs. Sections Pantoblepharon and Trichopus (clade F2) are intermixed with one another in the combined molecular phylogeny. Species of both groups have adaxially flattened, unifoliate pseudobulbs (Fig. 3A and B), multi-flowered inflorescences and sepals and petals with hairy or papillose margins, with the exception of B. muscicola. The lip is ciliate in all species and the column-foot has an acute basal tooth. Schlechter (1924) originally defined section Pantoblepharon mainly by the hairy sepals, petals and lip and section Trichopus by the setaceous peduncle, unifoliate pseudobulbs and the shape of the stelidia. The latter trait was not scored in this study as it could not be divided into discrete states. However all the characters provided by Schlechter (1924) seem to fit both sections, keeping the small number of species belonging to these sections (14) in mind, we propose to merge them. Section Pachychlamys was found to be polyphyletic within clade E. Morphologically, section Pachychlamys is characterized by hysteranthous inflorescences and the presence of (remnants of) sheaths covering the rhizome and pseudobulbs. These features are clearly homoplasious (see Fig. 3C and F) and should therefore not be used to define sections. Based on the current phylogenetic position and on the morphological characters (shape of the lip, form of the tepals) it is clear that B. ikongoense should be excluded from section Pachychlamys therefore we propose to placed it in a section of its own. Additional molecular work is needed to asses whether the two recovered subclades in the combined molecular phylogeny of section Pachychlamys and B. liparidioides within clade H, will form a wellsupported clade when faster evolving markers are sequenced. Due to unresolved polytomies or weak statistical support in the combined molecular phylogeny, the status of several remaining sections and species could not yet be fully ascertained. Section Ploiarium (part of clade H) is morphologically well characterized by the (partly fused) lateral sepals, which form a boat-like structure, and immobile lip (Fig. 3G; Schlechter (1924)). In the combined molecular phylogeny, species assigned to this section, however, ended up in five separate subclades forming part of the basal polytomy. Future studies with faster evolving 365 molecular markers will be needed to clarify the status of this section. Although members of sections Ploiarium and Pachychlamys share a very short pedicel (Fig. 3F), our study does not suggest that they are closely related. Bulbophyllum cardiobulbum (clade C), assigned to section Calamaria by Bosser (1965), appears in our combined tree as sister to sections Bifalcula, Calamaria and Humblotiorchis. Morphologically, this species is intermediate as it shows traits of sects. Alcistachys, Calamaria and Kainochilus such as an erect inflorescence, hairs on the lip and laterally flattened two-leafed pseudobulbs. In its current phylogenetic position it is a remnant of an ancestral lineage of clade C. This hypothesis is supported by the recent discovery of a new species which is sister to B. cardiobulbum (Fischer et al., unpublished data). Therefore we propose to put it in a section of its own, to make section Calamaria monophyletic. The monotypic section Polyradices (Fischer et al., 2007) comprises only B. petrae. This species is tiny, lacks spiral vessels and has densely clustered and bilaterally flattened unifoliate pseudobulbs (Fig. 3A and B). Its few-flowered inflorescence is sessile, and the sepals, petals and lip are glabrous (Fig. 3H) but the former are finely papillose on the margin and the latter is slightly papillose beneath. This unique combination of morphological characters is consistent with the isolated position as part of the basal polytomy in our combined molecular phylogeny. 4.2. Evolution of inflorescence development and resupination Resupinate orchid flowers were drawn by several authors as early as the 16th and 17th century (Arditti, 2002). Linnaeus (1780) first employed the term ‘florum resupinatio’ for unfolding movements of flowers and Goebel (1924) subsequently attempted to classify the different ways in which resupination occurs in orchid flowers. Goebel acknowledged the fact that for many orchids, the movement and the positioning of the inflorescence are important for resupination and he recognized separate categories of erect, horizontal and pendulous inflorescences. The ten different ways of inflorescence development of Madagascan species of Bulbophyllum (Plate 1) will now be discussed according to these categories. The peduncle and lateral sepals have been indicated in dark and light grey, respectively, to clarify the position of the different organs during inflorescence development (Fig. 4). The evolution of the different types of inflorescence development is inferred by mapping them on the combined molecular phylogeny of Madagascan Bulbophyllum. In erect inflorescences, Goebel distinguished flowers which remain unaltered in their position from those whose position is altered during development. Erect inflorescences with non-resupinate flowers (Fig. 4: Type A) occur in Madagascan Bulbophyllum mainly in section Kainochilus, of which several species have inflorescences of this type. Species closely related to B. alexandrae sect. Kainochilus likewise have erect inflorescences and non-resupinate flowers 366 G.A. Fischer et al. / Molecular Phylogenetics and Evolution 45 (2007) 358–376 Plate 1. Overview of different types of inflorescences in Bulbophyllum species from Madagascar. but with pedicels oriented in an angle up to 135 between the base and apex of the pedicel by apical drooping, reversing the lateral sepals (grey coloured in Fig. 4: Type B) from the most abaxial in the most adaxial position (Fig. 4: Type B), which also occur in B. cardiobulbum sect. Calamaria. When inflorescence development is mapped on the combined molecular phylogeny (Fig. 5), Type B inflorescences evolved from an ancestor bearing either erect inflorescences 367 G.A. Fischer et al. / Molecular Phylogenetics and Evolution 45 (2007) 358–376 Types of inflorescence development Resupination B A C D1 D2 E1 E2 F G H Fig. 4. Schematic overview of inflorescence development in Bulbophyllum species of Madagascar. A description of the different types is given in Fig. 5. 