WO2001087945A1 - The novel polypeptide-human laminin b2 chain 12 and the polynucliotide encoding said polypeptide - Google Patents

Abstract

The invention discloses a new kind of polypeptide-human laminin B2 chain 12 and the polynucleotide encoding said polypeptide and a process for producing the polypeptide by recombinant methods. It also discloses the method of applying the polypeptide for the treatment of various kinds of disease, such as nerve aregeneratory, inflammation and reparation disorder, tumor, developmental disorder, immune disease, HIV infection. The antagonist of the polypeptide and therapeutic use of the same is also disclosed. In addition, it refers to the use of polynucleotide encoding said human laminin B2 chain 12.

Description

 A New Polypeptide——Human Adhesive Molybdenum B2 锘 12 and Polynucleotide of This Polypeptide Technical Field

 The present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide Λ-laminin B2 chain 12, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and the polypeptide.

# 术 背景

 Laminin is a multi-domain protein. It is the main non-collagen component of the basement membrane. It is present in all basement membranes and interacts with other major components of the basement membrane such as nestin, heparan sulfate proteoglycan, or collagen IV Complexation (Timpl, R. (1989) Eur. J. Biochem. 180; 487 to 502). It consists of three different disulfide-linked polypeptides, which gives a laminin an asymmetric cross-linked structure, containing eight different assembly subunits. In order to obtain an isoform of laminin, peptides of three different molecular types must always be assembled together: an alpha chain (also known as the A chain), a beta chain (also known as the B1 chain), and a gamma chain (Also known as the B2 chain) (Burgeson, RE; et al. (1994) Matrix Biology, Vol. 14, 209 to 211). Laminin is involved in a variety of interesting biological functions, such as affecting cell growth, cell proliferation, and axonal growth, and inducing differentiation (Timpl, R. (1989) Eur. J. Biochem. 180; 487 to 502) . Although laminin is a typical component of all basement membranes, the different characteristics of different isoforms are that they have a very specific tissue distribution. For example, partitioned proteins (= laminin 2; alpha 2, beta 1, gamma 1) are a component of the basement membrane of nerve membrane cells, striated muscle, and vegetative cells (Leivo, I .; Engvall, E. (1988 ) Proc. Natl. Acad. Sci. USA 85; 1544 to 1548). The other type, s-laminin (= laminin 3; alpha 1, beta 2, gamma 1) is found in the basement membrane of synapses in neuromuscular terminals, in the vascular endothelium, and in the glomerular podocytes ( Hunter, DD; Shah, V .; Merlie, L P .; Sanes, JR (1989) Nature 338; 229 to 234). The third type, K-laminin (laminin 6; alpha 3, beta 1 / beta 2, gamma 1) is specific to the skin basement membrane (Mar inkovich, MP; Lunstrora, GP; Burgeson, RE ( 1992a) L Biol. Chem. 267; 17900 to 17906). Prion protein (laminin 5, alpha3, beta3, gamma2) is a typical component of epithelial tissue and a component of anchoring protein filaments (Mar inkovich, MP; Lunstrom, GP; Keene, DR, Burgeson, RE (1992b) J. Cell Biol. 119; 695 to 703).

The laminin B2 chain consists of helical structures, multiple repeats of cysteine, and different regions of the globular domain Domain composition. Compared with the laminin Bl chain, the alpha domain and beta domain of the B1 chain have no equivalent in the B2 chain, and the number of repeated cysteine repeats in B2 is 12, which is 1 less than the B1 chain. Each. The B1 and B2 chains are highly homologous proteins, with 40% residues in the cysteine-containing repeat domains III and V, which are the products of related genes. The open reading frame of the B2 chain gene encodes a 33-residue signal peptide. The domain I / II of the B2 chain is similar to the B1 chain, and also contains a seven-fold repeating coiled spiral structure. The B1 and B2 chains are connected to form a spiral structure with the A chain. The domains I II and V of the B2 chain are related to the membrane surface through specific receptor binding. Most proteins that promote cell proliferation and migration contain this region (Pikkara inen T, Ka llunki T, Tryggvason K, J Biol Chera 1988 May 15; 263 (14): 6751-8).

 Specific detection of detectable laminin in human serum can be used to diagnose various diseases: liver fibrosis / cirrhosis, alcoholic liver fibrosis, diabetic complications of basic metabolism, nephropathy, chronic inflammatory disease / chronic Multiple arthritis and tumor diseases (Kropf. J .; et a l. (1991) Cl in Chera. 37; 30; Niemela, 0 .; Ris tel i, L .; Sotaniemi, EA; Ri s tel li, J (1985) Eur. J. Cl in. Inves t. 15; 132 to 137; Katayama, M .; Karaihagi, K .; Hira i, S .; Murakami, K .; Hino, F .; Kate, I. (1992) Br. J. Cancer 65; 509 to 514; Brocks, DG; Strecker, H .; Neubauer, HP; Timpl, R. (1986) Cl in. Chem. 32; 787 to 791; Hor ikoshi, S. Koide, H. (1991) Cl in. Chira. Acta 196; 185 to 192).

 Gene chip analysis revealed that in the thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, arsenic-stimulated L02 L02 cell line stimulated by arsenic for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain, fetal lung, and fetal heart The expression profile of the polypeptide of the present invention is very similar to the expression profile of the human laminin B2 chain, so the functions of the two may also be similar. The invention is named human laminin B2 chain 12.

 As mentioned above, the human laminin B2 chain 12 protein plays an important role in regulating important functions of the body, such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need to identify more involved in these In the process of human laminin B2 chain 12 protein, especially the amino acid sequence of this protein is identified. Isolation of the new human laminin B2 chain 12 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding for DM. Object of the invention

An object of the present invention is to provide an isolated novel polypeptide-human laminin B2 chain 12 and Its fragments, analogs and derivatives.

 Another object of the invention is to provide a polynucleotide encoding the polypeptide.

 Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human laminin B2 chain 12.

 Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding human laminin B2 chain 12.

