WO1994017203A1

WO1994017203A1 - Amplified dna fingerprinting method for detecting genomic variation

Info

Publication number: WO1994017203A1
Application number: PCT/CA1994/000033
Authority: WO
Inventors: Dennis Kunimoto; Prasit Palittapongarnpim
Original assignee: The Governors Of The University Of Alberta
Priority date: 1993-01-29
Filing date: 1994-01-24
Publication date: 1994-08-04
Also published as: AU5877194A; GB9301776D0

Abstract

A method is provided for identifying an individual member or a strain of a species of an organism comprising amplifying at least one flanking sequence adjacent to a repeated sequence in the DNA of the member or strain and differentiating the amplified flanking sequences on the basis of their relative size so as to characterise an individual member or strain of the species.

Description

AMPLIFIED DNA FINGERPRINTING METHOD FOR DETECTING GENOMIC VARIATION

This invention relates to a new method for detecting genomic variation. It is generally applicable to any genome or any DNA sequence which has multiple copies of an insertion sequence or other repetitive sequence.

The invention provides a new ligation-mediated method for PCR amplification of the DNA sequences flanking an insertion sequence. The invention further provides a new rapid method for preparing DNA fingerprints which permit detection of genomic variation and provide evidence of relatedness or unrelatedness between individuals or strains within a species.

BACKGROUND OF THE INVENTION

The detection of genomic variation within a species has proved to be a powerful tool in areas as diverse as forensic science and epidemiology and microbiology.

Both for epidemiological studies and for purposes of disease containment, the ability to identify particular strains of microorganisms and to prove their paths of transmission is extremely important.

Until recently, phage typing or serotyping were the only methods available for strain identification. These methods are time-consuming and hampered by an inability to distinguish more than a limited number of strains.

Repeated nucleotide sequences have been found in the genomes of many types of organism. The heterogeneity or polymorphism of the DNA sequences which flank these repeated or insertion sequences has been captured by probing Southern blots of restriction digested genomic DNA with insertion sequence probes to give DNA "fingerprints", distinctive patterns based on the length of restriction fragments containing the target IS. This method is known as restriction fragment length polymorphism (RFLP) .

RFLP has been applied to epidemiological studies of many microorganisms. For example, strain identification of M. tuberculosis has been performed by Southern blots of restriction digested chromosomal DNA with IS986 or IS6110 to detect RFLPs (Hermans, P. .M. et al; (1990), J. Clin. Microbiol. , vol. 28, pp. 2051-2058; Masurek, G.H. et al; (1991), J. Clin. Microbiol., vol. 29, pp. 2030-2033).

RFLP methods are, however, very laborious with an organism such as M. tuberculosis, in which purification of the required amount of DNA is notoriously difficult and such methods are not suitable for clinical diagnosis.

Clinical diagnosis of tuberculosis continues to depend on culture of M. tuberculosis from sputum or infected tissue, with an undesirable delay of two to six weeks to obtain results, even with the best methodology. Eisenach, K.D. et al., (1990), J. Infec. Dis. , vol. 161, pp. 977-981, has reported use of polymerase chain reaction (PCR) amplification of a portion of the insertion sequence IS6110 of M. tuberculosis as a means of detecting the presence of M. tuberculosis. As all strains of the organism contain IS 6110, this offers no means of distinguishing and identifying individual strains of the organism.

Such strain identification is important both epide iologically, and also clinically, for identification of particular drug resistant strains.

Prior to the work of the present inventors, there was a need for a rapid and convenient method for distinguishing and identifying different strains of M^_ tuberculosis. SUMMARY OF THE INVENTION

In accordance with one aspect of the invention, a method is provided for identifying an individual member or a strain of a species of organism having within its DNA at least one repeated nucleotide sequence, each repeat of the repeated nucleoside sequence having a first upstream flanking sequence and a second downstream flanking sequence and the flanking sequences being polymorphic. The method comprises (i) amplifying at least said first flanking sequences or said second flanking sequences by ligation-mediated polymerase chain reaction and (ii) differentiating the amplified flanking sequences on the basis of their relative size so as to characterise an individual member or strain of the species.