368 G.A. Fischer et al. / Molecular Phylogenetics and Evolution 45 (2007) 358–376 Kainochilus Polyradices Bifalcula Humblotiorchis Calamaria Alcistachys Lichenophylax Trichopus Pantoblepharon Micromonanthe Pachychlamys Hymenosepalum Elasmotopus Pachychlamys Ploiarium Types of inflorescence development (A) Erect inflorescence, flowers not resupinate (B) Erect inflorescence, apical drooping of the pedicel up to 135 degrees, flowers not resupinate (C) Erect inflorescence, torsion of the pedicel with/without apical drooping of the peduncle, all flowers resupinate (D1) Erect inflorescence, apical drooping of the peduncle up to 135 degrees, youngest flowers resupinate (D2) Erect inflorescence, apical drooping of the peduncle up to 135 degrees and drooping of the oldest flowers, all flowers resupinate (E1) Erect inflorescence, drooping of the peduncle up to 90 degrees, flowers not resupinate Loxosepalum (E2) Erect inflorescence, drooping of the peduncle up to 180 degrees, all flowers resupinate (F) Erect inflorescence, apical drooping and torsion of the rhachis, all flowers resupinate (G) Pendulous inflorescence, all flowers resupinate Micromonanthe Lepiophylax (H) Erect inflorescence, apical drooping of the peduncle, flower resupinate equivocal Fig. 5. Reconstruction of character state evolution of inflorescence development mapped on the combined (nrITS and cpDNA) phylogeny using a maximum parsimony assumption (ACCTRAN and DELTRAN optimization) with the Trace Character option in MacClade. G.A. Fischer et al. / Molecular Phylogenetics and Evolution 45 (2007) 358–376 with non-resupinate flowers (Type A) or resupinate flowers with the peduncle apically drooping up to 180 as compared to its original upright position (Type E2). For the inflorescences in which the position is altered, Goebel made a distinction between species in which the apical part of the inflorescence droops and those in which torsion of the pedicel and ovary occurs. Zimmermann (1933) followed Goebel’s basic types but distinguished more subclasses, which are discussed in respect to Madagascan Bulbophyllum. Erect inflorescences with resupinate flowers resulting from twisted pedicels and peduncles with or without apical drooping (Fig. 4: Type C) only have been observed in sections Pantoblepharon and Trichopus. Regardless whether the peduncle is erect or drooping, all flowers face the same direction, which provides additional support for the hypothesis that they are closely related. Erect inflorescences with resupinate flowers by apical drooping and torsion of the rachis (Fig. 4: Type F) mainly evolved in sections Elasmotopus and Pachychlamys and in some species of sections Calamaria and Ploiarium. Type F seems to have evolved from either Type E1 or E2 (Fig. 5). The apical drooping of the rachis is clearly an active growth mechanism as inflorescences stretched out with wire start to elongate until tension of the wire slackened after which they continue drooping again (Fischer, unpublished data). Erect inflorescences with a solitary, resupinate flower by apical drooping of the peduncle (Fig. 4: Type H) occurs in Madagascan Bulbophyllum only in section Lichenophylax but is very common in Asian Bulbophyllum. Type H is different from Type C by the fact that resupination of the single flowers occurs by apical drooping of the peduncle only whereas the multiple flowers of Type C become resupinate by torsion of the pedicel as well. Resupination of flowers on horizontal inflorescences were first described for African species of Bulbophyllum belonging to section Megaclinium by Goebel (1924). Zimmermann (1933) recognized two types of resupination in these species: in the first, the flowers remain unaltered in the same position whereas in the second, the ovary twists in such a way that the lip becomes the lowermost part of the perianth. Although our observations correspond to the basic principles described by Goebel (1924) and Zimmermann (1933), there seem to be many additional intermediate types of resupination in Madagascan species of Bulbophyllum that may also involve apical drooping of the inflorescence axis. Erect inflorescences with young, resupinate flowers by apical drooping of the inflorescence axis up to 135 (Fig. 4: Type D1) and erect inflorescences with resupinate flowers of all ages by apical drooping of the inflorescence axis up to 135 and drooping of the oldest flowers (Fig. 4: Type D2) evolved in sections Loxosepalum and Lepiophylax. Whether Type D2 is derived from Type D1 remains unclear, as the topology of the molecular phylogeny is not sufficiently resolved. Erect inflorescences with non-resupinate flowers and drooping of the peduncle up to 90 (Fig. 4: Type E1) predominantly evolved in section Ploiarium. The angle of drooping varies considerably 369 between species, and some members of this section also have erect inflorescences with apical drooping and torsion of the rachis (Type F) or without resupinate flowers (Fig. 5: Type A). Erect inflorescences with resupinate flowers by drooping of the peduncle up to 150–180 (Fig. 4: Type E2) is common in section Alcistachys and also evolved in section Calamaria. For pendulous inflorescences, Goebel (1924) stated that flowers are always resupinate and that resupination can occur in multiple ways. In the Madagascan species of Bulbophyllum, only a single type occurs without any torsion or drooping of the peduncle (Fig. 4: Type G), which is also common in members of Dendrobiinae, Gongorinae and Stanhopeinae (Goebel, 1924; Zimmermann, 1933). Type G evolved several times in Madagascan Bulbophyllum in each of these sections Calamaria, Ploiarium and Polyradices. Experiments were carried out on species exhibiting almost all types of inflorescence development to clarify whether movements of floral parts are an active physiological process or passive based on gravitational forces (Zimmermann, 1933; Ames, 1938; Arditti, 2002; Hill, 1939; Nyman et al., 1984, 1985; Ernst and Arditti, 1994; Went, 1926). Plants placed upside down in early bud stages always developed their inflorescences in such a way that the lip ultimately obtained the lowermost position in the flower, which suggests that resupination is influenced by gravity. Exclusion of light did not inhibit or eliminate