 Another object of the present invention is to provide a method for producing human laminin B2 chain 12.

 Another object of the present invention is to provide an antibody against the polypeptide-human laminin B2 chain 12 of the present invention.

 Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors directed to the polypeptide-human laminin B2 chain 12 of the present invention.

 Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human laminin B2 chain 12. Summary of invention

 The present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.

 The invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;

 (b) a polynucleotide complementary to polynucleotide (a);

 (c) A polynucleotide having at least 70% identity to a polynucleotide sequence of (a) or (b).

 More preferably, the sequence of the polynucleotide is one selected from: (a) a sequence having positions 645-965 in SEQ ID NO: 1; and (b) a sequence having 1-3561 in SEQ ID NO: 1 Sequence of bits.

 The present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.

 The invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.

The invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human laminin B2 chain 12 protein, which comprises utilizing the polypeptide of the invention. The invention also relates to compounds obtained by this method. The present invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of human laminin B2 chain 12 protein in vitro, comprising detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting The amount or biological activity of a polypeptide of the invention in a biological sample.

 The invention also relates to a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.

 The present invention also relates to the polypeptides and / or polynucleotides of the present invention prepared for the treatment of abnormal nerve regeneration, inflammation and repair abnormalities, tumor growth, developmental disorders, immune diseases, HIV infection or other human laminin B2 chains. 12 Use of a medicament for a disease caused by abnormal expression.

 Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein. . BRIEF DESCRIPTION

 The following drawings are used to illustrate specific embodiments of the present invention, but not to limit the scope of the present invention as defined by the claims.

FIG. 1 is a comparison diagram of gene chip expression profiles of human laminin B2 chain 12 and human laminin B2 chain of the present invention. The upper graph is a graph of the expression profile of human laminin B2 chain 12, and the lower graph is the graph of the expression profile of human laminin B2 chain. Among them, 1 indicates fetal kidney, 2 indicates fetal large intestine, 3 indicates fetal small intestine, 4 indicates fetal muscle, 5 indicates fetal brain, 6 indicates fetal bladder, 7 indicates unstarved L02, 8 indicates L02 +, lhr, As ³⁺ , and 9 indicates ECV304 PMA-, 10 means ECV304 PMA +, 11 means fetal liver, 12 means normal liver, 13 means thyroid, 14 means skin, 15 means fetal lung, 16 means lung, 17 means lung cancer, 18 means fetal spleen, 19 means spleen, 20 Indicates prostate, 21 indicates fetal heart, 22 indicates heart, 23 indicates muscle, 24 indicates testis, 25 indicates fetal thymus, and 26 indicates thymus.

 Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated human laminin B2 chain 12. 12KDa is the molecular weight of the protein. The arrow indicates the isolated protein band. Summary of the Invention

The following terms used in this specification and claims have the following meanings unless specifically stated: "Nucleic acid sequence" refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand. Similarly, the term "amino acid sequence" refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof. When the "amino acid sequence" in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide" or "protein" does not mean to limit the amino acid sequence to the protein Molecularly related complete natural amino acids.

 A "variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.

 "Deletion" refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.

 "Insert" or "addition" refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule. "Replacement" refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.

 "Biological activity" refers to a protein that has the structure, regulation, or biochemical function of a natural molecule. Similarly, the term "immunologically active" refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.

 An "agonist" refers to a molecule that, when combined with human laminin B2 chain 12, causes a change in the protein to regulate the activity of the protein. An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to the human laminin B2 chain 12.

 An "antagonist" or "inhibitor" refers to a molecule that, when combined with human laminin B2 chain 12, can block or regulate the biological or immunological activity of human laminin B2 chain 12. Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind to the human laminin B2 chain 12.

 "Regulation" refers to a change in the function of human laminin B2 chain 12, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune properties of human laminin B2 chain 12. change.

 "Substantially pure" means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify human laminin B2 chain 12 using standard protein purification techniques. The substantially pure human laminin B2 chain 12 produces a single main band on a non-reducing polyacrylamide gel. The purity of human laminin B2 chain 12 polypeptide can be analyzed by amino acid sequence.

"Complementary" or "complementary" refers to polynucleotides that naturally bind through base-pairing under conditions of acceptable salt concentration and temperature. For example, the sequence "C-TGA" can be combined with the complementary sequence "GACT". The complementarity between two single-stranded molecules may be partial or complete. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands. "Homology" refers to the degree of complementarity and can be partially homologous or completely homologous. "Partial homology" refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern blotting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to target sequences under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.

"Percent identity" refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods, such as the Clus ter method (Hi ggins, DG and PM Sharp (1988) Gene 73: 237-244). The Clus ter method checks the distance between all pairs The groups of sequences are arranged into clusters. The clusters are then allocated in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: Number of residues _{χ 100}

^ Sequence (number of residues - the sequence of spacer residues - sequence S ^Χ spacer residues may be present by methods known in the art such as the Jotun Hein measuring the percentage identity between nucleic acid sequences or by Clus ter method (Hein L, (1990) Methods in enzymology 183: 625-645).

 "Similarity" refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences. Amino acids used for conservative substitution, for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.

 "Antisense" refers to a nucleotide sequence that is complementary to a particular DNA or R sequence. "Antisense strand" refers to a nucleic acid strand that is complementary to a "sense strand."

 "Derivative" refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.

"Antibody" refers to a complete antibody molecule and its fragments, such as Fa,? ( _¾ 1),) ₂ and? It can specifically bind to the epitope of human laminin B2 chain 12. A "humanized antibody" refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.

 The term "isolated" refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring). For example, a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system. Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated. As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .

 As used herein, "isolated human laminin B2 chain 12" means that human laminin B2 chain 12 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human laminin B2 chain 12 using standard protein purification techniques. Substantially pure polypeptides produce a single main band on a non-reducing polyacrylamide gel. The purity of human laminin B2 chain 12 polypeptide can be analyzed by amino acid sequence.

