WO1999015520A1 - Fused or nonfused benzene compounds - Google Patents

Abstract

Compounds represented by general formula (I), nontoxic salts and acid addition salts of the same, and hydrates of both; and peroxisome proliferator-activated receptor (PPAR) controllers containing the same as the active ingredient (wherein each symbol is as defined in the description). The compounds exhibit control effects against PPAR and are therefore useful as, e.g., antihyperglycemic drugs, antihyperlipidemic drugs, or preventive and/or therapeutic agents for metabolic diseases such as diabetes, obesity, syndrome X, hypercholesterolemia and hyperlipoproteinemia, hyperlipemia, arteriosclerosis, circulatory diseases, polyphagy, and ischemic heart diseases.

Description

 Specification

 Condensed or non-condensed benzene compounds

 The present invention relates to a condensed or non-condensed benzene compound represented by the general formula (I), a non-toxic salt thereof, an acid addition salt thereof and a hydrate thereof, a method for producing the same, and a method for producing the compound. The present invention relates to a peroxisome proliferator-activated receptor regulator contained as a component.

 More specifically, the general formula (I)

(I)

(In the formula, all symbols have the same meanings as described below.) Condensed or non-condensed benzene compounds, their non-toxic salts, their acid addition salts and their hydrates, and their production methods (4) It relates to a peroxisome-proliferating drug-activated receptor regulator containing them as an active ingredient. Background art

Recently, in studies of transcription factors involved in the induction of the expression of adipocyte differentiation marker genes, a nuclear receptor, peroxisome proliferator activated receptor (hereinafter referred to as PPAR receptor) is abbreviated. ) Is drawing attention. For PPAR receptors, cDNA is cloned from various animal species, and multiple isoform genes have been found. In mammals, three types of "," and "" are known (J. Steroid Biochem. Molec. Biol., 51, 157 (1994); Gene Expression, 4, 281 (1995); Biochem Biophys. Res. Commun., 224, 431 (1996); Mol. Endocrinology, 6, 1634 (1992)). Furthermore, type A is mainly expressed in adipose tissue, immune cells, adrenal gland, spleen and small intestine, type α is mainly expressed in adipose tissue, liver and retina, and type S is ubiquitously expressed without tissue specificity. (See Endocrinology, 137, 354-366 (1996)).

 Incidentally, the thiazolidine derivatives shown below are known as therapeutic agents for non-insulin-dependent diabetes mellitus (NIDDM), and are hypoglycemic agents used to correct hyperglycemia in diabetic patients. In addition, it is a compound that has been shown to be extremely promising as an insulin sensitizer because it is effective in correcting or improving hyperinsulinemia, improving glucose tolerance, and lowering serum lipids.

 Troglitazone

It has also been found that one of the intracellular target proteins of these thiazolidine derivatives is the PPAR7 receptor, which increases the transcriptional activity of PPARa (Endocrinology, 137: 4189-4195 (1996); Cell, 83). : 803-812 (1995); Cell, 83: 813-

819 (1995); J. Biol. Chem., 22Q: 12953-12956 (1995)). Therefore, a PPAR 7 activator (agonist) that increases the transcriptional activity of PPAR 7 is considered to be promising as a hypoglycemic agent and / or a lipid lowering agent. In addition, PPAR Gonists are known to enhance the expression of PPARa protein itself (Genes &

Development, 1Q: 974-984 (1996)) not only activates PPAR7

Drugs that increase the expression of the PPARa protein itself are also considered clinically useful. The nuclear receptor PPARa is involved in adipocyte sorting (see J. Biol. Chem., 272, 5637-5670 (1997) and Cell, 83, 803-812 (1995)). It is known that thiazolidine derivatives which can be converted promote adipocyte differentiation. Recently, it has been reported in humans that thiazolidine derivatives increase body fat, causing weight gain and obesity (see Lancet, 349, 952 (1997)). Therefore, an antagonist (antagonist) that suppresses PPAR7 activity and an agent that can reduce the expression of PPAR7 protein itself are considered to be clinically useful. By the way, Science, 224: 2100-2103 (1996) introduces a compound that can inhibit the activity of PPAR7 by phosphorylating it. Drugs that suppress activity are also considered to be clinically useful. From these facts, PPARa receptor activator (agonist) and PPARa protein expression regulator that can increase the expression of protein itself are hypoglycemic agents, hypolipidemic agents, diabetes, obesity, syndrome X, is useful as a prophylactic and therapeutic agent for metabolic disorders such as hypercholesterolemia and hyperlipoproteinemia, hyperlipidemia, arteriosclerosis, hypertension, cardiovascular disease, bulimia, etc. It is expected to be. On the other hand, antagonists that suppress the transcriptional activity of the PPARa receptor or PPAR7 protein expression regulators that can suppress the expression of the protein itself include hypoglycemic drugs, diabetes, obesity, metabolic disorders such as syndrome X, and hyperlipidemia. Is expected to be useful as a prophylactic and / or therapeutic agent for diseases, arteriosclerosis, hypertension, bulimia and the like.

Also, the following fibrous compounds, for example, clofibrate, are known as lipid lowering agents,

It has also been found that one of the intracellular target proteins of fibrate compounds is a PPAR "receptor (Nature, 347: 645-650 (1990); J. Steroid Biochem. Molec. Biol., 51: 157-166). (1994); Biochemistry, 2: 5598-5604 (1993)) From these facts, it is considered that a PPAR "receptor regulator which can activate a fibrate compound has a lipid-lowering effect, It is expected to be useful as a prophylactic and / or therapeutic agent for hyperlipidemia.

In addition to this, as a biological activity involving PPARα, it has recently been reported in W0973 6579 that it has an anti-obesity effect. In addition, J. Lipid Res., 39, 17-30 (1998) states that the activity of PPAR receptor increases the cholesterol of high-density lipoprotein (HDL) and that of low-density lipoprotein (LDL) cholesterol. It has been reported that it has a very low density lipoprotein (VLDL) cholesterol and even triglyceride lowering effect. Diabetes, 348-353 (1997) reported that one of the fibrate compounds, bezafibrate, was found to improve blood fatty acid composition, hypertension, and insulin resistance. Therefore, agonists that activate PPAR "receptors" and PPAR-regulators that increase the expression of PPAR "protein itself are useful not only as lipid-lowering agents and drugs for treating hyperlipidemia, but also as HDL cholesterol-elevating agents, It is expected to reduce cholesterol and Z or VLD L cholesterol, and to suppress and treat the progression of arteriosclerosis, and to suppress obesity. Onset of ischemic heart disease It seems promising for prevention.

 On the other hand, there are few reports of biological activities involving the ligand ゃ PPAR3 receptor, which significantly activated the PPAR receptor.

 PPAR S is sometimes referred to as PPAR?, Or NUC 1 in humans. As a biological activity of P PAR δ, WO 9601430 describes that hNUC IB (P PAR subtype that is one amino acid different from human NUC 1) can suppress the transcriptional activity of human P PAR α and thyroid hormone receptor. It is shown. Further, recently, in WO 9728149, compounds (agonists) having a high affinity for PPARS protein and significantly activating PPARS have been found, and those compounds have been further identified. It has been reported that HDL (high density lipoprotein) has a cholesterol increasing effect. Therefore, agonists capable of activating PPARδ are expected to have an effect of increasing HDL cholesterol, thereby suppressing the progression of arteriosclerosis and its application, as lipid-lowering agents and hypoglycemic agents, and for treating hyperlipidemia. It is also considered to be useful for hypoglycemic drugs, treatment of diabetes, reduction of the risk factor of syndrome X, and prevention of the development of ischemic heart disease.

 As patent applications relating to PPAR receptor modulators, for example, the following five patent applications (including some mentioned in the background of the invention) are known.

 (1) The specification of WO 9727857 includes a general formula (Α)

(Wherein RA is selected from a hydrogen atom, C 1-6 alkyl, C 5-10 aryl, and C 5 10 heteroaryl, wherein the alkyl, aryl and heteroaryl are The reel may be substituted with 1 to 3 R a A;

R 1 ^A is selected from a hydrogen atom, C 1 to 15 alkyl, C 2 to 15 alkenyl, C 2 to 15 alkynyl and C 3 to 10 cycloalkyl, and the above alkyl, alkenyl, alkynyl, The cycloalkyl may be substituted by 1 to 3 R ^{a A} ;

R ^{3 A} is a hydrogen atom, NHR ^{1 A,} NH Ashiru, C. 1 to: I 5 alkyl, C 3~: 1 0 cycloalkyl, C. 2 to 1 5 alkenyl, C. 1 to 1 5 alkoxy, C0 ₂ Aruki Le, OH, C2 ~: 15 alkynyl, C5 ~ 10 aryl, C5 ~ 10 heteroaryl, alkyl, cycloalkyl, alkenyl, alkynyl, aryl and heteroaryl are from 1 May be substituted with three R a A;

_(Z A- _W A) is ZA- CR6AR7A-, ZA- CH = CH-, or

Represents;

R8A is CR6AR7A, 0, NR6A and S (0) is selected from _{p A;} R ⁶ _A and R ⁷ A are each independently selected from hydrogen atom, C 1 to 6 alkyl; BA is below 1) to 3 ) Is selected from;

 1) 5- or 6-membered hetero ring containing 0 to 2 double bonds and 1 hetero atom selected from 0, S, N, and a hetero atom is a 5- or 6-membered hetero ring The heterocyclic ring may be substituted at any position of the ring, and the heterocyclic ring may be substituted with 1 to 3 R a A,

 2) a carbocycle containing from 0 to 2 double bonds, wherein the carbocycle may be substituted at any position of 5 or 6 members with 1 to 3 R a A,

3) A 5- or 6-membered hetero ring containing 0 to 2 double bonds and 3 hetero atoms selected from 0, S, and N, and the hetero atom is a 5- or 6-membered hetero ring. The heterocyclic ring may be substituted at any position of the ring, and the heterocyclic ring may be substituted with 1 to 3 R a A. May be done;

 X 1 A and X 2 A are each independently a hydrogen atom, OH, C l-15 alkyl, C

2 to; L 5 alkenyl, C 2 to 15 alkynyl, halogen atom, 0 R ^{3 A} , C 5 to 10 aryl, C 5 to 10 aralkyl, C 5 to: I 0 heteroaryl and C 1 to 10 acyl Wherein said alkyl, alkenyl, alkynyl, aryl and heteroaryl are optionally substituted by 1 to 3 R ^A A; Ra A is a halogen atom, asyl, aaryl, heteroaryl, CF ₃ , 〇CF ₃ ,

- 0 -, CN, N 0 2, R 3 A, OR 3 A, SR 3 A, = N (0 R A), S (0) R 3 A, S 0 2 R 3 A, NR 3 AR 3 Α NR 3 ACOR 3 A, NR 3AC 0 ₂ R 3A, NR 3 AC 0 N (R 3 A) ₂ , NR 3 AS 0 ₂ R 3 A, COR 3 A, C〇 ₂ R 3 A, C ON (R 3 a) _2, S_〇 _{2 N (R 3 a) 2} , is selected from ◦ CON (R3 a) _2, the Ariru and heteroaryl are optionally substituted with one or et three halogen atoms or C. 1 to 6 alkyl YA is S (0) ρ _Α , — CH _2- , — C (0)-, -C (0) NH-, — NRA—, 1 0—, 1 S 0 ₂ NH—, 1 NH S 0 ₂ — selected from, Y 1 A selected from 0 and C,

Z ^A is selected from _{^{C0 2 R 3 A, R 3}} A C0 2 R3A, C0NH S 0 2 Me, C0NH 2 and 5 _ (1 H- tetrazol Ichiru)

t A and V A each independently represent 0 or 1, 1; 8 + 8 is 1;

 Q A represents a saturated or unsaturated, straight-chain 2 to 4 carbon atoms at the opening, and p A is 0 to 2. )

Or a pharmaceutically acceptable salt thereof is a P PAR receptor modulator and is described as being useful for the treatment of diabetes, obesity, hyperlipidemia and the like. (2) WO 9728137 also describes that compounds similar to the above are P PAR d receptor modulators and are useful for similar diseases.

