WO1993015201A1 - Novel protein tyrosine kinases - Google Patents

Novel protein tyrosine kinases Download PDF

Info

Publication number
WO1993015201A1
WO1993015201A1 PCT/US1993/000586 US9300586W WO9315201A1 WO 1993015201 A1 WO1993015201 A1 WO 1993015201A1 US 9300586 W US9300586 W US 9300586W WO 9315201 A1 WO9315201 A1 WO 9315201A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
lptk
bptk
protein
sal
Prior art date
Application number
PCT/US1993/000586
Other languages
French (fr)
Inventor
Hava Avraham
Jerome Groopman
Sally Cowley
David Scadden
James Mon LEE
Brian Drake Bennett
William I. Wood
David Goeddel
Original Assignee
New England Deaconess Hospital
Genentech, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by New England Deaconess Hospital, Genentech, Inc. filed Critical New England Deaconess Hospital
Priority to EP93903639A priority Critical patent/EP0624192A1/en
Priority to JP5513345A priority patent/JPH07504813A/en
Publication of WO1993015201A1 publication Critical patent/WO1993015201A1/en
Priority to US08/446,648 priority patent/US6331302B1/en
Priority to US09/982,610 priority patent/US6673343B2/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/71—Receptors; Cell surface antigens; Cell surface determinants for growth factors; for growth regulators
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/82—Translation products from oncogenes
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2863—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against receptors for growth factors, growth regulators
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K19/00—Hybrid peptides, i.e. peptides covalently bound to nucleic acids, or non-covalently bound protein-protein complexes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • Protein tyrosine kinases are enzymes that catalyze this process. Moreover, many act as growth factor receptors.
  • the present invention relates to novel protein tyrosine kinase genes present in human megakaryocytic and lymphocytic cells, the proteins encoded by these genes, antibodies specific for the encoded proteins, RNA nucleic acid sequences which hybridize to the genes and methods of use therefor.
  • pTK protein tyrosine kinase
  • the pTK genes of the present invention show significant sequence homology with members of the c-kit subgroup of growth factor receptors with protein tyrosine kinase activity.
  • the c-kit subgroup of receptor tyrosine kinases catalyze the phosphorylation of exogenous substrates, as well as tyrosine residues within their own polypeptide chains. (Ullrich, A. and Schlessinger, J. , Cell. 61:203 (1990)).
  • Members of the c-kit subgroup include FLT/FLK (Fetal Liver Kinase) , FGF (Fibroblast Growth Factor Receptor) and NGF (Nerve Growth Factor Receptor) .
  • pTK genes fourteen pTK genes have been identified.
  • Two pTK genes referred to as SAL-SI and SAL- D4 (also referred to as megakaryocyte derived FGF-like receptor tyrosine kinase) were identified in megakaryocytic cells.
  • Five pTK genes referred to as LpTKs, were identified in lymphocytic cells and have been shown to be present in megakaryocytes as well.
  • One pTK gene referred to a HpTKs, was identified in human hepatoma cells.
  • Six pTK genes referred to as bpTK genes, found in human brain tissue.
  • SAL-SI is related to the FLT/FLK family of pTKs.
  • SAL-D4 is related to the FGF receptor family of pTKs, and one LpTK (LpTK 3) is related to the NGF receptor family of pTKs.
  • the pTK genes which are the subject of the present invention, were identified using two sets of degenerative oligonucleotide primers: a first set which amplifies all pTK DNA segments (SEQ ID NOS:1-2), and a second set which amplifies highly conserved sequences present in the catalytic domain of the c-kit subgroup of pTKs (SEQ ID NOS:3-4).
  • SAL-SI is expressed in several megakaryocytic cell lines, but not in erythroid cell lines.
  • the nucleotide sequence of SAL-SI was obtained, revealing a sequence containing 158 base pairs. (SEQ ID NO:5).
  • This isolated DNA fragment encoded an amino acid sequence (SEQ ID NO:6) which exhibited significant sequence homology with known protein tyrosine kinases of the FLT/FLK family.