 The present invention provides a new polypeptide, human laminin B2 chain 12, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide. The polypeptides of the invention can be naturally purified products, or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.

The invention also includes fragments, derivatives and analogs of human laminin B2 chain 12. As used herein, the terms "fragment", "derivative" and "analog" refer to a polypeptide that substantially maintains the same biological function or activity of the human laminin B2 chain 12 of the present invention. A fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by a genetic codon; or (Π) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or (I II) In such a case, the mature polypeptide and another compound (such as compounds that extend the half-life of the polypeptide, such as polyethylene glycol) Fusion; or (IV) a polypeptide sequence (such as a leader sequence or a secreted sequence or a sequence used to purify the polypeptide or a protease sequence) in which an additional amino acid sequence is fused into a mature polypeptide. As set forth herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.

 The present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2. The polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1. The polynucleotide of the present invention is found from a CDM library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 3561 bases and its open reading frame of 645-965 encodes 106 amino acids. According to the comparison of gene chip expression profiles, it was found that this polypeptide has a similar expression profile to the human laminin B2 chain, and it can be deduced that the human laminin B2 chain 12 has a similar function to the human laminin B2 chain.

 The polynucleotide of the present invention may be in a DNA form or an R form. DM forms include cDNA, genomic DNA, or synthetic DNA. DNA can be single-stranded or double-stranded. DNA can be coding or non-coding. The coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used herein, a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.

 The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.

 The term "polynucleotide encoding a polypeptide" refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.

 The invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .

The invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences). The invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions. In the present invention, "strict conditions" means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 6 (TC; or (2) Cross When adding denaturants, such as 50 ° / »(v / v) formamide, 0.1% calf serum / 0.1% Ficol l, 42 ° C, etc .; or (3) only between two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%. In addition, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.

 The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used in the present invention, a "nucleic acid fragment" contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleotides encoding human laminin B2 chain 12.

 The polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity. The specific polynucleotide sequence encoding the human laminin B2 chain 12 of the present invention can be obtained by various methods. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.

 The DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.

 Of the methods mentioned above, genomic MA is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences. The standard method for isolating the cDNA of interest is to isolate mR from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. Various methods have been used to extract mRNA, and kits are also commercially available (Qiagene). And the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spiring Harbor Laboratory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.

 The genes of the present invention can be selected from these cD ^ A libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DM or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the level of transcripts of human laminin B2 chain 12; ( 4) Detecting gene-expressed protein products by immunological techniques or by measuring biological activity. The above methods can be used singly or in combination.

In the method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides. The probe used here is generally a MA sequence chemically synthesized based on the gene sequence information of the present invention. The gene or fragment of the present invention may of course Used as a probe. DM probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase). In the method (4), immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product expressed by the human laminin B2 chain 12 gene.

 A method using PCR technology to amplify DNA / RNA (Saiki, et al. Science 1985; 230: 1350-1354) is preferably used to obtain the gene of the present invention. In particular, when it is difficult to obtain a full-length cDNA from a library, the RACE method (RACE-Rapid Amplification of cDNA Ends) can be preferably used. The primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Select and synthesize using conventional methods. The amplified DM / RNA fragment can be isolated and purified by conventional methods such as by gel electrophoresis.

 The polynucleotide sequence of the gene of the present invention or various DM fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDM sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.

 The present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly using the human laminin B2 chain 12 coding sequence, and a recombinant technology for producing the polypeptide of the present invention. method.

 In the present invention, a polynucleotide sequence encoding human laminin B2 chain 12 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art. In the present invention, the vectors used include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al. Gene, 1987, 56: 125) expressed in bacteria; pMSXND expression vectors expressed in mammalian cells (Lee and Nathans, J Bio Chem. 263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells. In short, as long as it can be replicated and stabilized in the host, any plasmid and vector can be used to construct a recombinant expression vector. An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.

Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human laminin B2 chain 12 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DM synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Molecular Cloning, a Laboratory Manua, Cold Spring Harbor Laboratory. New York, 1989). The DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRM synthesis. Representative examples of these promoters are: the lac or trp promoter of E. coli; the PL of lambda phage Promoters; eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, retroviral LTRs and other known controllable genes in prokaryotic or eukaryotic cells Or a promoter expressed in its virus. The expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors expressed by DM, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.

 In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.

 Those of ordinary skill in the art will know how to select appropriate vector / transcription control elements (such as promoters, enhancers, etc.) and selectable marker genes.

 In the present invention, a polynucleotide encoding human laminin B2 chain 12 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or a recombinant vector. The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: Escherichia coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as fly S2 or Sf9; animal cells such as CH0, COS or Bowes melanoma cells.

Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote such as E. coli, competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with (1 ₂ method used in the step are well known in the art. Alternatively, it is a MgCl _2. If If necessary, transformation can also be performed by electroporation. When the host is a eukaryotic organism, the following DM transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging Wait.

 The polynucleotide sequence of the present invention can be used to express or produce recombinant human laminin B2 chain 12 by conventional recombinant DNA technology (Science, 1984; 224: 1431). Generally there are the following steps:

 (1) using the polynucleotide (or variant) encoding human human laminin B2 chain 12 of the present invention, or transforming or transducing a suitable host cell with a recombinant expression vector containing the polynucleotide;

 (2) culturing host cells in a suitable medium;

(3) Isolate and purify protein from culture medium or cells. In step (2), depending on the host cell used, the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

 In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC), and various other liquid chromatography techniques and combinations of these methods.

 The polypeptides of the present invention, as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.