resupination, but removal of auxin sources from the flower, such as gynostemia or ovaries did. Orchid flowers were generally found to be temporarily sensitive to resupination during specific (mostly early) stages of development only. This would explain why only a portion of the flowers of Type D1 end up resupinate: by the time the rachis stops drooping apically, the lowermost flowers are too old to respond to gravity. The direction of torsion of the pedicel and ovary of Madagascan Bulbophyllum can be clockwise or counterclockwise. For some species the direction of turning is random (Type D2), whereas others turn their buds in a single direction only (Type C). Regarding the functional significance of resupination, no empirical evidence has yet been collected, but it is assumed that resupination may facilitate pollination by providing landing platforms for pollinators, exposing labella to sunlight for optimal display of ultraviolet or colour patterns, raising the temperature of labella to volatilize scents, providing space for opening flowers, and/or protecting young flower buds (Arditti, 2002). A hitherto overlooked explanation could be that resupination also facilitates the positioning of pollinia on specific parts of the body of pollinators so that hybridization between sympatric or pollinator-sharing species is prevented. The different orientation of flowers may lead to pre-zygotic isolation promoting speciation, and is therefore of evolutionary significance. Studies analysing resupination in a phylogenetic context are scarce. Clark and Zimmer (2003) and Lavin et al. (2003) discovered flower resupination to be an important 370 G.A. Fischer et al. / Molecular Phylogenetics and Evolution 45 (2007) 358–376 synapomorphy for clades in molecular phylogenies of the genera Alloplectus (Gesneriaceae) and Poissonia (Fabaceae), respectively. The results of these studies indicate that resupination can be of systematic value. However, in Madagascan Bulbophyllum, despite the characterization of various clades by a unique resupination type, there are also multiple independent transitions from one type to the other, underscoring the fact that resupination can also be evolutionary fairly labile. With the molecular phylogenetic framework for Madagascan Bulbophyllum reconstructed here, more knowledge about the evolution of resupination in orchids was achieved. Resupination by apical drooping of the rachis seems to have evolved from apical drooping of the peduncle. Erect inflorescences with non-resupinate flowers have evolved several times into either erect inflorescences with (partly) non-resupinate flowers or pendulous inflorescences with resupinate flowers. The genetics of resupination in Madagascan Bulbophyllum is now being investigated by crossing species from sister groups with different resupination types for quantitative trait loci (QTL) analysis as done previously by Hodges et al. (2002) for species of Aquilegia differing in floral orientation. Interspecific crossing have already successfully been made for this purpose by Fischer et al. (unpublished data). Although nothing is known about the genetics underlying the various inflorescence types characterized in the present study, yet, it seems feasible that only a small number of genes is involved because of (i) the recurrent evolution of the same inflorescence type (Fig. 5: Types A, D, E, F, G); and (ii) the often simple genetic basis of flower orientation known from other plant groups (Hodges et al., 2002; Prazmo, 1965). The evolution of an ecological and evolutionary interesting process is finally better understood. Hopefully, unraveling the genetics of resupination will follow in the not too distant future. Acknowledgments We wish to express our thanks to Joseph Arditti and two anonymous reviewers for very useful feedback on earlier drafts of this manuscript, Jaap Vermeulen (National Herbarium of The Netherlands, Leiden University) for useful comments on the taxonomy and molecular systematics of Bulbophyllum, Mark Chase and the Kew DNA Bank for DNA aliquots, Hans Peter Comes for various discussions, Justin Moat for species distribution data, Johan Hermanns and Thierry Pailler for plant material and help in identifications, literature and herbarium research, Jean Noel Labat and Jean Bosser for help with herbarium material, Solo Rapanarivo for facilities and hospitality in PBZT (Parc Botanique et Zoologique de Tsimbazaza), DEF (Department des Eaux et Fôrets, Madagascar) for the collaboration and collecting permits, the National History Museum in Paris for type specimens and Maria Pichler for assistance in the lab. The staff of the Oakes Ames Orchid Library at Harvard University is thanked for assistance in obtaining rare literature. The present work was carried out in the context of Austrian Science Fund project FWF-17124-Bio to G.A.F. and M.K. and a Fulbright Junior Scholarship and Netherlands Organisation for Scientific Research Grant MV 8.0.010 to B.G. Appendix A List of taxa studied Section Species Geographic origin Herbarium/Voucher Genbank accession number Alcistachys Alcistachys Bulbophyllum occlusum Ridl. B. sulfureum Schltr. WU/FS722 WU/FS1585 EF196040 EF200127 EF200253 EF200381 EF202196 EF196071 EF200128 EF200254 EF200382 EF202197 Alcistachys Bifalcula Bifalcula Bifalcula Bifalcula Calamaria Calamaria Calamaria Calamaria Calamaria Calamaria Calamaria Calamaria B. B. B. B. B. B. B. B. B. B. B. B. B. WU/FS799 WU/FS1010 WU/FS1207 WU/FS1006 WU/FS1298 SZU/OR1042003 WU/FS1315 WU/FS2229 WU/FS2124 WU/FS2019 WU/FS863 WU/FS1133 WU/FS826 EF196074 EF195966 EF196031 EF196061 EF633602 EF195964 EF195967 EF195975 EF195974 EF195973 EF195976 EF195983 EF196028 Calamaria Calamaria B. lecouflei Bosser B. obtusatum (Jum. & H. Perrier) Schltr. B. occultum Thouars B. pervillei Rolfe ex Elliot B. sambiranense Jum. & H. Perrier B. sp. nov. B. trifarium Rolfe B. sambiranense Jum. & H. Perrier B. longiflorum Thouars B. longiflorum Thouars B. aubrevillei Bosser B. aubrevillei Bosser B. francoisii H. Perrier B. francoisii H. Perrier B. oxycalyx Schltr. B. oxycalyx Schltr. var. rubescens (Schltr.) Bosser B. rauhii Toill.-Gen. & Bosser B. rauhii Toill.