In accordance with a further aspect of the invention, an isolated DNA molecule is provided having the formula 5'OH-CCTTTCCAAGAACTGGAGTC-OH

3-OH-GGAAAGGTTCTTGACCTCAGCTAG-OH.

In accordance with a further aspect of the invention, an isolated DNA molecule is provided having the formula

5•CGGACTCACCGGGGCGGTTC

5•CCTTTCCAAGAACTGGAGTC

In accordance with a further aspect of the invention, a method is provided for amplifying a portion of a DNA fragment having a known nucleotide sequence from the known nucleotide sequence to an unknown nucleotide sequence comprising (a) subjecting the DNA fragment to digestion by a restriction endonuclease to give restriction fragments having cohesive ends;

(b) contacting the restriction fragments with a non-phosphorylated linker having cohesive ends and ligating a linker strand to the restriction fragments to provide an amplification site;

(c) denaturing the restriction fragments to give single stranded fragments and contacting the single stranded fragments under hybridising conditions with a first oligonucleotide primer complementary to the ligated linker strand and a second oligonucleotide primer complimentary to at least a portion of one strand of the repeated nucleotide sequence;

(d) subjecting the restriction fragments to a selected number of cycles of amplification by polymerase chain reaction so as to amplify the portion of the repeated nucleotide sequence along with its adjacent flanking sequence.

SUMMARY OF THE DRAWINGS

Certain embodiments of the invention are described, reference being made to the accompanying drawings, wherein:

Figure l shows in schematic form the amplification technique employed in one embodiment of the invention. Panel a shows the fate of a Bcrl II restriction fragment containing an insertion sequence (IS 6110) during the amplification process. The insertion sequence IS6110 is represented by the dark grey area and the linker is represented in light grey. The primers are represented by horizontal arrows. Panel b shows the fate of a Bql II restriction fragment which does not contain an IS when the method is applied. Panel c shows the sequence of one linker fragment of the invention (5¹ strand: Sequence ID No: 1; 3 • strand Sequence ID No: 2) and of primers dku 53 (Sequence ID No: 3) and dku 55

(Sequence ID No: 4) .

Figure 2 shows DNA fingerprinting patterns obtained by the method of the invention. Lane 1 - molecular weight marker (replicative form of øxl74 digested with Hae III) .

Lane 2 - M. tuberculosis, strain H37Ra.

Lane 3 - M. tuberculosis, strain H37Rv.

Lanes 4 -11 - clinical isolates of M. tuberculosis. Figure 3 shows RFLP patterns obtained from the samples of Figure 2. Hybridising probe was IS 6110. The two left hand lanes were reference strains H37Ra and

H37Rv. Lanes marked 7, 13, 14, 16, 17, 18, 15 and 27 were the clinical isolates of Figure 2, lanes 4, 5, 6, 7, 8, 9, 10 and 11.

Figure 4 shows DNA fingerprinting patterns obtained by the method of the invention with varying amounts of DNA.

Lanes 1 and 9 - molecular weight markers Lanes 2 to 8 - 0.06, 0.12, 0.25, 0.5, 1.0, 2.0 and 4.0 nanograms DNA respectively.

Figure 5 shows DNA fingerprints obtained from organisms cultured for different time periods.

Lane 1 - molecular weight markers Lanes 2a & 2b to 9a & 9b - 8 clinical isolates cultured

(a) to growth index 100 or less and (b) to growth index greater than 999.

DETAILED SUMMARY OF THE INVENTION The use of RFLP-based techniques for detection of genomic variation has been limited by the need to isolate large enough quantities of the relevant DNA fragments.

In accordance with one embodiment of the present invention, the inventors have devised a new method for detecting genomic variation and identifying individual members or strains within a species comprising amplification of the polymorphic sequences flanking a repeated or insertion sequences by ligation-mediation PCR followed by differentiation of the amplified flanking sequences on the basis of their relative size. Amplification of the flanking DNA sequences adjacent to insertion sequences (IS) has to be achieved without knowledge of their nucleotide sequences.

Blunt end ligation-mediated polymerase chain reaction (LMPCR) has been described for amplification of DNA fragments between a known and an unknown sequence

(Mueller, P.R. et al., (1989), Science, v. 246, pp. 780-

786; Pfeiffer, G.P. et al. , (1989), Science, v. 246, pp.