 Laminin is a major non-collagen component of the basement membrane. It is present in all basement membranes and complexes with other major components of the basement membrane such as nestin, heparan sulfate proteoglycan or collagen IV. It consists of three different polypeptides: A chain, B1 chain and B2 chain. Laminin is involved in a variety of biological functions, such as cell growth, cell proliferation and axonal growth, and induces differentiation. Laminin has different isotypes and has different tissue distributions. For example, partitioned proteins (= laminin 2; alpha 2, beta 1, gamma 1) are a component of the basement membrane of neural membrane cells, striated muscle, and vegetative cells. Another type, s-laminin (= laminin 3; a lpha 1, beta 2, ga cryptoa 1) is present in the basement membrane of synapses in neuromuscular terminals, in the vascular endothelium, and in the glomerular foot Cell. The third type, K-laminin (laminin 6; a lpha 3, beta 1 / beta 2, gamma 1) is specific to the skin basement membrane. Prion protein (laminin 5, a lpha3, beta3, ga leg a2) is a typical component of epithelial tissue and a component of anchor protein filaments.

 The laminin B2 chain is essential for the normal function of laminin. It also involves the induction of cell proliferation and migration.

 The expression profile of the polypeptide of the present invention is consistent with the expression profile of the human laminin B2 chain, and both have similar biological functions. The polypeptide of the present invention is closely related to axon growth, nerve cell regeneration, inflammation repair, wound healing and survival of transplanted tissues in vivo. Its abnormal expression is usually closely related to pathogenesis such as tumorigenesis and spread, inflammatory repair, and nerve regeneration, and produces related diseases.

It can be seen that the abnormal expression of the human laminin B2 chain 12 of the present invention will produce various diseases, especially tumor growth, embryonic developmental disorders, abnormal inflammation and repair, growth and developmental disorders, immunity Epidemic diseases, including but not limited to:

 Tumors of various tissues: neuroblastoma, astrocytoma, ependymoma, glioblastoma, neurofibroblastoma, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine muscle Tumor, colon cancer, melanoma, bladder cancer, uterine cancer, endometrial cancer, thymic tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, fibroid, fibrosarcoma, lipoma, liposarcoma

 Fetal developmental disorders: congenital abortion, cleft palate, limb loss, limb differentiation disorder, atrial septal defect, neural tube defect, congenital hydrocephalus, malformation of the brain, congenital glaucoma or cataract, congenital deafness

 Growth and development disorders: mental retardation, brain development disorders, skin, fat and muscle dysplasia, bone and joint dysplasia, sexual retardation

 Inflammation and repair abnormalities: liver fibrosis, cirrhosis, chronic arthritis, chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, multiple sclerosis of the cerebral spinal cord, glomerulonephritis, myocarditis Cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, various infectious inflammations, pyloric stenosis, tracheal stenosis after injury, mitral stenosis, aortic stenosis, pulmonary stenosis, constrictive pericarditis

 Immune diseases: systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome

 Abnormal expression of the human laminin B2 chain 12 of the present invention will also cause certain hereditary, hematological diseases and the like.

 The polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially tumor growth, embryonic development disorders, inflammation and repair abnormalities, nerve regeneration, growth and development. Obstructive diseases, immune diseases, certain hereditary, blood diseases, etc.

 The invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human laminin B2 chain 12. Agonists enhance biological functions such as human laminin B2 chain 12 to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers. For example, mammalian cells or a membrane preparation expressing human laminin B2 chain 12 can be cultured together with labeled human laminin B2 chain 12 in the presence of a drug. The ability of the drug to increase or suppress this interaction is then determined.

Antagonists of human laminin B2 chain 12 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human laminin B2 chain 12 can bind to human laminin B2 chain 12 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide to make the Peptides cannot perform biological functions.

 When screening compounds as antagonists, human laminin B2 chain 12 can be added to a bioanalytical assay to determine whether a compound is a compound by measuring the effect of the compound on the interaction between human laminin B2 chain 12 and its receptor. Antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same way as for screening compounds described above. Polypeptide molecules capable of binding to human laminin B2 chain 12 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the 12 molecules of human laminin B2 chain should generally be labeled.

 The present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies. The invention also provides antibodies against human laminin B2 chain 12 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.

Polyclonal antibodies can be produced by injecting human laminin B2 chain 12 directly into immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's Agent. Techniques for preparing monoclonal antibodies to human laminin B2 chain 12 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma Technology, EBV-hybridoma technology, etc. Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). ₀ Existing techniques for producing single-chain antibodies (US Pat No. 4946778) can also be used to produce single chain antibodies against human laminin B2 chain 12.

 Antibodies against human laminin B2 chain 12 can be used in immunohistochemical techniques to detect human laminin B2 chain 12 in biopsy specimens.

 Monoclonal antibodies that bind to human laminin B2 chain 12 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.

 Antibodies can also be used to design immunotoxins that target a particular part of the body. For example, human laminin B2 chain 12 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill human laminin B2 chain 12 cell.

The antibodies in the present invention can be used to treat or prevent diseases related to human laminin B2 chain 12. Administration of an appropriate dose of antibody can stimulate or block the production or activity of human laminin B2 chain 12. The invention also relates to a diagnostic test method for quantitative and localized detection of human laminin B2 chain 12 levels. These tests are well known in the art and include FI SH assays and radioimmunoassays. The levels of human laminin B2 chain 12 detected in the test can be used to explain the importance of human laminin B2 chain 12 in various diseases and to diagnose diseases in which human laminin B2 chain 12 functions.

 The polypeptide of the present invention can also be used for peptide mapping analysis. For example, the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.

 The polynucleotide encoding human laminin B2 chain 12 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human laminin B2 chain 12. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human laminin B2 chain 12 to inhibit endogenous human laminin B2 chain 12 activity. For example, a mutated human laminin B2 chain 12 may be a shortened human laminin B2 chain 12 lacking a signaling domain, and although it can bind to a downstream substrate, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human laminin B2 chain 12. Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus and the like can be used to transfer the polynucleotide encoding human laminin B2 chain 12 into cells. Methods for constructing recombinant viral vectors carrying a polynucleotide encoding human laminin B2 chain 12 can be found in existing literature (Sambrook, et al.). Alternatively, a recombinant polynucleotide encoding human laminin B2 chain 12 can be packaged into liposomes and transferred into cells.

 Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.

 Oligonucleotides (including antisense RNA and DM) and ribozymes that inhibit human laminin B2 chain 12 mRNA are also within the scope of the present invention. A ribozyme is an enzyme-like RM molecule that can specifically decompose specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA and performs endonucleation. Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DM synthesis techniques, such as solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides. Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the RM polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphorothioate or peptide bonds instead of phosphodiester bonds.

The polynucleotide encoding human laminin B2 chain 12 can be used for human laminin B2 chain 12 Diagnosis of related diseases. The polynucleotide encoding human laminin B2 chain 12 can be used to detect the expression of human laminin B2 chain 12 or the abnormal expression of human laminin B2 chain 12 in a disease state. For example, the DNA sequence encoding human laminin B2 chain 12 can be used to hybridize biopsy specimens to determine the expression of human laminin B2 chain 12. Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available. A part or all of the polynucleotide of the present invention can be used as a probe to be fixed on a microarray or a DM chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues. Human laminin B2 chain 12 specific primers can also be used to detect the transcription products of human laminin B2 chain 12 by RM-polymerase chain reaction (RT-PCR) in vitro amplification.

 Detection of mutations in the human laminin B2 chain 12 gene can also be used to diagnose human laminin B2 chain 12 related diseases. Human laminin B2 strand 12 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human laminin B2 strand 12 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.

 The sequences of the invention are also valuable for chromosome identification. This sequence specifically targets a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DM sequences on a chromosome.

 In short, a PCR primer (preferably 15-35bp) is prepared from the cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.

 PCR localization of somatic hybrid cells is a quick way to localize DM to specific chromosomes. Using the oligonucleotide primers of the present invention, in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.

 Fluorescent in situ hybridization (FISH) of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step. For a review of this technique, see Verma et al., Human Chromosomes: a Manua l of Basic Techniques, Pergamon Pres s, New York (1988).

Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be To correlate with genetic map data. These data can be found in V. Mckusick, Mendel ian Inherance in Man (available online with Johns Hopkins University Welch Medica l Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.

 Next, the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution Capacity and each 20kb corresponds to a gene).

 The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

 The invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention. Along with these containers, there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell. In addition, the polypeptides of the invention can be used in combination with other therapeutic compounds.

 The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. Human laminin B2 chain 12 is administered in an amount effective to treat and / or prevent a specific indication. The amount and range of human laminin B2 chain 12 to be administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples

 The present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods in the following examples are not marked with specific conditions, usually according to conventional conditions, such as Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Harbor Harbor Laboratory Pres s, 1989), or according to the conditions described in Conditions recommended by the manufacturer.

Example 1 Cloning of human laminin B2 chain 12 Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Poly (A) mMA was isolated from total RNA using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. Smart cDNA cloning kit (purchased from Clontech 1 cDM fragment was inserted into the multi-cloning site of pBSK (+) vector (Clontech)) to transform DH5 ot to form a CDM library. Dye terminate cycle react ion sequencing ki t (Perkin-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer) determined the 5 'and 3' end sequences of all clones. The determined cDNA sequence was compared with the existing ^ sequence sequence database (Genebank ) The comparison showed that the cDNA sequence of one of the clones 0 5M2 was a new DM. A series of primers were synthesized to determine the inserted CDM fragment of the clone in both directions. The results showed that the full length CDM contained in the 0215M2 clone was 3561bp (As shown in Seq ID NO: 1), there is a 321bp open reading frame (0RF) from 645bp to 965bp, encoding a new protein (as shown in Seq ID NO: 2). We named this clone pBS -0215M2, the encoded protein is named human laminin B2 chain 12. Example 2 The gene encoding human laminin B2 chain 12 was cloned by RT-PCR method

 CDNA was synthesized using fetal brain total RNA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:

 Primer 1: 5, one GGAAGTGGAGACATGGGCTGGGAA-3, (SEQ ID NO: 3)

 Primer2: 5'- ACTTTTTACATTTTATGTTTATTT -3 '(SEQ ID NO: 4)

 Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;

 Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.

Amplification reaction conditions: A reaction volume of 50 μ1 contains 50 mmol / L KCl, 10 legs ol / L Tris-HCl pH 8. 5, 1. 5 crypto ol / L MgCl ₂ , 20 (^ mol / L dNTP, l Opmol primer, 1U Taq DM polymerase (product of Clontech). The reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72. C 2min. Set β-act in as a positive control and template blank as a negative control at the same time during RT-PCR. The amplification products were purified using a QIAGEN kit and ligated to a pCR vector using a TA cloning kit (Invi trogen product). ). The DNA sequence analysis results show that the DM sequence of the PCR product is exactly the same as 1- 3561bp shown in SEQ ID NO: 1. Example 3 Northern blot analysis of human laminin B2 chain 12 gene expression

Total RM extraction in one step [Anal. Biochem 1987, 162, 156-159] ₀ This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1), mixed After centrifugation. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water. Using 20 μ§ RNA, electrophoresis was performed on a 1.2% agarose gel containing 20raM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-1 mM EDTA-2. 2M formaldehyde. It was then transferred to a nitrocellulose membrane. A- ³² P dATP was used to prepare ³² P-labeled DNA probes by random primers. The DM probe used was the PCR amplified human laminin B2 chain 12 coding region sequence (645bp to 965bp) shown in FIG. 1. A 32P-labeled probe (about 2 x 10 ⁶ cpm / ml) was hybridized with a nitrocellulose membrane to which RM was transferred at 42 ° C overnight in a solution containing 50% formamide-25raM KH ₂ P0 ₄ (pH7. 4)-5 x SSC-5 x Denhardt, s solution and 20 (^ g / ml salmon sperm DNA. After hybridization, the filter was placed in 1 x SSC-0.1 ° /. SDS at 55 ° C. Wash for 30 min. Then, use Phosphor Imager for analysis and quantification. Example 4 In vitro expression, isolation and purification of recombinant human laminin B2 chain 12