-Gen. & Bosser var. andranobeense Bosser B. sp. nov. B. amphorimorphum H. Perrier B. humblottii Rolfe B. analamazoatrae Schltr. B. analamazoatrae Schltr. var. nov. B. alexandrae Schltr. Madagascar, Toamasina Prov., road to Lakato Madagascar, Fianarantsoa Prov., road to Ranomafana Madagascar, Fianarantsoa Prov., Farafangana Madagascar, Fianarantsoa Prov., Farafangana Madagascar, Mahajanga Prov., Ambanja Madagascar, Fianarantsoa Prov., Farafangana Madagascar, Mahajanga Prov., Ambanja Madagascar, Fianarantsoa Prov., Farafangana Madagascar, Antananarivo Prov., Anjozorobe Madagascar, Antananarivo Prov., Tsinjoarivo Madagascar, Toliara Prov., Analavelona Madagascar, Fianarantsoa Prov., Andringitra Madagascar, Fianarantsoa Prov., Irondro Madagascar, Mahajanga Prov., Antsonihy Madagascar, Fianarantsoa Prov., between Ifanadiana and Kianjavato Madagascar, Antsiranana Prov., Daraina Madagascar, Mahajanga Prov., Mangindrano WU/FS1278 WU/FS1170 EF196029 EF200139 EF200263 EF200393 EF202207 EF196039 EF200140 EF200264 EF200395 EF202209 nrITS Elasmotopus Elasmotopus EF200141 EF200143 EF200145 EF200144 EF200146 EF200147 EF200150 EF200151 EF200155 — EF200162 EF200156 EF200161 EF200157 EF200251 EF200256 EF200257 EF200255 — — EF200258 EF200262 EF200261 EF200260 EF200259 — EF200266 EF200379 EF200383 EF200385 EF200386 — EF200387 EF200384 EF200390 EF200391 EF200389 EF200388 EF200392 EF200396 EF200394 EF200400 EF200398 EF200397 EF200399 EF200401 EF200405 EF200406 EF200410 — EF200417 EF200411 EF200416 EF200412 trnD EF202194 — EF202199 EF202198 — EF202200 EF202201 EF202205 EF202204 EF202203 EF202202 EF202206 EF202210 Madagascar, Toamasina Prov., Lakato Madagascar, Fianarantsoa Prov., Farafangana Madagascar, Tana flower market Madagascar, Antsiranana Prov., Daraina Madagascar, Mahajanga, Ambanja Madagascar, Mahajanga, Mangindrano Madagascar, Toamasina Prov., Masoala La Réunion Madagascar, Toamasina Prov., Maromizaha Madagascar, Toamasina Prov., road to Lakato Madagascar, Toamasina Prov., Ambatovy Madagascar, Toamasina Prov., road to Lakato Madagascar, Toamasina Prov., Ambatovy Madagascar, Antananarivo Prov., Tampoketsa d’Ankzobe Madagascar, Antananarivo Prov., Anjozorobe Madagascar, Toamasina Prov., Andasibe WU/FS617 WU/FS818 WU/FS1459 WU/FS1232 WU/FS1224 WU/FS1173 K/Chase 14645 WU/OR7272003 K/Hermans 5200 WU/FS620 WU/FS795 WU/FS691 SZU/OR1332003 K/Hermans 5490 EF196041 EF196049 EF196057 EF196062 EF196072 EF195989 EF196023 EF196024 EF195962 EF195961 EF195978 EF195977 EF196044 EF196045 WU/FS1326 WU/FS1435 EF196054 EF200158 EF200283 EF200413 EF202223 EF196055 EF200159 EF200284 EF200414 EF202224 Madagascar, Toamasina Prov., road to Lakato Madagascar, Toamasina Prov., Maromizaha Madagascar, Toamasina Prov., Ambatovy Madagascar, Toamasina Prov., Ambatovy Madagascar, Toamasina Prov., road to Lakato Madagascar, Toamasina Prov., Ambatovy WU/FS688 K/Hermans 5173 WU/FS1008 WU/FS773 SZU/OR8282003 WU/FS779 EF196067 EF196069 EF195986 EF195956 EF195957 EF195952 EF200160 EF200163 EF200148 EF200153 EF200154 EF200164 EF200265 EF200267 EF200269 EF200268 EF200270 EF200271 EF200275 EF200276 EF200281 EF200280 EF200288 EF200287 EF200286 EF200282 psbA EF200285 EF200415 EF200289 EF200418 EF200272 EF200402 EF200278 EF200408 EF200279 EF200409 EF200290 EF200419 (continued on EF202208 EF202214 EF202212 EF202211 EF202213 EF202215 EF202323 EF202324 EF202220 EF202219 EF202227 EF202221 EF202226 EF202222 EF202225 EF202228 EF202216 EF202217 EF202218 EF202229 next page) 371 Elasmotopus Elasmotopus Humblotiorchis Hymenosepalum Hymenosepalum Kainochilus EF200125 EF200129 EF200130 EF200131 — EF200132 EF200133 EF200137 EF200136 EF200135 EF200134 EF200138 EF200142 ndhJ G.A. Fischer et al. / Molecular Phylogenetics and Evolution 45 (2007) 358–376 Calamaria Calamaria Calamaria Calamaria Calamaria Calamaria Cirrhopetalum Cirrhopetalum Elasmotopus Elasmotopus Elasmotopus Elasmotopus Elasmotopus Elasmotopus variegatum Thouars capuronii Bosser minutum Thouars implexum Jum. & H. Perrier complanatum H. Perrier bicoloratum Schltr. cardiobulbum Bosser sambiranense Jum. & H. Perrier sambiranense Jum. & H. Perrier sambiranense Jum. & H. Perrier elliottii Rolfe hildebrandtii Rchb. f. quadrifarium Rolfe trnL–F 372 Appendix A (continued) Section Species Geographic origin Herbarium/Voucher Genbank accession number Kainochilus Kainochilus B. anjozorobeense Bosser B. edentatum H. Perrier WU/FS1457 WU/FS866 EF195958 — — EF200420 EF202230 EF195972 EF200165 EF200291 EF200421 EF202231 Kainochilus Kainochilus B. horizontale Bosser B. imerinense Schltr. WU/AJL148 WU/FS901 EF195984 — — EF200422 EF202232 EF195987 EF200166 EF200292 EF200423 EF202233 Lepiophylax Lichenophylax Lichenophylax Lichenophylax B. B. B. B. WU/FS769 WU/FS880 WU/FS709 WU/FS1552 EF196059 EF195980 EF196060 EF196063 Loxosepalum Loxosepalum B. aff. baronii Ridl. B. aff. baronii Ridl. WU/FS949 WU/FS869 EF195946 EF200170 EF200310 EF200441 EF202251 EF195944 EF200187 EF200314 EF200445 EF202255 Loxosepalum B. aff. baronii Ridl. WU/FS937 EF195945 EF200196 — EF200453 EF202263 Loxosepalum Loxosepalum Loxosepalum Loxosepalum Loxosepalum Loxosepalum B. B. B. B. B. B. aff. baronii Ridl. aff. sphaerobulbum H. Perrier aff. sphaerobulbum H. Perrier alleizettei Schltr. ambatoavense Bosser amoenum Bosser WU/FS988 WU/FS612 WU/FS798 WU/FS746 SZU/OR2282003 WU/FS932 EF195947 EF195950 EF195949 EF195953 EF195954 EF195955 EF200199 EF200190 EF200188 EF200201 EF200174 EF200169 EF200324 EF200317 EF200315 EF200326 EF200300 EF200295 EF200456 EF200448 EF200446 EF200458 EF200432 EF200426 EF202266 EF202258 EF202256 EF202268 EF202242 EF202237 Loxosepalum Loxosepalum Loxosepalum Loxosepalum B. B. B. B. approximatum Ridl. leandrianum H. Perrier marovoense H. Perrier melleum H. Perrier WU/FS633 WU/FS1028 SZU/OR2642003 K/Hermans 5483 EF195960 EF196021 EF196027 EF196030 EF200194 EF200173 EF200175 EF200176 EF200319 EF200298 EF200301 EF200302 EF200451 EF200429 EF200431 EF200430 EF202261 EF202240 EF202243 EF202241 Loxosepalum B. ochrochlamys Schltr. WU/FS871 EF196042 EF200181 EF200299 EF200437 EF202248 Loxosepalum Loxosepalum Loxosepalum Loxosepalum Loxosepalum Loxosepalum Loxosepalum B. B. B. B. B. B. B. WU/FS741 WU/FS1651 WU/FS683 WU/O00316-1 WU/FS745 WU/FS640 WU/FS874 EF196001 EF195994 EF195999 EF196014 EF196002 EF196075 EF196005 Loxosepalum B. sp. WU/FS933 EF196007 EF200189 EF200316 EF200447 EF202257 Loxosepalum Loxosepalum Loxosepalum Loxosepalum Loxosepalum Loxosepalum Loxosepalum