810-812) , for the purpose of sequencing genomic DNA.

Such blunt end ligation, however, is low efficiency and is not likely to be satisfactory as the basis of production of reproducible patterns for strain discrimination.

Furthermore, a blunt end ligation-based method is subject to artefacts if applied to DNA which has been subject to shearing during isolation, as is the case, for example, in isolation of DNA from an organism such as M. tuberculosis which has tough cell walls.

In accordance with a further aspect of the invention, a new cohesive end ligation-mediated PCR method is provided for amplifying a DNA fragment between a known nucleotide sequence and an unknown nucleotide sequence.

The method of the invention will be described with reference to a preferred embodiment comprising a method for identifying individual members or strains of the species M. tuberculosis.

It will be understood by those skilled in the art, however, that the method of the invention is equally applicable to detection of genomic variation, identification of individual members or strains of, other species, including other species of mycobacteria and species of viruses, bacteria, fungi, algae, plants and animals, provided there is a repeated sequence within its DNA.

Creation of appropriate linkers and primers for application of the method of the invention to such other species can be performed by those skilled in the art with the guidance of the description of linkers and primers herein.

In accordance with a preferred embodiment of the invention, a method is provided for amplifying the flanking sequences on each side of a selected IS, IS

6110, of the M. tuberculosis genome, and differentiating the amplified flanking sequences by gel electrophoresis to give a DNA fingerprint characteristic of the strain of the organism from which DNA was taken for analysis. The amplification step is shown schematically in Figure 1, panels a and b. DNA was isolated from the strain to be identified by conventional methods and digested with a restriction endonuclease to give restriction fragments with cohesive ends. A restriction enzyme which gives fragments of less than 1-2 kb is preferred, for example Bαlll. BamHI or Bell. A linker of the following sequence: 5OH-CCTTTCCAAGAACTGGAGTC-OH 3'OH-GGAAAGGTTCTTGACCTCAGCTAG-OH

was added by cohesive end ligation to the restriction fragments using a DNA ligase such as T4 DNA ligase, as shown in Figure 1, to provide one priming site for amplification. As the linker was non-phosphorylated, only the shorter linker nucleotide strand was ligated to the restriction fragments. The longer linker strand, being non-phosphorylated, was not ligated and did not act as a PCR priming site. The linker was designed so that neither BamHI or Bglll could digest the ligated products. Removal of the restriction enzyme used for digestion was, therefore, unnecessary. After ligation, the mixture was heated to 94°C to denature the DNA fragments, primers and PCR reagents were added and amplification was carried out for 25 to 30 cycles under conventional PCR conditions, (for example, as described by Innes, M.A. and Gelfand, D.H., (1990), in "PCR protocols, methods and applications", Chapter 1). The following primers were used; dku53 5•CGGACTCACCGGGGCGGTTC dku55 5'CCTTTCCAAGAACTGGAGTC

The primers are complementary to the 5' terminal sequences of the two strands of IS 6110. Primer dku55 is identical in sequence to the shorter strand of the linker. As the linker priming site is identical to one of the two IS priming sites, this strategy allows the method of the invention to be practised using two primers, rather than three primers as required by previously described methods. As will be understood by those skilled in the art, the linker need not have the same sequence as one of the insertion sequence primers. Furthermore, the insertion sequence primers may be complementary to any selected portions of the IS and need not be complementary to the terminal portions. Likewise, any repeated sequence within the M. tuberculosis genome could be used as the known sequence priming site for flanking sequence amplification.

As will be understood by those skilled in the art, other nucleotide sequences may be used as linkers in this embodiment of the method of the invention. The linker sequence should be selected to be a sequence not occurring more frequently than in about one or two copies in the genome being analysed. The linker should have cohesive ends and preferably the ligated restriction fragment should not contain a site attacked by the restriction enzyme employed. One might have expected that the linker would be ligated to both ends of all fragments, producing a smear after PCR. The linker was, however, devised without phosphorylation, so that the longer linker strand did not become ligated to the genomic DNA and therefore did not act as a PCR priming site for the dku55 primer.

Due to the choice of primers, only restriction fragments containing the IS are amplified, as illustrated in Figure 1, panel a. As seen in Figure 1, panel b, fragments not containing the IS are not amplified.