  • the full length gene sequence (SEQ ID NO: 17) contains 6827 b.p. and the deduced amino acid sequence (SEQ ID NO: 18) contains 349 residues.
  • SAL-D4 also expressed in megakaryocytic cells, is a DNA fragment containing the nucleotide sequence of 141 base pairs. (SEQ ID NO:7) . This isolated DNA fragment encoded an amino acid sequence (SEQ ID NO:8) which exhibited significant sequence homology with known protein tyrosine kinases of the FGF receptor family.
  • the LpTKs including LpTK 2, LpTK 3, LpTK 4, and LpTK 13 and LpTK 25, are expressed in lymphocytic cells, as well as megakaryocytic cells.
  • the nucleotide sequence (151 base pairs) of the LpTK 3 gene was obtained (SEQ ID NO:11), and exhibited significant homology with known protein tyrosine kinases of the NGF receptor family.
  • the nucleotide sequences of the LpTK 2, LpTK 4, and LpTK 13 genes contained 149 base pairs (SEQ ID NO:9), 137 base pairs (SEQ ID NO:13), and 211 base pairs (SEQ ID NO:15) respectively.
  • LpTK 25 has a nucleotide sequence of 3120 b.p. (SEQ ID NO: 22) .
  • a full length gene sequence has been obtained for LpTK 2 (SEQ ID NO: 19) which contains 7606 b.p. Additional sequencing of LpTK 4 revealed a sequence of 404 b.p. (SEQ ID NO: 21).
  • the HpTK 5 gene expressed in human hepatoma cells, has a nucleotide sequence of 3120 b.p. (SEQ ID NO: 22) .
  • Nucleotide sequences of the bpTK's are expressed in human brain tissue encode proteins having the amino acid sequences of SEQ ID NOS: 25-30 respectively.
  • the present invention includes DNA isolated from a human megakaryocytic cell line, which hybridizes to a DNA fragment which hybridizes to DNA encoding an amino acid sequence which is highly conserved in the catalytic domain of protein tyrosine kinases of the c-kit subgroup.
  • the present invention also includes the proteins encoded by the pTK genes identified as described herein, which exhibit significant sequence homology with members of the c-kit subgroup of pTks (i.e. FLT/FLK (SAL-SI), FGF receptor (SAL-D4) or NGF receptor (LpTKS) ) as well as the proteins encoded by HpTK 5 and the bpTKs.
  • pTks i.e. FLT/FLK (SAL-SI), FGF receptor (SAL-D4) or NGF receptor (LpTKS)
  • the present invention also includes SAL-SI, SAL-D4, and LpTK, HpTK and bpTK homologues or equivalents (i.e., proteins which have amino acid sequences substantially similar, but not identical, to that of SAL-SI, SAL-D4, the LpTKs HpTK and the bpTKs, which exhibit tyrosine kinase activity.)
  • This invention further includes peptides (SAL-SI, SAL-D4, LpTK, HpTK and bpTK fragments) which retain tyrosine kinase activity, yet are less than the entire SAL-Sl, SAL-D4, LpTK, HpTK and bpTK sequences) , monoclonal and polyclonal antibodies specific for SAL-SI, SAL-D4, the LpTKs, HpTK and the bpTKs, and uses for the SAL-SI, SAL-D4, the LpTK, HpTK and the bpTK
  • the present invention further includes nucleic acid sequences which hybridize with DNA or RNA encoding the proteins described herein, which exhibit significant sequence homology with the FLT/FLK, FGF receptor or NGF receptor family of protein tyrosine kinases contained within the c-kit subgroup.
  • nucleic acid sequences are useful as probes to identify pTK genes in other vertebrates, particularly mammals, and in other cell types. They can also be used as anti-sense oligonucleotides to inhibit protein tyrosine kinase activity, both in vitro and in vivo.
  • the SAL-SI, SAL-D4, LpTK, HpTK and bpTK, tyrosine kinases of the present invention can be used as target proteins in conjunction with the development of drugs and therapeutics to modulate cell growth, differentiation and other metabolic functions.