Loxosepalum B. B. B. B. B. B. B. B. Madagascar, Tana flower market Madagascar, Fianarantsoa Prov., Ambalamanaka Madagascar, Toamasina Prov., Ambatovy Madagascar, Fianarantsoa Prov., road to Ranomafana Madagascar, Toamasina Prov., Ambatovy Madagascar, Toamasina Prov., road to Lakato Madagascar, Toamasina Prov., road to Lakato Madagascar, Fianarantsoa Prov., Ambinanindrano Madagascar, Antananarivo Prov., Mount Ibity Madagascar, Fianarantsoa Prov., road to Ranomafana Madagascar, Fianarantsoa Prov., road to Ranomafana Madagascar Madagascar, Toamasina Prov., road to Lakato Madagascar, Toamasina Prov., Ambatovy Madagascar, Toamasina Prov., Ambatovy Madagascar, Toamasina Prov., road to Lakato Madagascar, Fianarantsoa Prov., road to Ranomafana Madagascar, Toamasina Prov., road to Lakato Madagascar, Toamasina Prov., road to Lakato Madagascar, Toamasina Prov., Ambatovy Madagascar, Toamasina Prov., Col de Mantady Madagascar, Fianarantsoa Prov., road to Ranomafana Madagascar, Toamasina Prov., Ambatovy Madagascar, Toamasina Prov. Madagascar, Toamasina Prov., road to Lakato Madagascar, Toamasina Prov., Ambatovy Madagascar, Toamasina Prov., Ambatovy Madagascar, Toamasina Prov., road to Lakato Madagascar, Fianarantsoa Prov., road to Ranomafana Madagascar, Fianarantsoa Prov., road to Ranomafana Madagascar, Toamasina Prov., road to Lakato Madagascar, Toamasina Prov., Ambatovy Madagascar, Toamasina Prov., road to Lakato Madagascar, Toamasina Prov., road to Lakato Madagascar, Toamasina Prov., road to Lakato Madagascar, Toamasina Prov. Mauritius Mauritius WU/FS674 WU/FS787 WU/FS650 K/Hermans 5233 SZU/OR3482003 SZU/OR2902003 WU/099B147-1 WU/099B148-1 EF195998 EF196003 EF195996 EF196012 EF196018 EF196017 EF196037 EF196038 nrITS sp. sp. aff. baronii Ridl. sp. sp. ventriosum H. Perrier sp. sp. sp. sp. sp. sp. sp. nutans (Thouars) Thouars nutans (Thouars) Thouars EF200182 EF200167 — EF200168 EF200200 EF200183 EF200184 EF200203 EF200195 EF200191 EF200193 EF200192 EF200185 EF200186 EF200202 EF200198 EF200197 EF200180 EF200179 ndhJ EF200307 EF200293 — EF200294 EF200325 EF200309 EF200311 EF200328 EF200321 EF200308 EF200320 EF200318 EF200312 EF200313 EF200327 EF200323 — EF200306 EF200305 psbA EF200438 EF200424 — EF200425 EF200457 EF200440 EF200442 EF200460 EF200452 EF200439 EF200450 EF200449 EF200443 EF200444 EF200459 EF200455 EF200454 EF200436 EF200435 trnD — EF202234 EF202235 EF202236 EF202267 EF202250 EF202252 EF202270 EF202262 EF202249 EF202260 EF202259 EF202253 EF202254 EF202269 EF202265 EF202264 EF202247 EF202246 G.A. Fischer et al. / Molecular Phylogenetics and Evolution 45 (2007) 358–376 sciaphile Bosser hapalanthos Garay sp. nov. sp. nov. trnL–F B. nutans (Thouars) Thouars Loxosepalum B. nutans (Thouars) Thouars Micromonanthe Micromonanthe Micromonanthe Pachychlamys B. B. B. B. Pachychlamys Pachychlamys Pachychlamys B. liparidioides Schltr. B. longivaginans H. Perrier B. longivaginans H. Perrier Pachychlamys Pachychlamys Pachychlamys Pachychlamys Pachychlamys Pachychlamys Pachychlamys Pantoblepharon B. molossus Rchb. f. B. pachypus Schltr. B. pachypus Schltr. B. sandrangatense Bosser B. vestitum Bosser var. meridionale Bosser B. vestitum Bosser B. sp. B. pantoblepharon Schltr. Pantoblepharon B. pleurothallopsis Schltr. Ploiarium Ploiarium B. aff. labatii Bosser B. aggregatum Bosser Ploiarium Ploiarium B. ankaizinense (Jum. & H. Perrier) Schltr. B. auriflorum H. Perrier B. coriophorum Ridl. B. hamelinii W. Watson B. henrici Schltr. var. rectangulare H. Perrier B. henrici Schltr. var. rectangulare H. Perrier B. humbertii Schltr. Ploiarium Ploiarium Ploiarium B. insolitum Bosser B. jackyi G. A. Fischer, et al. B. cyclanthum Schltr. Ploiarium B. nitens Jum. & H. Perrier Ploiarium Ploiarium Ploiarium B. oreodorum Schltr. B. peyrotii Bosser B. platypodum H. Perrier Ploiarium Ploiarium B. rubiginosum Schltr. B. sp. nov. Ploiarium Ploiarium Ploiarium Ploiarium Ploiarium calyptropus Schltr. conchidioides Ridl. muscicola Schltr. ikongoense H. Perrier Madagascar, Fianarantsoa Prov., road to Ranomafana Madagascar, Fianarantsoa Prov., road to Ranomafana Madagascar, Antananarivo Prov., Tsinjoarivo Madagascar, Toamasina Prov., road to Lakato Madagascar, Toamasina Prov., Ambatovy Madagascar, Fianarantsoa Prov., Ambinanindrano Madagascar, Toamasina Prov., road to Lakato Madagascar, Toamasina Prov., Andasibe Madagascar, Toamasina Prov., Ambavanasy Forest Madagascar, Toamasina Prov., road to Lakato Madagascar, Toamasina Prov., road to Lakato Madagascar, Toamasina Prov., road to Lakato Madagascar, Toamasina Prov., road to Lakato Madagascar, Toamasina Prov., Andasibe WU/FS971 EF196036 EF200178 EF200304 EF200434 EF202245 WU/FS970 EF196035 EF200177 EF200303 EF200433 EF202244 WU/FS2202 WU/FS682 WU/FS790 WU/FS1514 EF195965 EF195969 EF196033 — WU/FS706 WU/FS1402 WU/O0083-1 EF196022 EF200205 EF200330 EF200462 EF202272 EF196025 EF200206 EF200332 EF200463 EF202273 EF196026 EF200207 EF200331 EF200464 EF202274 WU/FS622 SZU/OR3822003 SZU/OR432003 WU/FS661 K/Hermans 4943 EF196032 EF196046 EF196047 EF196058 EF196068 Madagascar, Toamasina Prov., road to Lakato Madagascar, Toamasina Prov., road to Lakato Madagascar, Fianarantsoa Prov., road to Ranomafana Madagascar, Fianarantsoa Prov., Ambalamanaka Madagascar, Toamasina Prov., Ambatovy Madagascar, Fianarantsoa Prov., between Ifanadiana and Kianjavato Madagascar, Toamasina Prov., Ambatovy WU/FS631 WU/FS669 WU/FS975 EF196076 EF200212 EF200337 EF200469 EF202279 EF195997 EF200213 EF200338 EF200470 EF202280 EF196048 EF200248 EF200376 EF200507 EF202319 SZU/OR1872003 EF196053 EF200249 EF200377 EF200508 EF202320 WU/FS737 WU/FS832 EF195948 EF200226 EF200354 — EF202296 EF195951 EF200215 EF200340 EF200472 EF202282 SZU/OR3372003 EF195959 EF200235 EF200364 EF200495 EF202306 Madagascar, Toamasina Prov., Andasibe Madagascar, Toamasina Prov., road to Lakato Madagascar, Toamasina Prov., road to Lakato Madagascar, Toamasina Prov., road to Lakato K/Hermans 4871 SZU/OR1172003 SZU/OR772003 WU/FS656 EF195963 EF195970 EF195979 EF195981 Madagascar, Toamasina Prov., Ambatovy SZU/OR3442003 EF195982 EF200231 EF200360 EF200491 EF202290 Madagascar, Fianarantsoa Prov., south of Ambositra Madagascar, Toamasina Prov., road to Lakato Madagascar, Fianarantsoa Prov., Farafangana Madagascar, Fianarantsoa Prov., road to Ranomafana Madagascar, Fianarantsoa