 (3) WO 97281 No. 15 describes the general formula (B)

(Wherein, RB is hydrogen, C L～6 alkyl, C. 5 to 10 Ariru, and C 5 ~ is selected from 1 0 Heteroariru said alkyl, Ariru and to Teroa reel with 1-3 R ^a B May be substituted;

R ^{1 B} is selected from a hydrogen atom, C 1 to: I 5 alkyl, C 2 to 15 alkenyl, C 2 to 15 alkynyl and C 3 to 10 cycloalkyl, and the above alkyl, alkenyl, alkynyl, and Cycloalkyl may be substituted by 1 to 3 R a B;

R 2 B is a hydrogen atom, C. 1 to 1 5 alkyl, Ashiru, C. 2 to 1 5 alkenyl, OR3B, C0 ₂ alkyl, C (〇) R ^{3 B,} OH, one OC (〇) R3B, C2~ 15 alkynyl , C. 5 to: 1 0 Ariru, is selected from C. 5 to 10 Heteroariru, the alkyl, alkenyl, alkynyl, Ariru and heteroaryl may be substituted with 1-3 R ^a B;

R3B is a hydrogen atom, NHR1B, NHacyl, C1-15 alkyl, C2-15: L5 alkenyl, C1-15 alkoxy, CO2 alkyl, OH, C2-15 alkynyl, C5-1 0 aryl, C 5-10 heteroaryl, wherein said alkyl, alkenyl, alkynyl, aryl and heteroaryl are optionally substituted by 1 to 3 RaB; R4I ^ ± R2B, one BB—selected from R5B or C = Y ^FFI ,

However, when (ZB—WB—) represents ZB—CR6BR7B—, γΒ represents ₀ , and R 4Β represents R 2Β, R2B represents acetyl, hydrogen atom, alkyl, alkoxy, aryl. If not;

Or (ZB—WB—) represents ZB—CR6BR7B—, γΒ represents ₀ ,

R ³⁸

And R4B. When representing the two丫² ", Y2B is either not represent 0, or _(Z B- _W B-) is ZB- CR6BR7B- or

formula

(Wherein, R8B represents 0.), YB represents S or 0, and R4B represents —ΒΒR5B, _{Β 0} does not represent ₀ or S;

 R5B is selected from c5-10 aryl and C5-10 heteroaryl, wherein said aryl and heteroaryl are optionally substituted with one to three RaBs;

BB is selected from 0, S (0) pB and NR ^{1 B} ;

(ZB-WB-) is ZB—CR 6BR 7B—, ZB—CH = CH—, or

Represents;

R8B is CR6BR7B, 〇 is selected from NR6B and S (0) _{p B;}

R6B and R7B are each independently selected from a hydrogen atom, C1-6 alkyl; X1B and χ2B are each independently a hydrogen atom, 0H, C1-15 alkyl, C2-15 alkenyl, C2-15 alkynyl, halogen atom, OR3B, c5-10 aryl, C5-10 aralkyl, C5-: selected from L0 heteroaryl and C1-10 acyl, and the above alkyl, alkenyl, alkynyl, Early And heteroaryl may be substituted with one to three R ^A B;

R a B is a halogen atom, acyl, aryl, heteroaryl, CF ₃ , OCF ₃ ,

_{_0, CN, N0 2, R} 3 B, 〇 R 3 B, SR 3 B, S (0) R 3 B,

S 0 ₂ R3 B, NR 3 BR 3 B, NR 3B C 0 R3 B, NR 3 BC 0 ₂ R 3 B, NR 3 BC ON (R 3 B) ₂ , NR 3 B _S 〇 ₂ R 3 B, COR 3 B, C0 ₂ R 3 B,

_{CON (R 3 B) 2,} S 0 2 N (R 3 B) 2, is selected from OCON (R3 B) _2, the above Ariru Contact Yopi Heteroariru with 1-3 halogen atoms or C. 1 to 6 alkyl May be substituted;

YB is from S (0) _{Ρ 、,} — CH ₂ —, — C (0) one, one C (0) NH—, — NRB—, one 0—, one S 0 ₂ NH—, one NHS 0 ₂ — Selected,

Y 1 B is selected from o, NRB and C;

Υ2Β is 〇, N (C l to 1 5) alkyl, N (C_〇 ₂₎ alkyl, N-0 alkyl Le, is selected from N-0 Ashiru and N-0H, however, display the is 0 Y2B and, 1? 38 Gazi 11 ₃ If the table Wasu, Itabeta is assumed to represent 2,

ΖΒ is selected from C0 ₂ R ^{3 B} , R ^{3 B} C0 ₂ R3B, C0 NHS 0 ₂ R ^B > C0 NH ₂ and 5 _ (1 H-tetrazole),

t B and V B each independently represent 0 or 1, 8 +: 6 is 1;

QB represents a 2-4 Haidoroka one carbon linear, saturated or unsaturated, and p ^B is from 0 to 2. )

Or a pharmaceutically acceptable salt thereof is a PPARS receptor modulator and is described to be useful for similar diseases.

(4) W09728149 also describes that compounds similar to the compounds represented by the above general formulas (A) and (B) are P PAR receptor modulators and are useful for similar diseases. Have been. (5) WO 973 1907 describes the general formula (C)

Wherein AC is phenyl or the like, wherein the phenyl is one or more halogen atoms, C1-6 alkyl, C1-3 alkoxy, C1-3 fluoroalkoxy, nitrile or 1NR7CR8C (formula Wherein R7C and R8C independently represent a hydrogen atom or C1-3 alkyl;

BC represents C 1-6 alkylene, one M ^c —C 1-6 alkylene, C 1-6 alkylene —MC—C 1-6 alkylene group (in the group, MC represents 0, S or NR 2 C) and the like. Represent;

 A 1 k C represents C 1-3 alkylene;

 R 1 C represents a hydrogen atom or C 1-3 alkyl;

 ZC is selected from one (Cl-3 alkylene) phenyl or one NR3 CR4C. ) Or a pharmaceutically acceptable salt thereof is described as having PPAR7 agonist activity. (The explanation of the groups in the formula is that necessary parts are extracted.) .

 On the other hand, as a condensed or non-condensed benzene compound, for example, (6) Japanese Patent Application Laid-Open No. 61-267532 (corresponding to European Patent Publication No.

_Ar 1D_ _x D_ _Ar D_ _z D_ _(R D _{) nO (D)}

Wherein Ar ID represents a nitrogen, sulfur or oxygen heterocyclic or aromatic ring; A rD represents a phenyl ring or a nitrogen, oxygen or sulfur heterocycle;

80-108 is completely substituted by H, CH ₃ , lower alkyl, aryl, arealkyl, noguchi, hydroxy, lower alkoxy, CF ₃ , carboxy, alkyl alkoxy, oxo, nitro, etc. Or may be incompletely substituted;

XD is 0 (CHR 1D) _nD —, -NR2D (CHR 1D) _nD —, alkylene

(Up to 2 carbon atoms and up to 4 carbon atoms in the main chain), —CO— (CH R ID) _n 'D—, -CH (OH)-(CHRlD) _nD —, etc.

ZD is an alkylene chain having up to 10 carbon atoms and up to 12 carbon atoms and 0 to 2 double bonds in the main chain, wherein the alkylene chain is bonded through an oxygen, sulfur or amino nitrogen atom. May be connected to A r D,

When n'D = 1, RD is selected from = 0, 0R3D, R1D, one COR4D, etc .;

R 1 D represents H or CH ₃ ;

R4D represents OR2D or the like;

R ^{2 I} ^ ± H, lower alkyl, etc .;

nD = 0 or 1;

n'D = 1-7. )

It has been described that the compound represented by and its salt have an anti-inflammatory action and an anti-allergic action based on the lipoxygenase inhibitory activity (the explanation of the groups in the formula was excerpted from necessary parts).

 (7) The specification of W08605779 has the general formula (E)

(Where AE represents a hydrogen atom, phenyl, phenoxy,

 nE represents an integer from 3 to 10,

R 1 E represents a hydrogen atom or lower alkoxy,

X 1 E represents — CH ₂ CH ₂ —, one CH = CH—, etc.

(In the formula, R ² E represents a hydrogen atom, halogen, nitro, hydroxyl group, lower alkoxy, etc., and R ^{3 E} represents a hydrogen atom, a hydroxyl group or lower alkoxy.)

X2E represents one CH = CH— or — Y 3E— _Y 4E— group (wherein, _Υ 3Ε represents a single bond, 1 0—, 1 S— or 1ΝΗ—, ¥ 4 £ is 1 to 6 alkyl Represents.) Represents

 Ν-Ν

 DE represents carboxy, lower alkoxycarbonyl or ~, Ν. )

 Ν

 Η

It has been described that the compound represented by and the salt thereof have an antiallergic activity based on SRS antagonism (necessary parts were extracted for the explanation of the groups in the formula).