As will be understood by those skilled in the art, amplification of only one flanking sequence adjacent to an IS may also be employed, by two using primers, one complementary to the linker priming site and one complementary to the insertion sequence.

After amplification, the amplified flanking sequences were separated by agarose gel electrophoresis and visualised by ethidium bromide staining. Any suitable visualisation method may be employed, including primer labelling with colorimetric or radiometric detection.

Alternatively, the amplified flanking sequences may be separated on the basis of relative size in a DNA sequencer such as a Model 362 gene scanner (Applied Biosystems Inc.), with detection of a fluorescent tag on the primer giving an array of peaks which can be converted into a suitable visual signal.

Reference strains of M. tuberculosis and clinical isolates of that organism have been examined by the method of the invention, as described in Example 1. The two closely related reference strains, H37Rv and H37Ra, gave similar but distinct banding patterns, as seen in Figure 2, lanes 2 and 3.

A round two hundred isolates have been examined and the inventors have shown that M. tuberculosis isolates from different case clusters or solitary cases gave different banding patterns by the method of the invention, whereas isolates from the same case cluster typically gave the same banding patter. For example, the samples in Lanes 10 and 11, Figure 2, were isolated from a baby and his mother and show identical patterns. Lanes 4 to 9 show samples isolated from unrelated cases and show widely varying patterns.

For comparison, RFLP patterns of one hundred clinical isolates already examined by the method of the invention were examined by Southern blotting and probing with a BamHI-Sall fragment of pDC 73, which contains a part of the IS 6110 sequence (Masurek supra) .

All strains found to give identical banding patterns with the method of the invention gave identical banding patterns with RFLP, and all strains found to give different banding patterns with the method of the invention gave different banding patterns by RFLP.

Figure 3 shows the RFLP banding patterns of the isolates examined in Figure 2. Lanes 15 and 27 of Figure 3, the isolates from baby and mother, again shown identical banding patterns.

RFLP analysis of M. tuberculosis takes 48 to 72 hours, whereas the method the invention requires less than 24 hours. The method of the invention is reproducible over a wide range of DNA concentrations, as seen in Figure 4 which shows banding patterns with from 0.06 to 4 nanograms of DAN. In contrast, RFLP requires l μg of DNA.

The improved speed and sensitivity of the method of the invention offer great advantages, particularly in a clinical setting.

A further indication of the sensitivity of the method of the invention is provided by Example 4. Eight clinical isolates of M. tuberculosis were cultured and DNA was extracted, amplified by the method of the invention. Replicates of the same eight isolates were grown to a growth index of 100 or less and similarly treated. The paired DNA samples were examined on agarose gel, as seen in Figure 5.

In each case, an identical pattern was obtained with the short term culture sample, with a saving of one to two weeks.

The short term cultures contain approximately 10,000 organisms per ml, which approximates the concentration of organisms which would be expected in a smear positive sputum sample. This indicates that the sensitivity of the method of the invention is sufficient to permit application of the method directly to sputum or tissue samples, or extracts of these, without prior culturing of the organisms.

Direct strain identification of M. tuberculosis on sputum or tissue samples without culture would further speed up the identification of the disease. The improved speed of identification provided by the method of the invention will also be invaluable in situation involving multi-drug resistant tuberculosis, which are an increasing and worrisome problem. It is now possible to show that a particular strain of M. tuberculosis is identical to a previously isolated and known multi- resistant strain days or even weeks before this could be determined by traditional sensitivity studies. The method of the invention is also technically superior to previous methods for strain identification as DNA purification after restriction digestion or ligation is not required by the method of the invention, due to the unique linker and primers devised. The method also tolerates greater DNA shearing than Southern blotting and hybridisation.

Example 1

Sputum samples were cultured by conventional techniques to a growth index greater than 999 (Morgan et al., (1983), J. Clin. Microbiol., v. 18, pp. 384-388). DNA was extracted by the following method. Mycobacteria were transferred into polypropylene tubes with siliconized glass beads and vortexed vigorously for 6-10 minutes. 600 μl of TE buffer was added and mixed. 1 ml of phenol was added for both killing the bacteria and purification of the DNA. Centrifuged for 1 minute at 3000 rp . Supernatant was transferred to a microfuge tube and centrifuged again for 10 minutes at 13000 rpm. Aqueous layer transferred to a new microfuge tube and equal volume of phenol added. Mixed well and centrifuged again for 6 minutes at 10000 rpm.