Prov., road to Ranomafana Madagascar, Fianarantsoa Prov., Andringitra Madagascar, Toamasina Prov., Ambatovy Madagascar, Fianarantsoa Prov., road to Ranomafana Madagascar, Fianarantsoa Prov., Farafangana Madagascar, Toamasina Prov., road to Lakato K/Hermans 3466 EF195985 EF200218 EF200345 EF200477 EF202287 WU/FS648 WU/FS868 K/Hermans 5571 EF196019 EF200219 EF200346 EF200478 EF202288 EF196020 EF200225 EF200353 EF200485 EF202295 EF195971 — EF200347 EF200479 EF202289 WU/FS870 EF196034 EF200228 EF200356 EF200487 EF202298 WU/FS2011 SZU/OR3762003 K/Hermans 5046 EF196043 EF200221 EF200349 EF200481 EF202291 EF196051 EF200222 EF200350 EF200482 EF202292 EF196052 EF200223 EF200351 EF200483 EF202293 WU/FS1035 WU/FS602 EF196056 EF200232 EF200361 EF200492 EF202303 EF196066 EF200236 EF200365 — EF202307 (continued on next page) EF200171 EF200172 EF200247 EF200204 EF200208 EF200214 EF200209 EF200210 EF200211 — EF200216 EF200126 EF200220 EF200296 EF200297 — EF200329 EF200333 EF200339 EF200334 EF200335 EF200336 EF200341 EF200343 EF200252 EF200348 EF200427 EF200428 EF200506 EF200461 EF200465 EF200471 EF200466 EF200467 EF200468 EF200473 EF200474 EF200380 EF200480 EF202238 EF202239 EF202318 EF202271 EF202275 EF202281 EF202276 EF202277 EF202278 EF202283 EF202284 EF202195 EF202302 G.A. Fischer et al. / Molecular Phylogenetics and Evolution 45 (2007) 358–376 Loxosepalum 373 374 Appendix A (continued) Section Species Geographic origin Herbarium/Voucher Genbank accession number nrITS B. sp. nov. Madagascar, Toamasina Prov., Ambavanasy Forest Madagascar, Toamasina Prov., road to Lakato Madagascar, Toamasina Prov., road to Lakato Madagascar, Fianarantsoa Prov., road to Ranomafana Madagascar, Fianarantsoa Prov., road to Ranomafana Madagascar, Toamasina Prov., Ambatovy Madagascar, Fiananrantsoa, Ambalamanaka Madagascar, Toamasina Prov., Col de Mantady Madagascar, Fianarantsoa Prov., road to Ranomafana Madagascar, Fianarantsoa Prov., between Ifanadiana and Kianjavato Madagascar, Fianarantsoa Prov., road to Ranomafana Madagascar, Toamasina Prov., road to Lakato Madagascar, Toamasina Prov., road to Lakato Madagascar, Toamasina Prov., Didy Madagascar, Toamasina Prov., Ambatovy Madagascar, Fianarantsoa Prov., Col de Tapia Madagascar, Fianarantsoa Prov., road to Ranomafana Madagascar, Toamasina Prov., Didy Madagascar, Fianarantsoa Prov., Andasibe Madagascar, Toamasina Prov., Ambatovy Madagascar, Toamasina Prov., road to Lakato Madagascar, Fianarantsoa Prov., road to Ranomafana Asia Philippines, Luzon Africa Malaysia Venezuela unknown Ploiarium Ploiarium Ploiarium B. sp. nov. B. sp. nov. B. turkii Bosser & P. J. Cribb Ploiarium B. sp. Ploiarium Ploiarium Ploiarium B. sp. B. sp. B. sp. Ploiarium B. sp. Ploiarium B. sp. Ploiarium B. sp. Ploiarium Ploiarium Ploiarium Ploiarium Ploiarium Ploiarium B. B. B. B. B. B. sp. sp. sp. sp. sp. sp. Ploiarium Ploiarium Polyradices Trichopus Trichopus B. B. B. B. B. sp. sp. petrae G. A. Fischer et al. ciliatilabrum H. Perrier sp. Sestochilus Sestochilus Group 1 (Vermeulen, 1987) Cirrhopetalum Bolbophyllaria Cirrhopetalum B. B. B. B. B. B. affine Lindl. alsiosum Ames barbigerum Lindl. biflorum Teijsm. & Binn. bracteolatum Lindl. burfordiense Hort. ex Garay et al. Xiphizusa B. aff. chloropterum Rchb. f. Brasil, Bahia, Jussari Bolbophyllaria B. cribbianum Toscano Brasil, Bahia, Mucugê Cirrhopetalum Sestochilus Sestochilus B. cumingii (Lindl.) Rchb. f. B. dearei (Hort.) Rchb.f. B. dearei (Hort.) Rchb.f. Philippines, Mindanao Philippines, Mindanao Philippines, Mindanao ndhJ psbA trnD WU/O00165-1 EF196070 EF200237 EF200366 EF200496 EF202308 WU/FS1946 WU/FS1926 WU/FS1595 EF196065 EF200245 EF200374 EF200504 EF202316 EF196064 EF200244 EF200373 EF200503 EF202315 EF196073 EF200224 EF200352 EF200484 EF202294 WU/FS958 EF196009 — WU/O00437-1 WU/FS1558 K/Hermans 4887 EF196015 EF200238 EF200367 EF200497 EF202309 EF195991 EF200242 EF200371 EF200501 EF202313 EF196013 EF200240 EF200369 EF200499 EF202311 WU/FS1610 EF195992 EF200243 EF200372 EF200502 EF202314 WU/FS833 EF196004 EF200230 EF200359 EF200490 EF202301 WU/FS960 EF196010 EF200229 EF200357 EF200488 EF202299 WU/FS624 WU/FS711 WU/O00465-1 WU/FS1040 WU/FS1480 WU/FS943 EF195995 EF196000 EF196016 EF195988 EF195990 EF196008 — EF200234 EF200239 EF200233 EF200241 EF200227 — EF200363 EF200368 EF200362 EF200370 EF200355 — EF200494 EF200498 EF200493 EF200500 EF200486 — EF202305 EF202310 EF202304 EF202312 EF202297 WU/FS907 K/Hermans 3948 WU/FS2287 WU/FS604 WU/FS1622 EF196006 EF196011 EF196050 EF195968 EF195993 EF200217 — EF200149 EF200246 EF200250 EF200344 EF200342 EF200273 EF200375 EF200378 EF200476 EF200475 EF200403 EF200505 EF200509 EF202286 EF202285 — EF202317 EF202321 SZU/OR2281998 SZU/OR2771998 L/SBGO 1692 SZU/OR5791999 WU/ 5/80 M.W.K.Goh and J.Elliot 1002 HUEFS/E.C.Smidt 308 HUEFS/E.L.Borba 2127 SZU/OR1811998 SZU/OR2271998 SZU/OR6061999 EF195916 EF195917 EF195918 EF195919 EF195920 AY273716 — — — — — — — — — — — — — — — — — — — — — — — — EF195921 — — — — EF195922 — — — — EF195923 — EF195924 — EF195925 — EF200274 EF200404 EF202322 — — — — — — EF200358 EF200489 EF202300 G.A. Fischer et al. / Molecular Phylogenetics and Evolution 45 (2007) 358–376 Ploiarium trnL–F — — — — — — B. siamense Rchb. f. B. smitinandii Seidenf. & Thorut Sestochilus Sestochilus Thailand Thailand Indonesia, Java Grand Comore, Haboho, Forêt de Bahani Asia Africa Philippines, Luzon Congo, Mayombe Malaysia, Cameron Highlands Thailand Africa unknown Philippines, Mindanao unknown Brazil, Minas Gerais, Caldas hamatipes J. J. Sm. intertextum Lindl. lobbii Lindl. lupulinum Lindl. macranthum Lindl. mayombeense Garay membranifolium Hook. f. orectopetalum Garay et al. oxychilum Schltr. patens King ex Hook. f. picturatum (Lodd.) Rchb.f. pileatum Lindl. plumosum (Barb. Rodr.) Cogn. B. B. B. B. B. B. B. B. B. B. B. B. B. Sestochilus Group 1 (Vermeulen, 1987) Sestochilus Group 8 (Vermeulen, 1987) Sestochilus Undetermined Sestochilus Sestochilus Group 1 (Vermeulen, 1987) Sestochilus Cirrhopetalum Sestochilus Xiphizusa Herbarium acronyms are given before the collection numbers. All numbers from Kew refer to Kew DNA Bank numbers. EF195942 — EF195943 — — — — — — — — — — — EF202325 — — — — — — — — — — — — EF200407 — — — — — — — — — — EF200322 — EF200277 — — — — — — — — — — — — EF200152 — — EF195929 EF195930 