 (8) JP-T 8-504194 (corresponding to WO 9412 181) describes the general formula (F)

XF- _Y F_ _Z F_ “A reel F” — _A F— _B F (F)

(Where "aryl F" is a monocyclic aromatic 6-membered ring system containing 0, 1, 2, 3, or 4 N atoms and having no substituents or substituted with R ^{5 F} ;

X ^F contains N, 0, 0 is selected from S, 1, 2, 3 or 4 heteroatom, or R ^{1 F} no substituent, R ^{2 F,} is substituted by R3F or R4F Just A cyclic or polycyclic aromatic or non-aromatic 4- to 10-membered ring system or the like, wherein RlF, R2F, 1 ^ 3 ?? ^^ 4 are hydrogen, C1-10 Independently selected from the group consisting of alkyl, C1-4alkoxyC0-6alkyl, and the like;

¥ 0 to 8 alkyl, C 0 to 8 alkyl-1 0 to C 0 to 8 alkyl,

C 0-8 alkyl-SO _{n F} — C 0-8 alkyl,

(CH ₂₎ 0 one ₆ - is _{NR 3 F- (CH 2) 0-} 6 , etc., where nF is an integer from 0 to 2;

ZF and AF are (CH ₂ ) _MF , (CH ₂ ) _MF 〇 (CH ₂ ) _NF , (CH ₂ ) _{M F} NR 3 F (CH ₂ ) _{n F} , (CH ₂ ) _mF S0 ₂ (CH ₂ ) _{n F} , (CH ₂ ) _mF S (CH ₂ ) _{n F} , (CH ₂ ) _mF SO (CH ₂ ) _{n F,} etc., where mF and nF are independently selected from 0-6 Where AF is (CH ₂ ) _mF , the "Aryl F" ring attached to ZF and AF must contain at least one heteroatom;

R ^{5 F} is hydrogen, C 1-6 alkyl, C 0-6 alkyloxy C 0-6 alkyl, halogen and the like;

_B F

And where

R 6 F, R 7 F, R 8 F, R 9 F, R 1 OF and R 11 F are independently selected from hydrogen, C 1-8 alkyl, etc.

 R 12 F is selected from hydroxy, C 1-8 alkyloxy and the like. ) And a pharmaceutically acceptable salt thereof have a platelet aggregation inhibitory activity based on fibrinogen receptor antagonist activity and are effective for thrombosis. In the explanation of, the necessary parts were extracted.)

(9) JP-A-61-118380 describes the general formula (G)

(Wherein, R ¹ G is hydroxymethyl or carboxy which may be protected, R ² G is hydrogen, linear or branched lower alkyl or lower alkenyl, C 4-7 cyclic alkyl, Phenyl, phenyl-lower alkyl, hydroxy, thienyl or furyl, and the broken line represents the presence or absence of a double bond.)) Is described as having an antihypertensive diuretic effect. As a commercially available reagent, for example, (10) formula (H)

2— (1-Phenylethyl) phenoxyacetic acid (manufactured by Sailor) represented by the following formula is known. Disclosure of the invention

 The present inventors have conducted intensive studies to find a compound having a PPAR receptor regulating action, and as a result, have found that the compound represented by the general formula (I) achieves the object, and completed the present invention.

 The present invention

(1) General formula (I) (I)

(Wherein, R 1 and R 2 each independently represent a hydrogen atom, a Cl-8 alkyl group, a Cl-4 alkoxy group, a halogen atom, a nitro group, or a trifluoromethyl group;

(In each formula, A represents a linear C 1-3 alkylene group, a single C O— group or a —CH (OH) — group;

 R3 represents a —COOR5 group (wherein, R5 represents a hydrogen atom or a c1-4 alkyl group), or a 1H-tetrazol-15-yl group;

C © is

 1) an 8- to 11-membered saturated or unsaturated bicyclic carbocyclic group, or

 2) A saturated or unsaturated 8- to 11-membered bicyclic heterocyclic group containing 1 to 3 hetero atoms selected from a sulfur atom, an oxygen atom and Z or a nitrogen atom. Oxo or thioxo groups).

 Y represents a 10_, 1S- or -NR7- group (wherein, R7 represents a hydrogen atom or a C1-4 alkyl group). ) Represents a group represented by )

A condensed or non-condensed benzene compound, a non-toxic salt thereof, an acid addition salt thereof, or a hydrate thereof, (2) a peroxisome proliferator-activated receptor regulator containing them as an active ingredient, and

 (3) The method for producing them. Detailed description of the invention

 In the present invention, all isomers are included unless otherwise indicated. For example, the alkyl group, the alkylene group, and the alkoxy group include those having a straight chain and those having a branched chain. It also includes isomer groups resulting from the presence of asymmetric carbon atoms, such as when a branched alkyl group is present.

 In the general formula (I), the c1-4 alkyl group represented by R5 and R7 is a methyl, ethyl, propyl, butyl group or a heterobiogenic group thereof.

 In the general formula (I), the C 1-8 alkyl group represented by R 1 and R 2 is a methyl, ethyl, propyl, butyl, pentyl, hexyl, heptyl, octyl group and isomer groups thereof. .

In the formula (I), the C 1 to 4 alkoxy groups represented by R ¹ and R ^2, Ah with main butoxy, ethoxy, Purobokishi, butoxy and isomeric groups thereof.

In the general formula (I), the halogen atoms represented by R ¹ and R ² are a fluorine, chlorine, bromine and iodine atom.

 In the general formula (I), the linear C1-3 alkylene group represented by A is a methylene, ethylene or trimethylene group, preferably a methylene group.

 A is preferably a methylene group or a C 1 O— group, and more preferably a C 1 O— group.

In the general formula (I),

Examples of the 8- to 11-membered saturated or unsaturated bicyclic carbocyclic group represented by are: pentalene, indene, naphthalene, dihydroindene, dihydronaphthalene, tetrahydronaphthalene and the like. Getting,

In the general formula (I),

A saturated or unsaturated 8- to 11-membered bicyclic heterocyclic group containing 1 to 3 hetero atoms selected from a sulfur atom, an oxygen atom and a nitrogen or nitrogen atom represented by (This ring may be further substituted with an oxo or thioxo group). Droisobenzozothiophene, Indole, Indolin, Isoindole, Isoindoline, Benzoxazol, Dihydrobenzoxazol, Isobenzoxazole, Dihydroisobenzoxazole, Benzothiazole, Dihydrobenzothiazo , Isobenzothiazole, dihydroiso Benzothiazol, benzimidazole, dihydrobenzimidazole, indazol, dihydroindazole, benzofurazan, dihydrobenzofurazan, chromene, chroman, isochromene, isochromanquinoline, dihydroquinoline, tetrahydroquinoline, isoquinoline, dihydroquinoline , Tetrahydroisoquinoline, quinazoline, dihydroquinazoline, tetrahydroquinazoline, cinnoline, dihydrocinnoline, tetrahydrocinnoline, quinoxaline, dihydroquinoxaline, tetrahydroquinoxaline, phthalazine, dihydrophthalazine, tetrahydrophthalazine, benzmorpholine, benzmorpholine Dithianaphthalene, dihydrodithianaphthalene, benzo Zepin, dihydrobenzazepine, tetrahydrobenzozepine, benzodiazepine, dihydrobenzozodazepine, tetrahydrobenzozodazepine, benzoxepin, dihydrobenzoxepin, tetrahydrobenzoxepin, benzodioxepin, dihydrobenzoxepin, dihydrobenzoxepin , Benzodioxane, benzothiaine, dihydrobenzothiaine, benzochepin, dihydrobenzozopine, tetrahydrobenzozopine, benzodicepine, dihydrobenzothiane Nzodichepine, tetrahydrobenzodichepine, benzoxazine, dihydrobenzoxoxazine, benzoxazepine, dihydrobenzoxazepine, tetrahydrobenzoxazepine, benzothiazepine, dihydrobenzozoazepine, tetrahydrobenzothiazepine, etc. The above heterocyclic group may be substituted with an oxo or thioxo group.

Preferred heterocyclic groups include

More preferred heterocyclic groups are

It is 14-hexane represented by.

 Among the compounds represented by the general formula (I), preferred compounds are

Is a compound of the formula

And more preferably C ©

It is a compound showing. Of these, compounds in which A is a methylene group or one CO— group are more preferred, and compounds in which A is a —CO— group are most preferred.

Specific compounds include the compounds described in Tables 1 to 8 below, their non-toxic salts, their acid addition salts, their hydrates, and the compounds described in Examples. The specific compounds shown below include isomers generated by the presence of asymmetric carbon, that is, R-form, S-form, and RS-form. In each of the following tables, Me represents a methyl group, and MeO represents a methoxy group.

t

Ksl 1: 2

CO

o

〇 OO 〇 00 CD O OJ CM CM CO CM c in

〇0 1

O

in

[Method for producing the compound of the present invention]

 (a) Among the compounds of the present invention represented by the general formula (I),

Represents a group represented by, wherein 1 ^ 3 is a compound represented by _ (: 0011 group, and A is represented by a —CO— group, that is, a compound represented by the general formula (I-1b)

(Wherein all symbols have the same meanings as described above.) The compound of the present invention represented by the general formula (IV)

Can be produced by subjecting a compound represented by the formula to an oxidation reaction.

 The above oxidation reaction can be carried out, for example, by generally well-known Jones oxidation or the like.

(b) Among the compounds represented by the general formula (I),

Represents a group represented by,

 A compound in which R3 is a —COOR5-1 group (wherein, R5-1 represents c 1-4 alkyl), and A is a —CO— group, that is, a compound represented by the general formula (I—c)

(Wherein all symbols have the same meanings as described above.) The compound of the present invention represented by the general formula (Ib) can be produced by subjecting the compound represented by the general formula (Ib) to an esterification reaction. it can.

 The reaction of converting an acid into an ester (esterification reaction) is known, and for example,

(1) a method using a diazoalkane,

 (2) a method using an alkyl halide,

 (3) a method using dimethylformamidodialkyl acetal,

 (4) Method for reaction with the corresponding alcohol

And the like.

 To explain these reactions specifically,

(1) The method of using diazoalkanes is, for example, using the corresponding diazoalkanes in an inert organic solvent (getyl ether, ethyl acetate, methylene chloride, acetate, methanol, ethanol, etc.) at a temperature of 10 to 40 ° C. At a temperature of (2) The method using an alkyl halide may be performed, for example, in an organic solvent (acetone, dimethylformamide (DMF), N, N-dimethylacetamide, dimethylsulfoxide (DMSO), etc.) in a base (potassium carbonate). , Sodium carbonate, potassium hydrogen carbonate, sodium hydrogen carbonate, etc.) The reaction is carried out at a temperature of 110 ° C to 40 ° C.

 (3) The method using DMF-dialkyl acetal is performed, for example, by using the corresponding DMF-dialkyl acetal in an inert organic solvent (benzene, toluene, etc.) at a temperature of 10 t: up to 40 ° C. It is done in.

 (4) The method of reacting with a corresponding alkanol is, for example, as follows: in a corresponding alkanol, an acid (hydrochloric acid, sulfuric acid, p-toluenesulfonic acid, hydrogen chloride gas, etc.) or a condensing agent (dicyclohexylcarbodiimide) (DCC), Vivaloyl halide, arylsulfonyl halide, alkylsulfonyl halide, etc.).

 Of course, these reactions may be carried out by adding an inert organic solvent which does not participate in the reaction (tetrahydrofuran (THF), methylene chloride, etc.).