 Based on SEQ ID NO: 1 and the coding region sequence shown in Figure 1, a pair of specific amplification primers were designed, the sequence is as follows:

Primer3: 5'- CATGCTAGCATGCCCCATATAAATGACTGCCGC -3, (Seq ID No: 5) Primer4: 5'- CATGGATCCTCACTGCTTATCTGGGAAAGGCAG-3, (Seq ID No: 6) The two ends of these two primers contain Nhel and BamHI restriction sites, respectively. The coding sequences of the 5 'and 3' ends of the target gene are followed, respectively. The Nhel and BamHI restriction sites correspond to the selection on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3). Sex endonuclease site. PCR was performed using the pBS-0215bl2 plasmid containing the full-length target gene as a template. The PCR reaction conditions were as follows: a total volume of 50 μ1 containing 10 pg of pBS-0215bl2 plasmid, primers Primer-3 and Primer-4 were lOpmol, Advantage polymerase Mix (Clontech) 1 μ1, respectively. Cycle parameters: 94. C 20s, 60. C 30s, 68 ° C 2 min, a total of 25 cycles. Nhel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligated product was transformed into E. coli DH5 CC using the calcium chloride method. After being cultured overnight in LB plates containing kanamycin (final concentration 30 μ ₈ / ηι1), positive clones were selected by colony PCR method and sequenced. A positive clone (pET-0215bl2) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method. Containing kanamycin (final concentration of 3 (^ g / ml) of LB liquid medium, host strain BL21 _(P ET-0215bl2) at 37.C cultured to logarithmic phase, IPTG was added to a final concentration of lmmol / L, continue to culture for 5 hours. Centrifuge the bacterial cells, decompose them by ultrasound, collect the supernatant by centrifugation, and use an affinity chromatography column His. Bind Quick Cartridge (Novagen) that can bind to 6 histidines (6His-Tag). Product) was chromatographed to obtain the purified human laminin B2 chain I ^{2 of interest} . After SDS-PAGE electrophoresis, a single band was obtained at 12 KDa (Figure 2). The band was transferred to a PVDF membrane The N-terminal amino acid sequence was analyzed by Edams hydrolysis method, and the 15 amino acids at the N-terminal were compared with SEQ ID NO: 2 The N-terminal 15 amino acid residues shown are identical. Example 5 Production of anti-human laminin B2 chain 12 antibodies

The following peptides specific for human laminin B2 chain 12 were synthesized using a peptide synthesizer (product of PE company): NH2-Met-Pro-His-I le-Asn-Asp-Cys-Arg-Arg-Gly-Cys-Tyr -Phe-Val-Leu-COOH (SEQ ID NO: 7). The polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively. For methods, see: Avrameas, et al. Immunochemis try, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once. A titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum. Protein A-Sepharose was used to isolate total IgG from antibody-positive rabbit sera. The peptide was bound to a cyanogen bromide-activated Seph _arOS e4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography. The immunoprecipitation method proved that the purified antibody could specifically bind to human laminin B2 chain 12. Example 6 Application of the polynucleotide fragment of the present invention as a hybridization probe

 The suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in various aspects. For example, the probes can be used to hybridize to the genome or CDM library of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected. Further, the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.

The purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method. Acid sequence or a homologous polynucleotide sequence thereof. Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter. These same steps are as follows: The sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer. The pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid. After the hybridization step, the unhybridized probes are removed by a series of membrane washing steps. This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals. The probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention The polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment. This implementation For example, the dot blot method is used to fix the sample on the filter membrane. Under high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.

 First, the selection of the probe

 The selection of oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:

 1. The preferred range of probe size is 18-50 nucleotides;

 2, GC content is 30% -70%, non-specific hybridization increases when it exceeds;

 3, there should be no complementary regions inside the probe;

 4. Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements For homology comparison of the regions, if the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used generally;

 5. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments.

 After completing the above analysis, select and synthesize the following two probes:

 Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):

 5-TGCCCCATATAAATGACTGCCGCAGAGGCTGCTACTTTGTC -3 '(SEQ ID NO: 8) Probe 1 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment or its complementary fragment (41Nt) of SEQ ID NO: 1:

 5'- TGCCCCATATAAATGACTGCCGCAGAGGCTGCTACTTTGTC -3 '(SEQ ID NO: 9) For other commonly used reagents and their preparation methods related to the following specific experimental procedures, please refer to the literature: DNA PROBES GH Kel ler; MM Manak; Stockton Pres s, 1989 (USA) and more commonly used molecular cloning laboratory manual books such as the "Molecular Cloning Experiment Guide" (Second Edition 1998) [US] Sambrook et al., Science Press.

 Sample Preparation:

 1. Extract DNA from fresh or frozen tissue

Steps: 1) Place fresh or freshly thawed normal liver tissue in flat J immersed in ice and filled with phosphate buffered saline (PBS). Cut the tissue into small pieces with scissors or a scalpel. Keep tissue moist during operation. 2) Centrifuge the tissue at 1000g for 10 minutes. 3) Suspend the precipitate (about 10 ml / g) with a cold homogenization buffer (0. 25 mol / L sucrose; 25 mmol / L Tris-HCl, pH 7.5; 25 mmol / L NaCl; 25 mmol / L MgCl ₂ ). 4) at 4. C Use an electric homogenizer to homogenize the tissue suspension at full speed until the tissue is completely broken. 5) 1000g centrifuge 10 minutes. 6) Resuspend the cell pellet (l-5ml per 0.1 g of the initial tissue sample), and centrifuge at 1000g for 10 minutes. 7) Resuspend the pellet in lysis buffer (1 ml per 0.1 g of the initial tissue sample), and then follow the phenol extraction method below.