EF195931 EF195932 EF195933 EF195934 EF195935 EF195936 EF195937 EF195938 EF195939 EF195940 EF195941 — — — EF195928 — Brasil, Minas Gerais, Carrancas B. glutinosum (Barb. Rodr.) Cogn. 375 References HUEFS/E.C.Smidt et al. s.n. SZU/OR4422003 P/P00213205 L/SBGO 740 SZU/OR2151999 SZU/OR2811998 WU/400/96 SZU/OR5751998 SZU/OR2831999 L/s.n. SZU/OR5411999 SZU/OR2041998 L/960106 HUEFS/E.C.Smidt et al. 315 SZU/OR2372001 WU/3601 Philippines Cameroon Sestochilus Group 5 (Megaclinium) (Vermeulen, 1987) Didactyle B. emiliorum Ames & Quisumb. B. falcatum (Lindl.) Rchb. f. SZU/OR3121998 WU/23/94 EF195926 — EF195927 — — — — — — — G.A. Fischer et al. / Molecular Phylogenetics and Evolution 45 (2007) 358–376 Ames, O., 1938. Resupination as a diagnostic character in the Orchidaceae with special reference to Malaxis monophyllosBotanical Museum Leaflets, vol. 6. Springer, pp. 145–183. Arditti, J., 2002. Resupination. In: Nair, H., Arditti, J. (Eds.), Proceedings of the 17th World Orchid Conference. Natural History Publications (Borneo), Kota Kinabalu, Malaysia, pp. 111–122. Bartareau, T., 1994. Pollination of Bulbophyllum macphersonii Rupp by a midge fly (Forcipomyia sauteri). The Orchadian 11, 255–258. Bateman, R.M., Hollingsworth, P.M., Preston, J., Yi-Bo, L., Pridgeon, A.M., Chase, M.W., 2003. Molecular phylogenetics and evolution of Orchidinae and selected Habenariinae (Orchidaceae). Bot. J. Linn. Soc. 142, 1–40. Borba, E.L., Semir, J., 1998. Wind-assisted fly pollination in the three Bulbophyllum (Orchidaceae) species orruring in the Brazilian campos rupestris. Lindleyana 13, 203–218. Bosser, J., 1965. Contribution à l’étude des Orchidaceae de Madagascar V. Révision de quelques sections du genre Bulbophyllum à Madagascar. Adansonia n.s. 5, 375–410. Bosser, J., 1969. Contribution à l’étude des Orchidaceae de Madagascar. VII. Adansonia n.s. 9, 135–137. Bosser, J., 1971. Contribution à l’étude des Orchidaceae de Madagascar XVI. Espèces nouvelles du genre Bulbophyllum. Adansonia n.s. 11, 325– 335. Bosser, J., 1989. Contribution à l’étude des Orchidaceae de Madagascar et des Mascareignes. XXIV. Bull. Mus. Nat. Hist. Nat., Paris, sect. B, Adansonia 11, 29–38. Bosser, J., 2000. Contribution à l’étude des Orchidaceae de Madagascar et des Mascareignes. XXIX. Revision de la section Kainochilus du genre Bulbophyllum. Adansonia sér 3 (22), 167–182. Bosser, J., 2004. Contribution à l’étude des Orchidaceae de Madagascar, des Comores et des Mascareignes XXXIII. Adansonia sér 3 (26), 53–61. Cameron, K.M., 2004. Utility of plastid psaB gene sequences for investigating intrafamilial relationships within Orchidaceae. Mol. Phylogen. Evol. 31, 1157–1180. Carlsward, B.S., Whitten, W.M., Williams, N.H., Bytebier, B., 2006. Molecular phylogenetics of Vandeae (Orchidaceae) and the evolution of leaflessness. Am. J. Bot. 93, 770–786. Clark, J.L., Zimmer, E.A., 2003. Preliminary phylogeny of Alloplectus (Gesneriaceae): implications for the evolution of flower resupination. Syst. Bot. 28, 365–375. Demesure, B., Sodzi, N., Petit, R.J., 1995. A set of universal primers for amplification of polymorphic non-coding regions of mitochondrial and chloroplast DNA in plants. Mol. Ecol. 4, 129–131. Dolphin, K., Belshaw, R., Orme, C.D.L., Quicke, D.L.J., 2000. Noise and incongruence: interpreting results of the incongruence length difference test. Mol. Phylogen. Evol. 17, 401–406. Doyle, J.J., Doyle, J.L., 1987. A rapid DNA isolation procedure for small quantities of fresh leaf material. Phytochem. Bull. 19, 11–15. Dressler, R.L., 1981. The Orchids Natural History and Classification. Harvard University Press, Cambridge, USA. Du Puy, D.J., Cribb, P.J., Bosser, J., Hermans J., Hermans C., 1999. The orchids of Madagascar. Royal Botanic Gardens, Kew. Ernst, R., Arditti, J., 1994. Resupination. In: Arditti, J. (Ed.), Orchid Biology: Reviews and Perspectives VI. John Wiley and Sons Inc., New York, pp. 135–188. Farris, J.S., Källersjö, M., Kluge, A., Bult, G.C., 1995. Constructing a significance test for incongruence. Syst. Biol. 44, 570–572. Fischer, G.A., Sieder, A., Cribb, P.J., Kiehn, M., 2007. Description of two new species and one new section of Bulbophyllum (Orchidaceae) from Madagascar. Adansonia sér. 3, 29 (1), 19–25. Fischer, G.A., Hermans, J., Sieder, A., Kiehn, M., Gravendeel, B., Cribb, P.J., in. preparation. Taxonomic revision of Bulbophyllum sections Bifalcula, Inversiflora and Lupulina (Orchidaceae) in Madagascar: a new sectional delimitation based on molecular and morphological evidence. Goebel, K., 1924. Die Entfaltungsbewegungen der Pflanzen und deren teleologische Deutung. Verlag von Gustav Fischer, Jena. 376 G.A. Fischer et al. / Molecular Phylogenetics and Evolution 45 (2007) 358–376 Gravendeel, B., Fischer, G.A., Smidt, E.C., Schuiteman, A., Sieder,A., Vogel, A., Vermeulen, J.J., in preparation. Molecular phylogeny of the Bulbophyllinae. Hedren, M., Fay, M.F., Chase, M.W., 2001. Amplified fragment length polymorphisms (AFLP) reveal details of polyploid evolution in Dactylorhiza (Orchidaceae). Am. J. Bot. 88, 1868–1880. Hill, A.W., 1939. Resupination studies of flowers and leaves. Ann. Bot. 3, 871–887. Hodges, S.A., Whittall, J.B., Fulton, J., Yang, J.Y., 2002. Genetics of floral traits influencing reproductive isolation between Aquilegia formosa and Aquilegia pubescens. Am. Nat. 159, S51–S60. Huelsenbeck, J.P., Ronquist, F., 2001. MrBayes: Bayesian inference of phylogenetic trees. Bioinformatics 17, 754–755. Kress, W.J., Wurdack, K.J., Zimmer, E.A., Weigt, L.A., Janzen, D.H., 2005. Use of DNA barcodes to identify flowering plants. Proc. Natl. Acad. Sci. 102, 8369–8374. Lavin, M., Wojciechowski, M.F., Gasson, P., Hughes, C., Wheeler, E., 2003. Phylogeny of robinioid legumes (Fabaceae) revisited: Coursetia and Gliricidia recircumscribed, and a biogeographical appraisal of the Caribbean endemics. Syst. Bot. 28, 387–409. Linnaeus, C., 1780. Philosophia Botanica 2. D.Johannes Gottlieb Gleditsch, Berolini. Maddison, W.P., Maddison, D.R., 2005. MacClade. [4.08]. Sinauer, Sunderland, Massachusetts. Müller, K., 2003a. PRAP—parsimony ratchet analysis using PAUP. Program distributed by the author. Nees Institute, University of Bonn Germany. Müller, K., 2003b. SEQSTATE—primer design and sequence statistics for phylogenetic DNA data sets. Program distributed by the author. Nees Institute, University of Bonn Germany. Nishida, R., Tan, K.H., Wee, S.L., Hee, A.K.W., Toong, Y.C., 2004. Phenylpropanoids in the fragrance of the fruit fly orchid, Bulbophyllum cheiri, and their relationship to the pollinator, Bactrocera papayae. Biochem. Syst. Ecol. 32, 245–252. Nyman, L.P., Soediono, N., Arditti, J., 1984. Opening and resupination in buds and flowers of Dendrobium (Orchidaceae) hybrids. Bot. Gaz. 145, 215–221. Nyman, L.P., Soediono, N., Arditti, J., 1985. Resupination in flowers of two Dendrobium (Orchidaceae) hybrids. Effect of nodal position and removal of floral segments. Bot. Gaz. 146, 181–187. Norup, M.V., Dransfield, J., Chase, M.W., Barfod, A.S., Fernando, E.S., Baker, W.J., 2006. Homoplasious character combinations and generic delimitation: a case study from the Indo-Pacific arecoid palms (Arecaceae: Areceae). Am. J. Bot. 93, 1065–1080. Perrier de la Bâthie, H. 1939. 