 (c) Among the compounds of the present invention represented by the general formula (I),

Represents a group represented by

A compound in which R3 is one COOR5-1 group (wherein, R5-1 represents c1-4 alkyl), and A is a —CO— group, that is, a compound represented by the general formula (1-1)

(Wherein all symbols have the same meanings as described above.) The compound of the present invention represented by the general formula (Y_1)

(Wherein all symbols have the same meanings as described above.) And a compound represented by the general formula (Y-2)

X ¹ ^ COOR ⁵¹ (Y-2)

(Wherein, X 1 represents a halogen atom, and the other symbols have the same meanings as described above.).

When the YH group of the compound represented by the general formula (Y-1) is a —SH group or a 10H group, the reaction is performed using an inert organic solvent (tetrahydrofuran (THF), getyl ether, methylene chloride, chloroform). Mouth form, carbon tetrachloride, pentane, hexane, benzene, toluene, dimethylformamide (DMF), dimethyl sulfoxide (DMSO), hexamethylphosphamide (HMPA), etc., base (hydrogenation) The reaction is performed at 0 to 80 ° C in the presence of sodium, potassium carbonate, triethylamine, pyridine, sodium iodide, cesium carbonate, and the like. When the YH group of the compound represented by the general formula (Y-1) is —NHR ⁷ group, the compound is in an inert organic solvent as described above or in the absence of a solvent, if necessary, in the presence of a tertiary amine such as triethylamine. At 0-80 ° C.

 (d) Among the compounds of the present invention represented by the general formula (I),

Represents a group represented by

A compound in which R 3 is a —CO 0H group and A is a —CO— group, General formula (I-II)

(In the group, all symbols have the same meanings as described above.) The compound represented by the general formula (1-1) can be produced by subjecting the compound represented by the general formula (1-1) to a saponification reaction.

 The saponification reaction is a known reaction, for example, an organic solvent miscible with water.

(THF, dioxane, ethanol, methanol, etc.) in an aqueous solution of an alkali (hydroxide, sodium hydroxide, potassium carbonate, sodium carbonate, etc.).

(e) Among the compounds of the present invention represented by the general formula (I), a compound in which R ³ represents a 1 H-tetrazole-15-yl group and A represents a —CO— group, (I— e)

(Wherein all symbols have the same meanings as described above.) The compound of the present invention represented by the general formula (V)

(Wherein all symbols have the same meanings as described above.)

General formula (VI)

(Wherein all the symbols have the same meanings as described above.).

 The above-mentioned treatment with an alkali is known. For example, an alkali (potassium hydroxide, sodium hydroxide, potassium carbonate, sodium carbonate) in an inert organic solvent miscible with water (such as methanol, ethanol, and dioxane) is used. The reaction is carried out at 0 to 50 ° C using an aqueous solution of

 The reaction of reacting the above cyano group with an azide and leading to a 1 H-tetrazole-5-yl group is known. For example, under an anhydrous condition, an inert organic solvent (dimethylformamide, N-methylpyrrolidone, etc.) This is carried out by heating using azide (sodium azide, lithium azide, potassium azide, etc.) in the presence of a weak acid (eg, pyridium chloride, ammonium chloride, dimethylanilin hydrochloride).

(f) Compounds of the present invention represented by the general formula (I), wherein A is a linear C 1-3 alkylene group and a CH (OH) — group, (I-f)

(Wherein A4 represents a straight-chain C1-3 alkylene group or one CH (OH) group, and other symbols have the same meanings as described above.) The compound of the present invention represented by the general formula described above Compounds represented by (I-b), (I-c), (I-e), (1-1), (I-2), and the general formula (Z)

(In the formula, A ³ represents a straight-chain C 1-2 alkylene group, and other symbols have the same meanings as described above.).

First, a compound in which A ⁴ is a —CH (0H) — group, and a compound in which the corresponding group is a —A 3 —CH (0H) — group (where A 3 has the same meaning as described above). Is obtained by using a known reaction for reducing a carbonyl group to a hydroxyl group. This reaction is performed in a hydrogen atmosphere in an organic solvent (methanol, ethanol, THF, acetic acid, etc.) using a catalyst (palladium carbon, palladium, platinum black, nickel, etc.) at a temperature of 0 to 40 ° C.

Further, Compound A ⁴ is a C 1 to 3 alkylene group, straight chain, a compound having a water group obtained above is obtained by subjecting the further reduction reaction. This reaction For example, using ammonium formate as a hydrogen source, an organic solvent (methanol, ethanol, THF, acetic acid, etc.) and a catalyst (palladium carbon, palladium, platinum black, nickel, etc.) at 40 to 110 ° Performed at a temperature of C.

 (g) Among the compounds represented by the general formula (I),

But 1, 4-Benzojiokisan a ring, and R 3 Gar COOR5- 1 group (wherein, R ⁵ -. ¹ are as defined above), and and C 1 to 3 alkylene A is a linear Or a compound represented by one CO— group, that is, the general formula (I -g)

(Wherein A ⁵ represents a linear C 1-3 alkylene group or a CO— group, and the other symbols have the same meanings as described above.) The compound of the present invention represented by the general formula (VII)

(Wherein all symbols have the same meanings as described above) and a compound represented by the general formula (VIII):

(Wherein, X represents a halogen atom, and other symbols have the same meanings as described above.).

 The above reaction is known, and examples thereof include an inert organic solvent (THF, methyl ether, methylene chloride, chloroform, carbon tetrachloride, pentane, hexane, benzene, toluene, dimethylformamide (DMF), Dimethyl sulfoxide

(DMS0), hexamethylphosphamide (HMPA), acetone, etc.) in the presence of a base (sodium hydride, potassium carbonate, triethylamine, pyridine, sodium iodide, cesium carbonate, etc.) at 0-80 ° Performed in C.

 (h) Among the compounds represented by the general formula (I),

Is a 1,4-benzodioxane, R ³ is one CO 0H group, and A is a linear C 1-3 alkylene group or a CO— group, that is, a compound represented by the general formula (I— h)

(Wherein all symbols have the same meanings as described above.) The compound of the present invention represented by the general formula (Ig) can be produced by subjecting the compound represented by the general formula (Ig) to a saponification reaction. The saponification reaction can be performed in the same manner as described above. (i) Among the compounds of the present invention represented by the general formula (I), those represented by the general formula (I-i)

(Wherein all symbols have the same meanings as described above.) The compound of the present invention represented by the general formula (IX)

(Wherein all symbols have the same meanings as described above.)

General formula (X)

(Wherein all the symbols have the same meanings as described above.).

 The reaction for treating with an alcohol and the reaction for acting on azide can be carried out in the same manner as described above.

 (j) Of the compounds of the present invention represented by the general formula (I),

(Wherein all symbols have the same meanings as described above.) The compound of the present invention represented by the general formula (I_g), (I-h) and (I-i), It can be produced by subjecting a compound represented by the C 0 — group to a reduction reaction. The reduction reaction can be performed in the same manner as described above.

 The general formulas (IV), (Y_l), (Y-2), (V), (VI), (VII), (VIII),

The compounds represented by (IX) and (X) are known compounds per se, or can be produced by known methods or the methods described in Examples.

 The compound represented by the general formula (Z) is a compound known per se, or can be produced by a known method or a method similar to the production methods (a) to (e) described above.

 For example, the compounds represented by the general formulas (IV), (Y-1), (V), (VI), (Z), (VII), (IX) and (X) are obtained by the following reaction schemes 1-1 It can be manufactured by the method indicated by 1. Among them, the compounds represented by the general formula (Z) are represented by the general formulas (Z_l), (Z-2),

The whole of the compounds represented by (Z-3), (Z-4) and (Z-5) corresponds to the compound represented by the general formula (Z). The symbols in each reaction step formula have the following meanings, and the other symbols have the same meanings as described above.

 R 6: General protecting group for hydroxyl group, for example, methoxymethyl group, THP group, acetyl group, etc.

Y a: a hydroxyl group protected with a protecting group for a hydroxyl group (eg, a methoxymethyl group, a THP group, an acetyl group, etc.) or a mercapto group protected with a protecting group for a mercapto group (eg, a methoxymethyl group, a THP group, etc.) An NHR group protected with an amino protecting group (for example, a Boc group) (wherein R ⁷ has the same meaning as described above),

 EDC · HC 1: 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide hydrochloride

 HOB t: 1—hydroxybenzotriazole,

E t ₃ N: triethylamine,

TMSNQ: trimethylsilyl azide.

Reaction process formula 1

 1) Deprotection reaction

2) Oxidation reaction

Reaction process formula 2

Deprotection reaction

Reaction process formula 3

Reaction process formula 4

Oxidation reaction

Reaction process formula 5

(B-5) (Z-1) (Z-2)

Reaction process formula 6

9P

 ¾ ¾

OZSSl / 66 O Reaction process formula 8

Reaction process formula 9

Reaction process formula 10

Reaction process formula 1 1

The starting materials in each reaction scheme are known per se or can be prepared by known methods.

 All reactions in each reaction scheme can be carried out by a known method.

 Further, other starting materials and reagents in the present invention are known per se or can be produced by known methods.

 The compounds described herein are converted to salts by known methods. The salt is preferably non-toxic and water-soluble. Suitable salts include salts of alkali metals (such as potassium and sodium), salts of alkaline earth metals (such as calcium and magnesium), ammonium salts, and pharmaceutically acceptable organic amines (tetramethylammonium). , Triethylamine, methylamine, dimethylamine, cyclopentylamine, benzylamine, phenethylamine, piperidine, monoethanolamine, diethanolamine, tris (hydroxymethyl) amine methane, lysine, arginine, N-methyl-D-glucamine Etc.).

Non-toxic acid addition salts include inorganic salts such as hydrochloride, hydrobromide, sulfate, phosphate, and nitrate, or acetate, lactate, tartrate, oxalate, and fumarate Such as acid, maleate, citrate, benzoate, methanesulfonate, ethanesulfonate, benzenesulfonate, toluenesulfonate, isethonate, glucuronate, gluconate Organic acid salts and the like. The compound of the present invention, a non-toxic salt thereof, or an acid addition salt thereof described herein may be converted into a hydrate by a known method. [Pharmacological activity]

 1) Preparation of luciferase atsushi material using human PPAR7 receptor .

 As a luciferase gene expression vector under the control of the thymidine kinase (TK) promoter, a luciferase structural gene is excised from PicaGene Basic Vector 2 (trade name, Toyo Ink, catalog No. 309-04821) and has a TK promoter. One ρΤΚ? (Clontech, Catalog No. 6179-1), a luciferase gene expression vector p TK—Luc. Under the control of the TK promoter (105 + 51) was prepared as the minimum necessary promoter activity. A response element of Ga14 protein, a yeast basic transcription factor, is inserted upstream of the TK promoter, and an enhancer sequence that repeats UAS four times is inserted into 4 XUAS-TK-Luc. To construct a reporter-gene. And The enhancer sequence (SEQ ID NO: 1) used is shown below. Sequence number 1: Enhancer sequence which repeated Ga14 protein response element

 5'-T (CGACGGAGTACTGTCCTCCG) x4 AGCT-3 'Nuclear receptor human at the carboxyl terminus of the DNA binding region of yeast Ga14 protein

A vector expressing the quinula receptor protein fused with the ligand-binding region of the PPAR7 receptor was constructed as follows. That is, PicaGene Basic Vector 2 (trade name, Toyo Ink Co., Catalog No. 309-04821) was used as a basic expression vector, while the promoter-enhancer region was kept as it was, and the structural gene was replaced with that of the chimeric receptor protein.