Aqueous phase was re-extracted 3-5 times with 1:1 phenol-chloroform mixture. After the interphase was clear, extracted once with chloroform. Two volumes of -20°C absolute ethanol were added and mixture stored in freezer for at least 30 min. Centrifuged for 10 minutes at 13000 rpm. Supernatant was drained off and pellet dried in the Speed Vac or on the bench.

100 μl of TE added and incubated for 30 min in a 30°C water bath. Centrifuged for 10 minutes at 13000 rpm. If any undissolved pellets, supernatant transferred to a new tube. 1 μl of RNase added. Incubated in a 37°C water bath for 1 hour. DNA solution heated in a 65°C water bath for 15 minutes to destroy any contaminating DNAse. The DNA sample may be stored in the fridge for several months. DNA concentration determined by OD 260/280 (2.5 μl in 500 ml H₂0) .

DNA samples were diluted to a concentration of 20 ng/μl and 100 ng DNA was digested with 20 units of BamHI per μg of DNA in M buffer (Boehringer Mannheim) for one hour. A mixture containing 5 μl of the digested DNA and 10 μl of a 50 pg/μl solution of the linker of Figure lc was warmed to 45°C for 5 min, then chilled in an ice bath. Five microlitres of a buffer containing 200mM Tris HCl pH 7.6, 40 mM MgCl₂, 4 mM ATP, 4mM dithiothreitol, 20% w/v PEG-8000 and 0.2 units of T4 DNA ligase were added to the mixture which was then incubated at 15°C for 4 hours. Amplification was performed in a total volume of 50 μl containing 2.5 units of Tag polymerase, 0.5 μl of the ligated DNA mixture, 5 μl of lOxbuffer (100 mM Tris HCl pH 9.0, 12.5 mM MgCl₂, 500 mM KC1, 1% triton X-100, 0.1% w/v gelatin), 200 μM of each dNTP and 0.5 μM of each of primers dku53 and dku55 (Fig lc) . The reaction mix was overlaid with 50 μl of mineral oil, incubated for 3 minutes at 94°C, and subjected to 30 cycles of PCR (1 min. at 94°C, 1 min. at 62°C and 2 min. at 72°C) using a PHC-2 thermocycler (Techne Incorporated, Princeton, New Jersey) . The products were visualized by ethidium bromide staining after electrophoresis in a gel containing 0.7% agarose and 0.4% Synergel (Diversified Biotech, Newton Centre, Massachusetts) . In this case the Synergel was used to enhance the visualization of the DNA.

The amplified DNA fragments usually consisted of 5 to 12 bands, ranging from about 100 bp to 2 kb long. A stained gel with typical DNA fingerprinting patterns is shown in Figure 2.

Example 2

DNA from one clinical isolate was diluted to various concentrations and the method of Example 1 was carried out on 0.06, 0.12, 0.25, 0.5, 1.0, 2.0 and 4.0 ng DNA.

Results are shown in Figure 4.

Example 3 Eight clinical isolates were divided into two portions. One portion of each was cultured to a growth index greater than 999, as described in Example 1. The other portion was cultured by the BACTEC method (Morgan, supra) , to a growth index of 100 or less. DNA was extracted from both sets of samples and processed as in Example 1.

The results are shown in Figure 5. The present invention is not limited to the features of the embodiments described herein, but includes all variations and modifications within the scope of the claims.

Claims

We claim:

1. A method for identifying an individual member or a strain of a species of organism having within its DNA at least one repeated nucleotide sequence, each repeat of said repeated nucleoside sequence having a first upstream flanking sequence and a second downstream flanking sequence and said flanking sequences being polymorphic, said method comprising

(i) amplifying at least said first flanking sequences or said second flanking sequences by ligation-mediated polymerase chain reaction and

(ii) differentiating the amplified flanking sequences on the basis of their relative size so as to characterise an individual member or strain of the species.