  • the SAL-SI, SAL-D4, LpTK, HpTK or bpTK proteins can be used as agonists or antagonists to other tyrosine kinases.
  • the SAL-SI, SAL-D4, LpTK, HpTK or bpTK tyrosine kinases can also be instrumental in the modulation of megakaryocyte and/or platelet adhesion interactions.
  • the SAL-SI, SAL-D4, LpTK, HpTK and bpTK tyrosine kinases can be used in screening assays to detect cellular growth and/or differentiation factors.
  • the ligands of the pTKs of the present invention can be identified. Once identified, assays can be designed to detect these ligands present endogenously, within cells, as well as exogenously, in extra cellular fluids. Assays can also be designed as diagnostic aids to detect these ligands in body fluids such as blood and urine.
  • Figure 1 depicts the nucleotide sequence of SAL-SI (SEQ ID NO: 5) and the deduced amino acid sequence (SEQ ID NO:6) .
  • Figure 2 depicts the nucleotide sequence of SAL-D4 (SEQ ID NO:7) and its deduced amino acid sequence (SEQ ID NO:8) .
  • Figure 3A depicts the nucleotide sequence (SEQ ID O:9) and its deduced amino acid sequence (SEQ ID NO:10) for LpTK 2.
  • Figure 3B depicts the nucleotide sequence (SEQ ID O:11) and its deduced amino acid sequence (SEQ ID NO:12) for LpTK 3.
  • Figure 3C depicts the nucleotide sequence (SEQ ID NO:13) and its deduced amino acid sequence (SEQ ID NO:14) for LpTK 4.
  • Figure 3D depicts the nucleotide sequence (SEQ ID NO:15) and its deduced amino acid sequence (SEQ ID NO:16) for the LpTK 13.
  • Figure 4A-4J depicts the full-length nucleotide sequence (SEQ ID NO: 17) and its deduced amino acid sequence (SEQ ID NO: 18) for SAL-SI.
  • Figure 5A-5J depicts the full length nucleotide sequence (SEQ ID NO: 19) and the deduced amino acid sequence (SEQ ID NO: 20) for LpTK2.
  • Figure 6 depicts the partial nucleotide sequence (SEQ ID NO: 21) for LpTK4.
  • Figure 7A-7D depicts the full length nucleotide sequence (SEQ ID NO: 22) for LpTK25.
  • Figure 8A-8F depicts the full length nucleotide sequence (SEQ ID NO: 23) and the deduced amino acid sequence (SEQ ID NO: 24) for HpTK5.
  • Figure 9 depicts the amino acid sequence (SEQ ID NO:
  • Figure 10 depicts the amino acid sequence (SEQ ID NO:
  • Figure 11 depicts the amino acid sequence (SEQ ID NO:
  • Figure 12 depicts the amino acid sequence (SEQ ID NO:
  • Figure 13 depicts the amino acid sequence (SEQ ID NO:
  • Figure 14 depicts the amino acid sequence (SEQ ID NO:
  • Novel protein tyrosine kinase genes have been identified, their nucleic acid sequences determined, and the amino acid sequences of the encoded proteins deduced.
  • the genes isolated as described herein are referred to, collectively, as protein tyrosine kinase (pTK) genes.
  • the nucleic acid sequences of these genes, isolated as discussed herein, show significant homology to with previously identified protein tyrosine kinases containing extracellular domains which function as growth factor receptors. These genes have been shown to be present in both megakaryocytic and lymphocytic cells. To facilitate the isolation and identification of these novel pTKs, two sets of DNA probes were used, as described in the Exemplification.
  • the first set consisted of two degenerative oligonucleotide sequences, pTK 1 (SEQ ID N0:l) and pTK 2 (SEQ ID NO:2) (Matthews, W. Cell 65: 1143 (1991; Wilks, A. F. Proc. Natl. Acad. Sci. USA 86:1603 (1989)). These sequences were used as primers in a polymerase chain reaction to amplify tyrosine kinase DNA segments. (Mullis, K. et al.. Cold Spring Harbor Symp. Advan. Biol. 51:263 (1986).