The DNA encoding the ligand-binding region of the human PPAR7 receptor is fused downstream of the DNA encoding the amino acid sequence from the 1st to the 147th amino acid sequence of the DNA binding region of the Ga14 protein so that the frame matches. It was inserted downstream of the promoter region of PicaGene Basic Vector 2 (trade name). At this time, the expressed chimera The protein is localized in the nucleus, and the amino terminus of the ligand binding region of the human PPARa receptor has a nuclear translocation signal derived from SV40 T-antigen, A la Pro Lys Lys LysA rg LysVa. l Gly (SEQ ID NO: 2), while at the carboxy terminus, the hemagglutinin epitope of influenza, Ty r Pro Ty rA sp V The DNA sequence was such that alProAspTyrA1a (SEQ ID NO: 3) and a translation stop codon were arranged in this order. The structural gene portion used as the ligand binding region of the human PPARa receptor is described in R. Mukherjee et al. (See J. Steroid Biochem. Molec. Biol., 51, 157 (1994)) and ME Green et al. (Gene Expression, 4). , 281 (1995)), and humans described in Elbrecht et al. (See Biochem Biophys. Res. Commun., 224, 431 (1996) or Schmidt et al. (See Mol. Endocrinology, 6, 1634 ( ¹⁹⁹² )). From the structural comparison of the F PAR receptor, DNA encoding human P PARa ligand binding region: Ser 176—T yr 478 was used, and P PAR ligand binding was used to monitor the effect on basic transcription. An expression vector having a DNA binding region of the Ga14 protein with the region deleted and a DNA encoding the amino acid sequence from the 1st to the 147th position was also prepared.

 2) Luciferase assay using human PPAR7 receptor

 CV-1 cells used as host cells were cultured according to a conventional method. That is, fetal bovine serum (GIBCOBRL, catalog No. 26140-061) was added to Dulbecco's modified Eagle's medium (DMEM) to a final concentration of 10%, and further, a 50 U / m1 final concentration of benicillin was added. The cells were cultured at 37 ° C. in 5% carbon dioxide gas in a medium containing G and 50 gZm1 of streptomycin sulfate.

Introduce both reporter gene and Ga14-PPAR expression vector into host cells. In transfection, seed cells 2 x 106 cells in a 10 cm dish in advance, and use serum After washing once with a medium containing no, 10 ml of the same medium was added. Reporter gene 1 Q _μg , G a 14—P PAR expression 0.5 g of Vector-1 and 50 ^ 1 of LipofectA NE (trade name, GIBCO BRL, catalog No. 18324-012) were mixed well and added to the culture dish. The culture was continued at 37 ° C for 5 to 6 hours, and a medium containing 20 <¾ of dialyzed fetal bovine serum (GIBCO BRL, Kataguchi No. 26300-061) 20 <¾ was added. After overnight culture at 37 ° C, the cells were dispersed by trypsinization and replated on a 96-well plate at a cell density of 8000 cdlsZ 100 ml DMEM_1 0% dialyzed serum Zwdl and incubated for several hours. When the cells were cultured and adhered, 100% of a DMEM-10% dialyzed serum solution of the compound of the present invention containing twice the assay concentration was added. The cells were cultured at 37 ° C for 42 hours to lyse the cells, and the luciferase activity was measured according to a conventional method. In this experiment, the positive control compound troglitazone (Cell,, 863 (1995), Endocrinology, 137.4189 (1996) and J. Med. Chem., 32, 665), which can significantly activate the transcription of the luciferase gene with respect to PPAR7, was used. (See (1996).) Table 9 shows the relative activity of the compound of the present invention when the luciferase activity at the time of adding 10 μM was set to 1.0. In addition, for promising compounds, the reproducibility was examined by performing the test three times, and the presence or absence of dose dependency was confirmed. Table 9

Lowering of blood sugar and blood lipids After receiving C57BL / KsJ-db / db mice (10 mice) at the age of 8 weeks, the animals were pre-bred for 2 weeks and the experiment was started. On the day of the experiment (day 0), blood was collected from the tail vein, grouped based on blood glucose level and body weight, and the compound of the present invention was orally administered once daily for 14 consecutive days from the next day (10 Omg / kgZday ) And blood samples were collected daily (day 4, day 7, day 11, day 15) and blood glucose levels were measured. The results are shown in Table 10. On the last day of the experiment (day 15), whole blood was collected from the abdominal vena cava under ether anesthesia to measure blood lipids (free fatty acid (FFA) and triglyceride (TG)). Table 11 shows the results. Table 10

 Blood sugar level (mg / dl)

0 4 4 7 1 1 1 5 Control 626 ± 58 561 ± 65 570 ± 59 600 ± 69 610 + 67 Manufactured in Example 1

 Compound 624 ± 50 552 ± 107 487 ± 81 521 + 75 513 Sat 83

 (10Omg / ka / day)

Table 11

FFA TG

 (mg / dl) (mg / dl) Control 797 + 201 79 + 28 Manufactured in Example 1

 586 ± 111 42 ± 24 *

Compound p <0.05 vs control (10 per group) Industrial applicability

 [Effect]

 The compounds of the present invention represented by the general formula (I), their non-toxic salts, their acid addition salts, and their hydrates have an effect of controlling PPAR receptors (particularly, PFAR receptor). Has hypoglycemic agents, hypolipidemic agents, diabetes, obesity, syndrome X, hypercholesterolemia, metabolic disorders such as hyperlipoproteinemia, hyperlipidemia, arteriosclerosis, hypertension, circulation It is useful as a prophylactic or therapeutic agent for nervous system diseases, bulimia, ischemic heart disease, etc., an HDL cholesterol-elevating agent, an agent for reducing LDL cholesterol and / or VLDL cholesterol, a risk factor reducing agent for diabetes and syndrome X It is expected to be.

[Toxic]

 The toxicity of the compound of the present invention was sufficiently low, and it was confirmed that the compound was sufficiently safe for use as a pharmaceutical.

[Application to pharmaceutical products]

 In order to use the compound of the present invention represented by the general formula (I), a non-toxic salt thereof, an acid addition salt thereof or a hydrate thereof for the above-mentioned purpose, it is usually required to administer orally or non-systemically or locally. It is administered in oral form.

 The dosage varies depending on the age, body weight, symptoms, therapeutic effect, administration method, treatment time, etc., but it is usually from 1 mg to 1000 mg per adult, once to several times a day. It is orally administered or parenterally (preferably intravenously) once or several times daily, in the range of 1 mg to 100 mg per adult per day. It is continuously administered intravenously for 1 to 24 hours a day.

As mentioned above, the doses to be used depend upon various conditions. Therefore, in some cases in an amount less than the above Symbol dose sufficient, also may be necessary beyond the range Oh O ₀ When the compound of the present invention is administered, it is used as a solid composition, a liquid composition and other compositions for oral administration and as an injection, an external preparation, a suppository and the like for parenteral administration.

 Solid compositions for oral administration include tablets, pills, capsules, powders, granules and the like.

 Force capsules include hard force capsules soft capsules.

 In such a solid composition, the one or more active substances include at least one inert diluent, such as lactose, mannitol, glucose, hydroxypropylcellulose, microcrystalline cellulose. , Starch, polyvinylpyrrolidone, and magnesium aluminate metasilicate. In accordance with the usual practice, the composition may contain additives other than inert diluents, such as lubricants, such as magnesium stearate, disintegrants, such as calcium cellulose glycolate, and stabilizing agents, such as lactose. Agents, solubilizing agents such as glutamate or aspartic acid. The tablets or pills may be coated with a film of a gastric or enteric substance such as sucrose, gelatin, hydroxypropylcellulose, hydroxypropylmethylcellulose phthalate, if necessary, or with two or more layers. Is also good. Also included are absorbable substances such as gelatin.

 Liquid compositions for oral administration include pharmaceutically acceptable emulsions, solutions, syrups, elixirs and the like. In such liquid compositions, one or more active substances are contained in commonly used inert diluents (eg, purified water, ethanol). The composition may contain, in addition to the inert diluent, adjuvants such as wetting agents and suspending agents, sweetening agents, flavoring agents, fragrances, and preservatives.

Other compositions for oral administration include sprays which contain one or more active substances and are formulated in a manner known per se. The composition may contain a buffering agent, other than an inert diluent, to render it isotonic with stabilizers such as sodium bisulfite, such as sodium chloride, sodium citrate or It may contain isotonic agents such as citric acid. The method for producing sprays is described in detail, for example, in US Pat. Nos. 2,868,691 and 3,095,355. Injections for parenteral administration according to the present invention include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Aqueous solutions and suspensions include, for example, distilled water for injection and physiological saline. Examples of the water-insoluble solution and suspension include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, alcohols such as ethanol, and polysorbate 80 (registered trademark). Such compositions may also contain adjuvants such as preservatives, wetting agents, emulsifying agents, dispersing agents, stabilizing agents (eg, lactose), solubilizing agents (eg, glutamic acid, aspartic acid). Is also good. These are sterilized by filtration through a bacteria retention filter, blending of a bactericide or irradiation. They can also be used to produce sterile solid compositions, for example, sterilized or dissolved in sterile distilled water for injection or other solvents before use of the lyophilized product. Other compositions for parenteral administration include external solutions, ointments, salves, suppositories for rectal administration and intravaginal administration, which contain one or more active substances and are formulated in a conventional manner. Includes a pouch for administration. BEST MODE FOR CARRYING OUT THE INVENTION

 Hereinafter, the present invention will be described in detail with reference to Reference Examples and Examples, but the present invention is not limited thereto.

 The solvent in the kakkou indicated by the chromatographic separation and TLC indicates the elution solvent or developing solvent used, and the ratio indicates the # 1 ratio.

 The solvent in the brackets at the NMR indicates the solvent used for the measurement. Participant example 1

1,2-Dimethoxy 3-((1 RS)-1-(4-pentylphenyl) 1 1 -Hydroxymethyl) 1 -5-Methylbenzene

A solution of 4-methyl-1,2-dimethoxybenzene (4.0 g) in tetrahydrofuran (50 ml) was cooled to 178 ° C, and a 1.64 M solution of t-butyllithium in pentane (17.7 ml) was added. The mixture was stirred for 2 hours while the temperature was raised from 78 ° C to 120 ° C. A solution of 4-pentylbenzaldehyde (4.6 g) in tetrahydrofuran (10 ml) was added to the reaction mixture, and the mixture was stirred at room temperature for 30 minutes. 1N Hydrochloric acid was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The extract was washed successively with water and saturated saline, dried over anhydrous magnesium sulfate, and concentrated. The residue was purified by silica gel column chromatography (methylene chloride: ethyl acetate = 40: 1) to give the title compound (4.5 g) having the following physical data.