 2, DNA phenol extraction method

Steps: 1) Wash cells with 1-10 ml of cold PBS and centrifuge at 1000g for 10 minutes. 2) Resuspend the pelleted cells (1 x 10 ^s cells / ml) with cold cell lysate and apply a minimum of 100ul lysis buffer. 3) Add SDS to a final concentration of 1%. If SDS is directly added to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break, and reduce the overall yield. This is particularly serious when extracting> 10 ⁷ cells. 4) Add proteinase K to a final concentration of 200ug / ml. 5) Incubate at 50 ° C for 1 hour or shake gently at 37 ° C overnight. 6) Extract with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge in a small centrifuge tube for 10 minutes. The two should be clearly separated, otherwise centrifuge again. 7) Transfer the water phase to a new tube. 8) Extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 9) Transfer the DNA-containing aqueous phase to a new tube. The DNA was then purified and ethanol precipitated.

 3.Purification and ethanol precipitation of DM

Steps: 1) Add 1/10 volume of 2mol / L sodium acetate and 2 volumes of cold 100% ethanol to the DNA solution and mix. Leave at -20 ° C for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol. 4) Wash the pellet with 500ul of 70% cold ethanol and centrifuge for 5 minutes. 5) Carefully aspirate or pour out the ethanol. Wash the pellet with 500ul of cold ethanol and centrifuge for 5 minutes. 6) Carefully aspirate or pour out the ethanol, then invert on the absorbent paper to drain off the residual ethanol. Air dry for 10-15 minutes to allow the surface ethanol to evaporate. Be careful not to allow the pellet to dry completely, otherwise it will be more difficult to re-dissolve. 7) Resuspend the DNA pellet in a small volume of TE or water. Low-speed vortexing or pipetting, with a dropper, while gradually increasing the TE, mixed until fully dissolved DM every 1-5 X 10 ⁶ cells extracted about plus lul.

 The following steps 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.

8) Add RNase A to the DNA solution to a final concentration of 100u _g / ml, 37. C was held for 30 minutes. 9) Add SDS and proteinase K to the final concentration of 0.5% and 100ug / ml. Incubate at 37 ° C for 30 minutes. 10) Extract the reaction solution with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge for 10 minutes. 11) Carefully remove the aqueous phase and re-extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 12) Carefully remove the aqueous phase, add 180 vols of 2 mol / L sodium acetate and 2.5 vols of cold ethanol, and mix well at -20 ° C for 1 hour. 13) Wash the pellet with 70% ethanol and 100% ethanol, air dry, and resuspend the nucleic acid. The process is the same as steps 3-6. 14) A _26fl and A _{28fl were measured} to detect the purity and yield of DNA. 15) Store at -20 ° C after dispensing.

 Preparation of sample film:

1) Take 4 x 2 nitrocellulose membranes (NC membranes) of appropriate size and mark them lightly with a pencil For spotting position and sample number, two NC membranes are required for each probe, in order to wash the membranes with high-strength conditions and intensity conditions in the subsequent experimental steps.

 2) Pipette and control 15 microliters each, spot on the sample film, and dry at room temperature.

 3) Place on filter paper infiltrated with 0.1 mol / L NaOH, 1.5raol / L NaCl for 5 minutes (twice), dry and place in 0.5 mol / L Tris-HCl (pH 7.0), 3 mol / L NaCl filter paper for 5 minutes (twice) and allowed to dry.

 4) Clamped in clean filter paper, wrapped in aluminum foil, and dried under vacuum at 60-80 ° C for 2 hours.

 Labeling of probes

1) 3μ1 Probe (0.1OD / Ιθμΐ), add 2μ1 Kinase buffer, 8-10 uCi γ- ³² P-dATP + 2U Kinase to make up to a final volume of 20μ1.

 2) Incubate at 37 ° C for 2 hours.

 3) Add 1/5 volume of Bromophenol Blue Indicator (BPB).

 4) Pass Sephadex G-50 column.

5) Before the ³² P-Probe is washed out, start collecting the first peak (can be monitored by Monitor).

 6) 5 drops / tube, collect 10-15 tubes.

 7) Monitor the amount of isotope with a liquid scintillator.

8) combining the first peak was collected after ³² P-Prob _e is prepared as required (the second peak to the free γ- ³² Ρ - dATP).

 Pre-hybridization

 The sample membrane was placed in a plastic bag, and 3-10 mg of prehybridization solution (10xDenhardt's; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DM)) was added. After closing the bag, 68. C. Water shake for 2 hours.

 Cross

 Cut a corner of the plastic bag, add the prepared probe, seal the bag, and shake it at 42 ° C in a water bath overnight. Wash film:

 High-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, 40. C Wash for 15 minutes (twice).

 3) 0.1xSSC, 0.1% SDS, 40. C wash for 15 minutes (twice).

 4) 0.1xSSC, 0.1% SDS, 55. Wash for 30 minutes (twice) and dry at room temperature. Low-intensity washing film:

1) Take out the hybridized sample membrane. 2) 2xSSC, 0.1% SDS, wash at 37 ° C for 15 minutes (twice).

 3) 0.1xSSC, 0.1 ° / oSDS, 37. C Wash for 15 minutes (twice).

 4) Wash in 0.1xSSC, 0.125 SDS at 40 ° C for 15 minutes (twice), and dry at room temperature.

X-ray auto-development:

 -70 ° C, X-ray autoradiography (pressing time depends on the radioactivity of the hybrid spot).

 Experimental results:

 釆 The hybridization experiments performed under low-intensity membrane washing conditions did not differ significantly in the radioactivity of the above two probe hybrid spots; while the hybridization experiments performed under high-intensity membrane washing conditions, the radioactive intensity of hybridization spots of probe 1 was obvious Stronger in radioactivity than the hybridization spot of another probe. Therefore, the presence and differential expression of the polynucleotide of the present invention in different tissues can be analyzed qualitatively and quantitatively with the probe 1. Example 7 DNA Microarray

 Gene chip or gene microarray (DM Microarray) is a new technology currently being developed by many national laboratories and large pharmaceutical companies. The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information. The polynucleotide of the present invention can be used as a target DM for gene chip technology for high-throughput research of new gene functions; searching for and screening new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . The specific methods and steps have been reported in the literature, for example, see the literature DeRis i, J. L., Lyer, V. & Brown, P. 0.