2. A method in accordance with claim 1 wherein step (i) comprises

(a) isolating the DNA of the individual or strain;

(b) subjecting the isolated DNA to digestion by a restriction endonuclease to give restriction fragments;

(c) contacting the restriction fragments with a non-phosphorylated linker and ligating a linker strand to the restriction fragments to provide an amplification site; (d) denaturing the restriction fragments to give single stranded fragments and contacting said single stranded fragments under hybridising conditions with a first oligonucleotide primer complementary to the ligated linker strand and a second oligonucleotide primer complementary to at least a portion of one strand of said repeated nucleotide sequence; (e) subjecting the restriction fragments to a selected number of cycles of amplification by polymerase chain reaction so as to amplify the portion of the repeated nucleotide sequence along with its adjacent flanking sequence.

3. A method in accordance with claim 2 wherein the restriction fragments produced in step (b) and the linker have cohesive ends.

4. A method in accordance with claim 3 wherein the ligated linker strand has the same nucleotide sequence as the portion of the repeated nucleotide sequence and the first and second oligonucleotide primers have the same nucleotide sequence.

5. A method in accordance with claim 3 wherein the single stranded fragments are additionally contacted in step (d) with a third oligonucleotide primer complementary to at least a portion of the other strand of the repeated nucleotide sequence.

6. A method in accordance with claim 5 wherein each of the second and third oligonucleotide primers is complementary to the terminal portion of its respective repeated nucleotide sequence strand.

7. A method in accordance with claim 6 wherein the ligated linker strand has the same nucleotide sequence as one of said portions of said repeated nucleotide sequence and the first and second oligonucleotide primers have the same nucleoside sequence.

8. A method in accordance with claim 7 wherein the individual member is a member of a species selected from the group comprising viruses, bacteria, mycobacteria, fungi, algae, plants and animals.

9. A method in accordance with claim 6 wherein the linker has the formula

5•OH-CCTTTCCAAGAACTGGAGTC-OH 3'OH-GGAAAGGTTCTTGACCTCAGCTAG-OH

10. A method in accordance with claim 9 wherein the individual member is a strain of mycobacterium.

11. A method in accordance with claim 10 wherein the strain is a strain selected from the group comprising M. tuberculosis. M. bovis. M. microti. M. africanum and M. avium.

12. A method in accordance with claim 11 wherein the strain is a strain of M. tuberculosis.

13. A method in accordance with claim 12 wherein the repeated nucleotide sequence is IS 6110.

14. A method in accordance with claim 13 wherein said first and second oligonucleotide primers have the formulae

5•CGGACTCACCGGGGCGGTTC and

5•CCTTTCCAAGAACTGGAGTC respectively.

15. A method in accordance with any of claims 1 to 14 wherein said amplified flanking sequences are differentiated by Southern blotting to give a banding pattern characteristic of the individual member.

16. A method in accordance with any of claims 1 to 14 wherein said amplified flanking sequences are differentiated by Southern blotting to give a banding pattern characteristic of the individual member and further comprising the step of comparing said banding pattern with those derived from a member or members of a strain of the organism for the purpose of establishing the strain identity of the individual member.

17. An isolated DNA molecule having the formula

5"OH-CCTTTCCAAGAACTGGAGTC-OH

3'OH-GGAAAGGTTCTTGACCTCAGCTAG-OH

18. An isolated DNA molecule having the formula

5•CGGACTCACCGGGGCGGTTC

19. An isolated DNA molecule having the formula

5'CCTTTCCAAGAACTGGAGTC

20. A method for amplifying a portion of a DNA fragment having a known nucleotide sequence from said known nucleotide sequence to an unknown nucleotide sequence comprising

(a) subjecting the DNA fragment to digestion by a restriction endonuclease to give restriction fragments having cohesive ends; (b) contacting the restriction fragments with a non-phosphorylated linker having cohesive ends and ligating a linker strand to the restriction fragments to provide an amplification site; (c) denaturing the restriction fragments to give single stranded fragments and contacting said single stranded fragments under hybridising conditions with a first oligonucleotide primer complementary to the ligated linker strand and a second oligonucleotide primer complimentary to at least a portion of one strand of said repeated nucleotide sequence; (d) subjecting the restriction fragments to a selected number of cycles of amplification by polymerase chain reaction so as to amplify the portion of the repeated nucleotide sequence along with its adjacent flanking sequence.