TLC: Rf 0.67 (methylene chloride: ethyl acetate = 20: 1);

_{NR (CDC1 3): δ 7.30} (2Η, d, J = 8Hz), 7.15 (2H, d, J = 8Hz), 6.80 (1H, s), 6.65 (1H, s), 5.95 (1H, d, J = 6Hz), 3.80 (3H, s), 3.55 (3H, s), 2.90 (1H, d, J = 6Hz), 2.55 (2H, t, J = 7.5Hz), 2.30 (3H, s), 1.60 ( 2H, m), 1.40-1.20 (4H, m), 0.90 (3H, t, J = 6.5Hz). Participant example 2

1, 2-dimethoxy-3- (4-pentylben-5-methylbenzene

Manganese dioxide (5.2 g) was added to a solution of the compound (3.27 g) produced in Reference Example 1 in methylene chloride (60 m 1), and the mixture was stirred at room temperature overnight, and further treated with manganese diacid.

(5.2 g) was stirred at room temperature for 6 hours. The reaction mixture was filtered through celite and concentrated. The residue was purified by silica gel column chromatography (hexane: ethyl acetate = 20: 1) to give the title compound (3.01 g) having the following physical data. TLC: Rf 0.31 (hexane: ethyl acetate = 9: 1);

_{NMR (CDC1 3): δ 7.75} (2Η, d, J = 8Hz), 7.25 (2H, d, J = 8Hz), 6.85 (1H, s), 6.70

(1H, s), 3.90 (3H, s), 3.70 (3H, s), 2.65 (2H, t, J = 7.5Hz), 2.35 (3H, s), 1.65 (2H, m), 1.45-1.20 ( 4H, m), 0.90 (3H, t, J = 7Hz). Participant example 3

 3- (4-pentylbenzoyl) -1-5-methyl-1,2-benzenediol

Boron tribromide (4.7 ml) was added to a solution of the compound (4.07 g) produced in Reference Example 2 in methylene chloride (40 ml) at 0 ° C., and the mixture was stirred for 30 minutes. Ice water was added to the reaction mixture, and the mixture was extracted with ethyl acetate. Wash the extract with water and saturated saline, The extract was dried over magnesium sulfate and concentrated. The residue was purified by silica gel column chromatography (methylene chloride: ethyl acetate = 30: 1) to give the title compound (3.4 g) having the following physical data.

 TLC: Rf 0.63 (methylene chloride: ethyl acetate = 30: 1);

_{NMR (CDC1 3): δ 7.65} (2Η, d, J = 7Hz), 7.30 (2H, d, J = 7Hz), 7.00 (1H, s), 6.95

(1H, s), 5.70 (1H, s), 2.70 (2H, t, J = 7.5Hz), 2.25 (3H, s), 1.70 (2H, m), 1.50-1.20 (4H, m), 0.90 ( 3H, t, J = 7.5Hz). Reference example 4

(3 RS) —3-Cyano 5-(4-pentylbenzoyl) 1 7-methyl '4 1-benzodioxane

and

 (2 R S) —2-cyano-5- (4-pentylbenzoyl) -17-methyl-14-benzodioxane

A mixture of the compound prepared in Reference Example 3 (3.2 g), 2-chloro acrylonitrile (8.5 ml) and potassium carbonate (14.8 g) in acetone (100 ml) was refluxed at 80 ° C for 1 hour. did. The reaction mixture is cooled to room temperature, filtered, and the filtrate is concentrated. Extracted with ethyl acetate. The extract was washed with water and saturated saline in this order and dried over anhydrous magnesium sulfate to give the title compound (3.64 g) as a mixture.

TLC: Rf 0.65 (methylene chloride; ethyl acetate = 40: 1);

_{NMR (CDC1 3): 7.80 (} 2H, m), 7.25 (2H, m), 6.90 (1H, s), 6.85 (1H, m), 5.10 &

5.00 (1H, m), 4.50-4.25 (2H, m), 2.70 (2H, t, J = 7.5Hz), 2.30 (3H, s), 1.65 (2H, m), 1.45-1.20 (4H, m) , 0.90 (3H, t, J = 6.5Hz) _c Examples 1 and 1 (1)

 A solution of the compound (3.64 g) produced in Reference Example 4, sodium azide (3.4 g) and ammonium chloride (2.8 g) in dimethylformamide (25 ml) was stirred at 110 ° C. for 30 minutes. After cooling the reaction mixture to room temperature, 1N hydrochloric acid (200 ml) was added, and the mixture was extracted with ethyl acetate. The extract was washed successively with water and saturated saline, dried over anhydrous magnesium sulfate, and concentrated. The residue was purified by silica gel column chromatography (methylene chloride: methanol = 20: 1) to give the following Example 1 compound (1.74 g) and Example 1 (1) compound (418 mg). Example L

 (3 R S) 3— (1 H—tetrazo-one 5 _yl)

 7-methyl-1,4-benzodioxane

TLC: Rf 0.27 (methylene chloride: methanol = 5: 1);

_{NMR (CDC1 3): δ 7.95} (2Η, d, J = 6.0Hz), 7.35 (2H, d, J = 6.0Hz), 6.80 (1H, s),

6.75 (1H, s), 5.65 (1H, dd, J-2.5, 2.5Hz), 4.90 (IH, dd, J = 11.0, 2.5Hz), 4.75 (1H, dd, J = 11.0, 2.5Hz), 2.75 (2H, t, J = 8.0 Hz), 2.25 (3H, s), 1.70 (2H, m), 1.45-1.25 (4H, m), 0.90 (3H, t, J = 7.0Hz). Muroran example] ()

 (2 R S) 1-2-(1 H-tetrazole-1-5-yl) 1-5-(4-pentyl benzoyl) 1-7-methyl-1, 4-benzodioxane

TLC: Rf 0.19 (methylene chloride: methanol = 5: 1);

NMR (CD ₃ OD): δ 7.65 (2Η, d, J = 8 Hz), 7.25 (2H, d, J = 8 Hz), 7.00 (1H, s), 6.75

(1H, s), 5.65 (IH, m), 4.50-4.30 (2H, m), 2.65 (2H, t, J = 7.5Hz), 2.30 (3H, s), 1.65 (2H, m), 1.45- 1.25 (4H, m), 0.90 (3H, t, J = 6.5Hz). Examples 2 to 2 (6)

 Reference Example 1—Reference Example 2—Reference Example 3 → Reference Example 4 → Performing the same operation as in Example 1 A compound having the following physical property values was obtained.

However, in Examples 2 and 2 (1), 1,2-dimethoxybenzene was used instead of 4-methyl-1,2-dimethoxybenzene in Reference Example 1. In Examples 2 (2) and 2 (3), in Example 1, benzaldehyde was used instead of 4-pentylbenzaldehyde.

 In Examples 2 (4) and 2 (5), 4-methylbenzaldehyde was used instead of 4-pentylbenzaldehyde in Reference Example 1.

 Example 2 (6) is different from Reference Example 1 in that 4-pentylbenzylaldehyde was used instead of 4-pentylbenzaldehyde, and 1,2-dimethoxy was used instead of 4-methyl-1,2_dimethoxybenzene. Benzene was used. Example 2

 (3 RS) — 3— (1 H-tetrazole-1-yl) 1-5— (4-pentylbenzoyl) 1-1,4-benzodioxane

N = N

TLC: Rf 0.30 (methylene chloride: methanol = 5: 1);

_{NMR (CDC1 3): δ 7.87} (2H, d, J = 8.0Hz), 7.31 (2H, d, J = 8.0Hz), 6.92-7.01 (3H, m), 5.69 (1H, dd, J = 3.2, 3.2Hz), 4.68-4.87 (2H, m), 2.70 (2H, t, J = 7.7Hz), 1.57-1.74 (2H, m), 1.32-1.40 (4H, m), 0.90 (3H, t, J = 6.7Hz) ₀

* Example 2 (1) isomer of compound Example 2 (1)

(2 RS) —2— (1 H—tetrazole-5-yl) (4—pentylben — 1, 4-benzodioxane Ήΐ) 19 · '(ZHO'S

'Ρ' Ηΐ) 96'9 '(ω' Η2) ςί'ί-θς-ί '(ui' ΗΙ) 'shi-9' shi '(m' Η) Q shiji-shi Q: (OSMa- ⁹ P) N

 : (T: 0 ΐ: 0 m ΨΠ 14 ΐ £ Ό J¾: 0T1

 SI

^ ^ One 'ΐ one ^ ^

 (Λ (y-^ -Λί- ζ, ^ -H ΐ)-ε- (s Η ε)

° (ΖΗ5'9 = Γ 'ί' Η £) 18Ό 'Η17) Ι £ · Ι- 9Γΐ Ή2) 9 · ΐ -9 · Ι l (zHS

'PP' HI) 6 £ 'S'

'Η £) £ 0 · n -08 · 9

 : (I: 2 = (~ ^ -ί ^^) 8Z / 0: DT

lItO / 86 «If / X3d 0 SI / 66 OM S9

Kuichi)-9-((-ζ- (-^ ^ -u i)-ε-(s H ε)

 ) Z \ m *

° (s ¾ £) then τ '(ZHO ΐ S = f' pp 'HI)' ( ^Ζ Η0ΤΙ '0' £ = f 'PP' Ηΐ) Οζ- '(ΖΗ S' 0 · ε = ί 'PP 'Ηΐ) Ζβ'ζ' (ZHO = ί 'Ρ' HI) 8Ζ 9 '(ZHO = f

'ρ Ήΐ) εο · n' (ω 'ΗΣ :) ς -ί-ςς-L' (ui ¾ε) 09 · Otsun 'n $ ： (oswa- ⁹ Ρ) N

: (I: 01: 0 = 氺: Λ (-^ ^: Ma ^ ψαα4 6ΓΟ J¾ ^: DTX Οΐ

 9-^-. ^ 4-^-Η ΐ)-Ζ- (SH Z) ξ

³ (s ¾ε) ξζτ '( ^Ζ ΗΟ Π'o's = i 'ΡΡ' ΗΪ) IS '(ΖΗΟ''ο · ε = ί' ΡΡ lltO / 86 <ir / X3d 0KSI / 66 OM N = N

TLC: Rf 0.31 (cloth form: methanol: water = 40: 10: 1);

NMR (d ₆ -DMSO): δ 7.63 (2H, d, J = 8.0 Hz), 7.25 (2H, d, J = 8.0 Hz), 6.94 (1H, d,

J = 2.0Hz), 6.71 (IH, d, J = 2.0Hz), 5.79 (1H, dd, J = 3.0, 5.0Hz), 4.60 (IH, dd, J = 3.0, 12.0Hz), 4.51 (IH, dd, J = 5.0, 12.0Hz), 2.36 (3H, s), 2.25 (3H, s).