49e Famille.—Orchidées I & II. In: Humbert, H. (Ed.), Flore de Madagascar. Tananarive, Imprimerie Officielle, Madagascar. Posada, D., Crandall, K.A., 1998. Modeltest: testing the model of DNA substitution. Bioinformatics 14, 817–818. Posada, D., Crandall, K.A., 2001. Selecting the best-fit model of nucleotide substitution. Syst. Biol. 50, 580–601. Prazmo, W., 1965. Cytogenetic studies on the genus Aquilegia. IV. Fertility relationships among the Aquilegia species. Acta Soc. Bot. Pol. 34, 667–685. Pridgeon, A.M., Chase, M.W., 2001. A phylogenetic reclassification of Pleurothallidinae (Orchidaceae). Lindleyana 16, 235–271. Pridgeon, A., Cribb, P.J., Chase, M., Rasmussen, F. (Eds.), 1999. Genera Orchidacearum, vol. 1. Oxford University Press, Oxford. Pridgeon, A., Cribb, P.J., Chase, M., Rasmussen, F. (Eds.), 2001a. Genera Orchidacearum. Orchidoideae (Part 1), vol. 2. Oxford University Press, Oxford. Pridgeon, A., Cribb, P.J., Chase, M., Rasmussen, F. (Eds.), 2003. Genera Orchidacearum. Orchidoideae (Part 2), Vanilloideae, vol. 3. Oxford University Press, Oxford. Pridgeon, A., Cribb, P.J., Chase, M., Rasmussen, F. (Eds.), 2005. Genera Orchidacearum. Epidendroideae (Part 1), vol. 4. Oxford University Press, Oxford. Pridgeon, A.M., Solano, R., Chase, M.W., 2001b. Phylogenetic relationships in Pleurothallidinae (Orchidaceae): combined evidence from nuclear and plastid DNA sequences. Am. J. Bot. 88, 2286–2308. Reeves, G., Chase, M.W., Goldblatt, P., Rudall, P., Fay, M.W., Cox, A.V., Lejeune, B., Souza-Chies, T., 2001. Molecular systematics of Iridaceae: evidence from four plastid DNA regions. Am. J. Bot. 88, 2074–2087. Sang, T., Crawford, D.J., Stuessy, T.F., 1997. Chloroplast DNA phylogeny, reticulate evolution, and biogeography of Paeonia (Paeoniaceae). Am. J. Bot. 84, 1120–1136. Schlechter, R., 1924. Orchidaceae Perrieranae. Ein Beitrag zur Orchideenkunde der Insel Madagaskar. Repertorium Specierum Novarum Regni Vegetabilis 33, 1–240. Sheahan, M.C., Chase, M.W., 2000. Phylogenetic relationships within Zygophyllaceae based on DNA sequences of three plastid regions, with special emphasis on Zygophylloideae. Syst. Bot. 25, 371–384. Sieder, A., Rainer, H., Kiehn, M., 2007. CITES checklist for Bulbophyllum and allied taxa (Orchidaceae). 319p. – Botanical Garden of the University of Vienna. Available from: <http://www.cites.org/ common/com/NC/tax_ref/Bulbophyllum.pdf>. Simmons, M.P., Ochoterena, H., 2000. Gaps as characters in sequencebased phylogenetic analyses. Syst. Biol. 49, 369–381. Smidt, E. C., Borba, E. L., van den Berg , C., Gravendeel, B., Fischer, G.A., in preparation. Molecular phylogeny of Neotropical Bulbophyllum species. Sun, Y.D.Z., Skinner, G.H., Liang, S., Hulbert, H., 1994. Phylogenetic analysis of Sorghum and related taxa using internal transcribed spacers of nuclear ribosomal DNA. Theor. Appl. Genet. 89, 26–32. Swofford, D.L., 2002. PAUP*. Phylogenetic analysis using parsimony (* and other methods). Version 4.0b10. Sinauer Associates, Sunderland, Massachussets, USA. Taberlet, P., Gielly, L., Pautou, G., Bouvet, J., 1991. Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Mol. Biol. 17, 1105–1109. Tan, K.H., Nishida, R., Toong, Y.C., 2002. Floral synomone of a wild orchid, Bulbophyllum cheiri, lures Bactrocera fruit flies for pollination. J. Chem. Ecol. 28, 1161–1172. Tate, J.A., Simpson, B.B., 2003. Paraphyly of Tarasa (Malvaceae) and diverse origins of the polyploid species. Syst. Bot. 28, 723–737. Teixeira, S.P., Borba, E.L., Semir, J., 2004. Lip anatomy and its implications for the pollination mechanisms of Bulbophyllum species (Orchidaceae). Ann. Bot. 93, 499–505. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmouguin, F., Higgins, D.G., 1997. The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25, 4876–4882. Van den Berg, C., Goldman, D.H., Freudenstein, J.V., Pridgeon, A.M., Cameron, K.M., Chase, M.W., 2005. An overview of the phylogenetic relationships within Epidendroideae inferred from multiple DNA regions and recircumscription of Epidendreae and Arethuseae (Orchidaceae). Am. J. Bot. 92, 613–624. Vermeulen, J.J., 1987. Orchid Monographs 2, a Taxonomic Revision of the Continental African Bulbophyllinae. E.J. Brill, Netherlands, Leiden. Vijverberg, K., Bachmann, K., 1999. Molecular evolution of a tandemly repeated trnF(GAA) gene in the chloroplast genomes of Microseris (Asteraceae) and the use of structural mutations in phylogenetic analyses. Mol. Biol. Evol. 16, 1329–1340. Wendland, H., Kränzlin, F., 1894. Bulbophyllum johannis Wendl. & Kraenzl. Gard. Chron. ii, 592. Went, F.W., 1926. On growth-accelerating substances in the coleoptile of Avena sativa. Proc. Kon. Acad. Wettensch. 30, 10–19. White, T.J., Bruns, T., Lee, S., Taylor, J., 1990. Analysis of phylogenetic relationships by amplification and direct sequencing of ribosomal RNA genes. In: Innis, M., Gelfand, D., Sninsky, J., White, T. (Eds.), PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA, pp. 315–322. Wiens, J.J., 1998. Combining data sets with different phylogenetic histories. Syst. Biol. 47, 568–581. Yoder, A.D., Irwin, J.A., Payseur, B.A., 2001. Failure of the ILD to determine data combinability for slow loris phylogeny. Syst. Biol. 50, 408–424. Zimmermann, W., 1933. Beiträge zur Kenntnis der Georeaktionen IV. Blütenbewegungen und andere Umstimmungsbewegungen. Jahrb. f. wiss. Botanik 77.