 (1997) Science 278, 680-686. And literature Helle, R. A., Schema, M., Chai, A., Shalom, D.,

(1997) PNAS 94: 2150-2155.

 (A) spotting

 A total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR, and the amplified product was purified to adjust its concentration to about 500ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 μm. The spotted slides were hydrated, dried, and cross-linked in a UV cross-linking instrument. After elution, the DNA was fixed on the glass slide to prepare a chip. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:

 1. Hydration in a humid environment for 4 hours;

 2. 0.2% SDS washing 1 tamping bell;

3. Wash twice with ddH ₂ 0 for 1 minute each time; 4. NaBH _{4 is} blocked for 5 minutes;

 5. 95 ° C water for 2 minutes;

 6. Wash at 0.2 ° / »SDS for 1 minute;

7. Rinse twice with ddH ₂ 0;

 8. Dry and store at 25 ° C in the dark for future use.

 (Two) probe marking

 Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and mRM was purified with Ol igotex mRNA Midi Kit (purchased from QiaGen). Reverse transcription was used to separate fluorescent reagents. Cy3dUTP (5-Amino-propargy 1-2 '-deoxyur idine 5'-triphate coupled to Cy3 f luorescent dye, purchased from Amershara Phamacia Biotech) was used to label mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5- Amino-propargyl- 2'-deoxyuridine 5'-triphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech, was used to label mRM, a specific tissue (or stimulated cell line) of the body, and the probe was prepared after purification. For specific steps and methods, see:

 Schena,, Shalon, D., Heller, R. (1996) Proc. Natl. Acad. Sci. USl Vol. 93: 10614-10619. Schena, M., Shalon, Dari., Davis, RW (1995) Science. 270 (20): 467-480.

(Three) cross

 The probes from the two types of tissues were hybridized with the chip in a UniHyb ™ Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, and washed with a washing solution (1 x SSC, 0.2% SDS) at room temperature. Scanning was performed with a ScanArray 3000 scanner (purchased from General Scanning, USA), and the scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.

 The above specific tissues (or stimulated cell lines) are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, L02 cell line stimulated by arsenic for 1 hour, L02 cell line stimulated by arsenic for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain, Fetal lung and fetal heart. Draw a graph based on these 26 Cy3 / Cy5 ratios (Figure 1). It can be seen from the figure that the expression profiles of human laminin B2 chain 12 and human laminin B2 chain according to the present invention are very similar.

Claims

Uncle demand

1. An isolated polypeptide-human laminin B2 chain 12, characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID NO: 2, or an active fragment, analog or derivative thereof.

 2. The polypeptide according to claim 1, characterized in that the amino acid sequence of said polypeptide, analog or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO: 2.

 3. The polypeptide according to claim 2, characterized in that it comprises a polypeptide having the amino acid sequence shown in SEQ ID NO: 2.

 4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having an amino acid sequence shown in SEQ ID NO: 2 or a fragment, analog, or derivative thereof;

 (b) a polynucleotide complementary to polynucleotide (a); or

 (c) A polynucleotide that is at least 70% identical to (a) or (b).

 5. The polynucleotide according to claim 4, wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence represented by SEQ ID NO: 2.

 6. The polynucleotide according to claim 4, characterized in that the sequence of the polynucleotide comprises the sequence of positions 645-965 in SEQ ID NO: 1 or the sequence of positions 1-3561 in SEQ ID NO: 1. .

 7. A recombinant vector containing an exogenous polynucleotide, characterized in that it is constructed from any one of claims 4 to 6 and the polynucleotide, a plasmid, a virus or a vector expression vector Recombinant vector.

 8. A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is selected from one of the following host cells:

 (a) a host cell transformed or transduced with the recombinant vector of claim 7; or

 (b) a host cell transformed or transduced with a polynucleotide according to any one of claims 4-6.

 9. A method for preparing a polypeptide having human laminin B2 chain 12 activity, characterized in that the method comprises:

 (a) culturing the engineered host cell according to claim 8 under the condition of expressing human laminin B2 chain 12;

 (b) Isolating a polypeptide having human laminin B2 chain 12 activity from the culture.

10.An antibody capable of binding to a polypeptide, characterized in that the antibody is capable of binding to human laminin B2 chain 12 specifically binds to the antibody.

 11. A class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that they are compounds that mimic, promote, antagonize or inhibit the activity of human laminin B2 chain 12.

 12. The compound according to claim 11, characterized in that it is an antisense sequence of the polynucleotide sequence shown in SEQ ID NO: 1 or a fragment thereof.

 13. Use of the compound according to claim 11, characterized in that the compound is used for a method for regulating the activity of human laminin B2 chain 12 in vivo and in vitro.

 14. A method for detecting a disease or disease susceptibility related to the polypeptide according to any one of claims 1-3, characterized in that it comprises detecting the expression amount of the polypeptide, or detecting the polypeptide Activity, or detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide.

 15. The use of the polypeptide according to any one of claims 1-3, characterized in that it is used for screening mimetics, agonists, antagonists or inhibitors of human laminin B2 chain 12; or For identification of peptide fingerprints.

 16. The use of a nucleic acid molecule according to any one of claims 4 to 6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or for manufacturing a gene chip. Or microarray.

 17. The use of the polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that the polypeptide, polynucleotide or mimetic, agonist, The antagonist or inhibitor is composed of a safe and effective dose with a pharmaceutically acceptable carrier as a pharmaceutical composition for diagnosing or treating a disease associated with abnormalities of human laminin B2 chain 12.

 18. The application of any one of claims 1-6 and 11, the application of the polypeptide, polynucleotide or compound described in claim 1, which is characterized in that the polypeptide, polynucleotide or compound is used to prepare for the treatment of malignant tumors. Drugs for blood diseases, HIV infection and immune diseases and various types of inflammation.