* Example 2 (5) isomer of compound Example 2 (5)

 (2 RS) —2— (1 H-tetrazole-5-yl) 5-(4-methylbenzyl) 1 7-methyl-1,4-benzodioxane

TLC: Rf 0.19 (form: methanol: water = 40: 10: 1);

NMR (d ₆ -DMSO): δ 7.60 (2Η, d, J = 8.0 Hz), 7.29 (2H, d, J = 8.0 Hz), 7.01 (1H, d,

J = 2.0Hz), 6.74 (1H, d, J = 2.0Hz), 5.91 (IH, dd, J = 3.0, 5.5Hz), 4.50 (IH, dd, J = 3.0, 12.0Hz), 4.38 (1H, dd, J = 5.5, 12.0Hz), 2.38 (3H, s), 2.27 (3H, s).

Example 2 (4) Isomer of Compound Example 2 (6)

 (2 R S) -2-(1 H-tetrazole-1-yl) 5- (2- (4-pentylphenyl) ethyl) 1,4-benzodioxane

and

(3 RS) — 3- (1 H-tetrazole-5-yl) 5- (2- (4-pentylphenyl) ethyl) 1,4-benzodioxane

Mixture of

TLC: Rf 0.60 and 0.51 (methanol: methylene chloride = 1: 4);

NMR (CDCk): δ 7.06 (4Η, m), 6.78 (3H, m), 5.65 and 5.51 (each 1H, each d),

4.58 and 4.57 (each 1H, each t), 4.29 and 4.21 (each 1H, each d), 2.94 and 2.88 (each 4H, each s), 2.55 (2H, m), 1.55 (2H, m), 1.29 (4H , M), 0.86 (3H, m). Room 3 and 3 (1)

To a solution of the compound (1.00 g) prepared in Reference Example 1 in acetic acid (30 ml) was added ammonium formate (192 mg) and palladium on carbon (10 Omg). The mixture was stirred at 100 ° C for 3 hours under a gas stream. The reaction mixture was cooled to room temperature, filtered through celite, and the filtrate was concentrated with toluene. The residue was purified by silica gel column chromatography (hexane: ethyl acetate = 20: 1), and the obtained compound was subjected to the same operation as in Reference Example 3—Reference Example 4—Example 1 to give the following. The compound of Example 3 and the compound of Example 3 (1) were obtained. Example 3

 (2 R S)-2-(1 H-tetrazole-1-5-yl) 15- (4-pentylbenzyl) 17-methyl-1,4-ben '

TLC: Rf 0.27 (methylene chloride: methanol = 10: 1);

_{NMR (CDC1 3): δ 7.09} (4Η, s), 6.63 (1H, br), 6.60 (1H, br), 5.71 (1H, dd, J = 5.8, 2.6Hz), 4.63 (1H, dd, J = 11.8, 2.6Hz), 4.33 (1H, dd, J = 11.8, 5.8Hz), 3.88 (2H, s), 2.56 (2H, t, J = 7.7Hz), 2.21 (3H, s), 1.69-1.49 ( 2H, m), 1.42-1.22 (4H, m), 0.88 (3H, t, J = 6.6Hz) o

3 (1)

(3 RS) — 3— (1 H-tetrazole-1-yl) 5-(4-pentylbenzyl) 1 7-methyl-1,4-benzodioxane

TLC: Rf 0.16 (methylene chloride: methanol = 10: 1);

_{NMR (CDC1 3): δ 7.27-7.14} (4Η, m), 6.74 (IH, br), 6.60 (1H, br), 5.56 (IH, m),

4.53-4.42 (2H, m), 4.04 (IH, d, J = 14.6Hz), 3.83 (1H d, J = 14.6Hz), 2.70-2.50 (2H, m), 2.27 (3H, s), 1.74- 1.48 (2H, m), 1.44-1.20 (4H m), 0.88 (3H, t, J = 6.4Hz). Example 4

 (3 R S) _ 3—ethoxycarbonyl-1 5— (4- ぺ

—Methyl-1,4-benzodioxane

and

(2 RS) 1-2-ethoxycarbonyl-15- (4-pentylbenzoyl) -7-methyl-14-benzodioxane .

脑 I 5

(3 RS) —3-Carboxy-5- (4-pentylbenzoyl) -7-methyl —1,4-benzodioxane

TLC: Rf 0.26 (cloth form: methanol = 9: 1);

NR (d ₆ -DMSO): δ 7.83 (2Η, d, J = 8.0Hz), 7.29 (2H, d, J = 8.0Hz), 6.76 (1H, s),

6.58 (1H, s), 4.25-4.31 (2H, m), 4.14-4.21 (1H, m), 2.63 (2H, t, J = 8.0Hz), 2.20 (3H, s), 1.51-1.68 (2H, m m), 1.23-1.35 (4H, m), 0.87 (3H, t, J = 7.0Hz).

Dragon example 5 (Ί)

 (2 R S) —2-Carboxy-5- (4-pentylbenzoyl) -17-methyl —1,4-benzodioxane

TLC: Rf 0.36 (Form: methanol = 4: 1) NMR (CD3OD): d 7.70 (2H, d, J = 6.0Hz), 7.29 (2H, d, J = 6.0Hz), 6.97 (1H, s),

6.69 (1H, s), 4.92-4.98 (IH, m), 4.16-4.35 (2H, m), 2.64-2.73 (2H, m), 2.31 (3H, s), 1.57-1.73 (2H, m), 1.28-1.39 (4H, m), 0.87-0.97 (3H, m).

 (3 RS) -3— (1H—tetrazoyl 5-yl) 1—5— ((1 RS) 1- (4-pentylphenyl) —1—hydroxymethyl) 1—7—methyl—1 4 Nzodioxane

The compound (54 mg) produced in Example 1 and 10% palladium carbon (5 mg) were added to methanol (5 ml), and the mixture was stirred under a hydrogen atmosphere at room temperature for 3 hours. The reaction mixture was filtered through celite, and the filtrate was concentrated. The residue was purified by silica gel column chromatography (methanol: chloroform = 100: 1) to give the title compound (17 mg) having the following physical data.

TLC: Rf 0.32 (cloth form: methanol: water = 40: 10: 1);

_{NMR (CDC1 3): δ 7.40-7.15} (4Η, m), 6.94 and 6.61 (IH, d, J = 1.5Hz), 6.64 and

6.37 (1H, d, J = 1.5Hz), 6.23 and 6.00 (IH, s), 5.68 and 5.48 (1H, t, J = 3.5Hz), 4.70-4.40 (2H, m), 2.65 and 2.61 (2H, t, J = 7.5Hz), 2.25 and 2.12 (3H, s), 1.75-1.15 (6H, m), 0.90 and 0.88 (3H, t, J = 6.5Hz) ₀ Example? ~ 7 (2)

 Reference Example 1—Reference Example 2—Reference Example 3—Reference Example 4—The same operation as in Example 1 was performed to obtain a compound having the following physical property values.

 However, in Example 7, 4-methyl-1-methoxybenzene was used in place of 4-methyl-1,2-dimethoxybenzene in Reference Example 1.

 In Example 7 (1), 4-methyl-1,1-methoxybenzene was used instead of 4-methyl-1,2-dimethoxybenzene in Reference Example 1.

 In Example 7 (2), 4-t-l-butyl) 1-methoxybenzene was used in place of 4-methyl-1,2-dimethoxybenzene in Reference Example 1.卖 Example 7

 4-methyl-2- (4- 4 (1 H-tetrazole

5-yl) methoxybenzene

TLC: Rf 0.58 (cloth form: methanol: water = 40: 10: 1);

_{NMR (CDC1 3): S 7.82} (2H, d, J = 8.0Hz), 7.32 (2H, d, J = 8.0Hz), 7.29 (1H, dd, J = 1.5, 8.5Hz), 7.16 (1H, d , J = 1.5Hz), 7.08 (1H, d, J = 8.5Hz), 5.62 (2H, s), 2.70 (2H, t, J = 7.5Hz), 2.30 (3H, s), 1.75-1.50 (2H , m), 1.45-1.20 (4H, m), 0.90 (3H, t, J = 7.5Hz). PL

0 £ 'L-OVL' (ΖΗ0 ・ 6 'S = ί' PP 'Ηΐ)' '(ΖΗ 8 = ί' Ρ 'Η ^) §-(% XD) Ν

 : (Τ: 0 ΐ: 0 0 1 = 氺: Λί-r ^ ^: Ma ^ αα) 0: o: TI

— /, ^ 4 one Η —) — I— ((

-

° (ΖΗOtsu = ί Ή Ή £) Ϊ6Ό '(' Hf) ΟΓΙ ΟΓΙ ΐ,) 9 9 ΐ '(ZHS = ί Οΐ 1 Ήζ)''(s Ή3) 9'ξ

'Ρ' ΗΖ) '(ζΗΟε = ί' Ρ

'Ηΐ) 9VL' (ΖΗ0'6 '0 · ε = ί' ΡΡ Ήΐ) VL 'Η 8 = ί' Ρ 'Η) Z ^ L §: (¾ΧΙ) ΉΙΛίΝ

 : (Ϊ́: 0 ΐ: 0 0 1 = 氺: (-^ ≠: Ma ^ ψαα ^ ςεΌ J¾: CTLL

IItO / 86 <If / X3 <i OZSSI / 66 OM 0

 ° (ΖΗ Otsu = ί 'J' Η £) 68Ό

 '') ori-s i 'Ή) Z9'i ^ L = i Ί ¾) 99'z' (s Ήε) 6Γε Ήε)

8 'ε' (s 'ΗΖ) 6.9' (ΖΗΟε = ί 'Ρ' Ηΐ) 88 "9 'ΗΟ'ε '06 = ί' ΡΡ 'Ηΐ) O 6.9' ^Ζ Η0'6 = Γ 'Ρ' Ηΐ) Ρΐ'ί 'ΗΖ) 9fL §: (¾XD) ¾ΡΜΝ

： 8 Ό m-Dll 51 — 士 α 一 ΐ 16j

-ヽ Λ¾¾ 3 ^ χ ^^^ 4 S— ー S

 Οι. ^ A> A ^ x ^ —, Λ ^ Γ I Γι, one? . House! ^ 呦 ^^ 篛 篛 2 · 单 ¾ 呦 ¾ 呦

^

 ς

° (ΖΗ = = Ί 'Η £) Ϊ6Ό'(s' Η6) LZ \ 'Ή ^) ΟΖ -ξΥΙ'('ΗΖ)99'ΐ' (ΖΗn = ί Ί 'Η) \ LZ' (s 'ΗΖ) £ 9 "5' (ζΗ0 · 6 = ί 'Ρ' ΗΤ) WL '(ω' Η £) 0 / 86dfAl d 0ZSSI / 66 ΟΛ \

To a solution of the compound (2.03 g) prepared in Reference Example 5 in methylene chloride (10 ml) was added HC1 (4.0 M dioxane solution, 3.0 ml) at 0 ° C. After stirring at room temperature for 1 hour, the solvent was removed under reduced pressure to give the title compound (1.76 g) having the following physical data. TLC: Rf 0.48 (ethyl acetate: hexane = 1: 1 0);

_{NMR (CDC1 3): $ 11.58} (1H, s), 7.64 (2H, d, J = 8.0Hz), 7.31 (2H, d, J = 8.0Hz),

7.20-7.10 (2H, m), 7.01 (1H, dd, J = 1.0, 8.5Hz), 3.72 (3H, s), 2.70 (2H, t, J = 7.5Hz), 1.65 (2H, m), 1.45 -1.30 (4H, m), 0.91 (3H, t, J = 7.5Hz).

Example 8

 4-Methoxy 2 _ (4- ぺ (1 H-tetrazole-5-yl) methoxybenzene

The same operation as in Reference Example 4—Example 1 was performed using the compound produced in Reference Example 6, to give the title compound having the following physical data.

TLC: Rf 0.58 (black mouth form: methanol: water = 40: 10: 1); NMR (CDCI3): δ 7.85 (2H, d, J = 8.0Hz), 7.33 (2H, d, J = 8.0Hz), 7.13 (1H, d,

J = 9.0Hz), 7.02 (1H, dd, J = 3.0, 9.0Hz), 6.88 (1H, d, J = 3.0Hz), 5.61 (2H, s), 3.76 (3H, s), 2.71 (2H, t, J = 7.5Hz), 1.64 (2H, m), 1.45-1.25 (4H, m), 0.90 (3H, t, J = 7.5Hz).

Example 9

 2- (4-Methoxyben-1-yl-1- (1-H-tetrazole-5-yl) methoxybenzene

2- (4-Methoxybenzoyl) -1-Methylphenol (SPECS and BioSPECS BV, Catalog No. CIF6153) Reference Example 4—The same operation as in Example 1 was performed, and the title having the following physical property values was obtained. The compound was obtained.

TTLC: Rf 0.34 (cloth form: methanol: water = 100: 10: 1);

_{NMR (CDC1 3): δ 7.91} (2Η, d, J = 9.0Hz), 7.27 (1H, m), 7. 13 (1H, d, J = 1.5Hz),

7.09 (1H, d, J = 8.5Hz), 6.99 (2H, d, J = 9.0Hz), 5.65 (2H, s), 3.92 (3H, s), 2.31 (3H, s). Example 10

4-Methyl-1- (4-pentylbenzoyl) phenoxyacetic acid

Reference Example 1 → Reference Example 2—Reference Example 3—Example 4—Operations similar to those in Example 5 were performed to obtain the title compound having the following physical property values. However, in Reference Example 1, 4-methyl-11-methoxybenzene was used in place of 4-methyl-1,2-dimethoxybenzene.

 TLC: Rf 0.52 (cloth form: methanol: water = 40: 10: 1);

NR (d ₆ -DMSO): δ 7.73 (2Η, d, J = 8.5Hz), 7.28 (2H, d, J = 8.5Hz), 7.19 (1H, dd,

J = 2.0, 8.5Hz), 7.03 (1H, d, J = 2.0Hz), 6.84 (1H, d, J = 8.5Hz), 4.27 (2H, s), 2.61 (2H, t, J = 7.5Hz) , 2.24 (3H, s), 1.70-1.45 (2H, m), 1.40-1.15 (4H, m), 0.85 (3H, t, J = 7.5Hz) ₀

[Formulation example]

Transliteration 1 1

 The following components were mixed in a conventional manner and then tableted to give 100 tablets each containing 100 mg of the active ingredient.

 • (3 R S) — 3 — (1 H—tetrazol-5-yl)-1 5 — (4-pentylbenzoyl) 1 7-methyl- 1, 4-benzodioxane (prepared in Example 1)

 …… 10.0 g 'Calcium fibrin glycolate (disintegrant) …… 0.2 g

• Magnesium stearate (lubricant) 0.1 g

'Microcrystalline cellulose …… 9.7 g After mixing the following components by the usual method, the solution is sterilized by the conventional method, filled into ampoules in 5 ml portions, freeze-dried by the conventional method, and an ampoule containing 20 mg of the active ingredient in one ampule I got 100.

 • (3 RS) — 3— (1 H—Tetrazol-1-5-yl) 1-5— (4-pentylbenzoyl) 17-methyl-1,4-benzodioxane (prepared in Example 1)

 …… 2 g

'Mannit 5 g

-Distilled water …… 1000 ml

Claims

The scope of the claims

 1.-General formula (I)

0)

(Wherein, R 1 and R 2 each independently represent a hydrogen atom, a Cl-8 alkyl group, a Cl-4 alkoxy group, a halogen atom, a nitro group, or a trifluoromethyl group;

 (In each formula, A represents a linear C 1-3 alkylene group, a C O— group or a —CH (OH) — group;

^1-3 represent _ (001-5 groups (wherein, R ⁵ represents a hydrogen atom or a C 1-4 alkyl group)) or 1 H-tetrazole-15-yl group;

C © is

 1) 8 to: L 1-membered saturated or unsaturated bicyclic carbocyclic group, or

 2) a saturated or unsaturated 8- to 11-membered bicyclic heterocyclic group containing 1 to 3 heteroatoms selected from a sulfur atom, an oxygen atom and or a nitrogen atom (this ring is further oxo , May be substituted with a thioxo group.)

Y represents one 0—, one S— or one NR7— group (wherein, R7 is a hydrogen atom or C 1-

4 represents an alkyl group. ). ) Represents a group represented by )

Or non-condensed benzene compounds, their non-toxic salts, their acids Addition salts or their hydrates _c

Two

C © is

The compound _{c according to} claim 1, which is

But

3. The compound according to claim 1 or 2, wherein

4. The compound according to claim 1, 2 or 3, wherein A is a methylene group or a CO— group.

5. The compound

 1) (3 RS 3-(1 H-tetrazole-1-yl) — 5— (4-diene

 7-methyl-1,4-benzodioxane

 2) (2 R S 2-(1 H-tetrazol _5_yl)-5-(4-pentylbenzoyl 7-methyl-1,4-benzodioxane

 3) (3 RS 3-(1 H—tetrazol-1-5-yl)-5-(4—pen

 1,4 benzodioxane,

 4) (2 R S 2— (1 H-tetrazole-5-yl)-5-(4-pentylbenzoyl) 1, 4

5) (3 RS 3— (1 H—tetrazoyl 5-yl) -5-benzoyl-7-methyl-14 6) (2 RS) -2-(1 H-tetrazole-5-yl) -1-5-benzoyl — 7-methyl-1, 4-benzodioxane,

 7) (3 RS) -3--(1H-tetrazol-l-5-yl) -l 5- (4-methylbenzoyl) -l 7-methyl-l, 4-benzodioxane,

8) (2 R S) -2-(1 H-tetrazole-5-yl) 1-5- (4-methylbenzoyl) 1 7-methyl-1,4, benzodioxane,

 9) (2 R S) -2-(1 H-tetrazole-1-5-yl) 1 5-(2-(4 -pentylphenyl) ethyl) 1, 4 -benzodioxane,

 1 0) (3 RS) — 3— (1 H-tetrazole-5-yl) _5 _ (2- (4-pentylphenyl) ethyl) 1,1,4-benzodioxane,

 1 1) (2 R S) -2-(1 H-tetrazole-1-yl) 1-5- (4-pentylbenzyl) 1 7-methyl-1,4-benzodioxane,

 1 2) (3 R S) —3— (1 H—tetrazoyl 5-yl) 1-5— (4-pentylbenzyl) 1 7-methyl-1,4-benzodioxane,

1 3) (3 R S) — 3-ethoxycarbonyl-5- (4-pentylbenzoyl) -17-methyl-1,4-benzodioxane,

 1 4) (2 R S) — 2-ethoxycarbonyl-1-5- (4-pentylbenzoyl) -17-methyl-1,4-benzodioxane,

 1 5) (3 R S) —3—carboxy-5- (4-pentylbenzoyl) -17—methyl-1,4-benzodioxane,

 1 6) (2 R S) —2—carboxy-5- (4-pentylbenzoyl) -17—methyl-1,4-benzodioxane, or

 1 7) (3 RS) —3— (1 H-tetrazole-5-yl) 1-5— ((1 RS) -1-(4-pentylphenyl) 1 1-hydroxymethyl) 1 7-methyl _1, 4—benzodioxane or

4. The compound according to claim 1, 2 or 3, which is a non-toxic salt thereof, an acid addition salt thereof, or a hydrate thereof.

 (In the formula, all symbols have the same meaning as described in Claim 1.)

2. The non-condensed benzene compound according to claim 1, which is a group represented by the formula:

7. The compound

 1) 4-Methyl-1- (4-pentylbenzoyl) 1-1- (1H-tetrazol-1-yl) methoxybenzene,

 2) 4-chloro-2--1- (4-pentylbenzoyl) 1-1-1 (1H-tetrazole-15-yl) methoxybenzene,

 3) 4-t-butyl-1- (4-pentylbenzoyl) 1-1- (1H-tetrazol-15-yl) methoxybenzene,

 4) 4-Methoxy-1- (4-pentylbenzoyl) -1-1 (1H-tetrazole-5_yl) methoxybenzene,

5) 2- (4-Methoxybenzoyl) -14-methyl-1-11 (1H-tetrazole-15-yl) methoxybenzene or

 6) The compound according to claim 1, which is 4-methyl-2- (4-pentylbenzoyl) phenoxyacetic acid or a non-toxic salt thereof, an acid addition salt thereof, or a hydrate thereof.

8. A peroxisome proliferator-activated receptor containing, as an active ingredient, a compound represented by the general formula (I) according to claim 1, a non-toxic salt thereof, an acid addition salt thereof, or a hydrate thereof. Control agents. 9. Compounds of general formula (I), their non-toxic salts, their acid-force tl salts, Or hypoglycemic agents, lipid-lowering agents, or diabetes, obesity, syndrome X, hypercholesterolemia, metabolic disorders, hyperlipidemia, arteriosclerosis, hypertension, An agent for preventing or treating cardiovascular disease, bulimia, ischemic heart disease, an agent for increasing HDL cholesterol, an agent for decreasing LDL cholesterol and Z or VLD L cholesterol, an agent for reducing the risk factor for diabetes or syndrome X.

10. The peroxisome proliferative activity according to claim 8, which comprises a compound represented by the general formula (I), a non-toxic salt thereof, an acid addition salt thereof, or a hydrate thereof as an active ingredient. Chemical receptor controlling agent.

11. The hypoglycemic agent or lipid-lowering agent according to claim 9, comprising a compound represented by the general formula (I), a non-toxic salt thereof, an acid addition salt thereof, or a hydrate thereof as an active ingredient.