  • the second set consisted of two oligonucleotide sequences, pTK 3 (SEQ ID NO:3) and pTKK (SEQ ID NO:4) designed to amplify the nucleic acid sequence which encodes the highly conserved regions of the catalytic domains of the c-kit family of protein tyrosine kinases. These sequences were used as primers in the polymerase chain reaction in a second round of DNA amplification. Using this two-step amplification procedure, DNA fragments which hybridized to these pTK primers were identified, isolated and subsequently sequenced.
  • pTK genes exhibiting significant homology with the c-kit subgroup of protein tyrosine kinases have been identified.
  • Two pTK genes referred to as SAL-SI and SAL-D4 (also referred to as megakaryocyte derived FGF-like receptor) were identified in several megakaryocytic cell lines, including CMK 11-5, DAMI, UT-7 and UT-7 grown in erythropoietin, but not in the erythroid cell lines HEL, PMA stimulated HEL cells, or K562.
  • Five pTK genes referred to as LpTKs, were identified in lymphocytic, as well as in megakaryocytic cells.
  • One pTK gene, referred to as HpTK5 was identified in human hepato a cells and six genes, referred to as bpTKs, were identified in human brain tissue.
  • SAL-SI (SEQ ID NO:6 and 18) encoded by the nucleic acid sequence SEQ ID NOS:5 and 17, exhibits significant homology with the FLT/FLK family of pTKs.
  • SAL-D4 (SEQ ID NO:8) encoded by SEQ ID NO:7, is related to the FGF receptor family of pTKs, and one LpTK (LpTK 3 (SEQ ID NO:12) encoded by the SEQ ID NO:11, is related to the NGF receptor family of pTKs.
  • LpTK2 (SEQ ID NO:10) encoded by SEQ ID NO:9
  • LpTK4 (SEQ ID NO:14) encoded by SEQ ID NO:13
  • LpTK13 (SEQ ID NO:16) encoded by SEQ ID NO:15
  • LpTK25 encoded by SEQ ID NO: 22
  • HpTK5 (SEQ ID NO: 24) encoded by SEQ ID NO: 23 and the bpTKs 1, 2, 3, 4, 5 and 7 (SEQ ID NOS: 25-30 respectively, also exhibit sequence homology with known protein tyrosine kinases.
  • DNA which hybridize with DNA encoding amino acid sequences present in the catalytic domain of a protein tyrosine kinase of the c-kit subgroup of protein kinases have been isolated and sequenced.
  • pTKs genes These isolated DNA sequences, collectively referred to as pTKs genes, (and their deduced amino acid sequences) have been shown to exhibit significant sequence homology with known members of receptor tyrosine kinase families.
  • pTKs genes Once isolated, these DNA fragments can be amplified using known standard techniques such as PCR. These amplified fragments can then be cloned into appropriate cloning vectors and their DNA sequences determined.
  • DNA sequences can be excised from the cloning vectors, labeled with a radiolabeled nucleotide such as 32 P and used to screen appropriate cDNA libraries to obtain the full-length cDNA clone.
  • the pTk genes as described above have been isolated from the source in which they occur naturally, i.e. megakaryocyte and lymphocytic cells.
  • the present invention is intended to include pTk genes produced using genetic engineering techniques, such as recombinant technology, as well as pTk genes that are synthesized chemically.
  • the deduced amino acid sequences of the pTK genes include amino acid sequences which encode peptides exhibiting significant homology with the catalytic domain of protein tyrosine kinases of the c-kit subgroup of tyrosine kinases.
  • These proteins, encoded by the pTk genes can include sequences in which functionally equivalent amino acid residues are substituted for residues within the sequence, resulting in a silent change, that is a change not detected phenotypically.
  • one or more amino acid residues within the sequence can be substituted by another amino acid of a similar polarity which acts as a functional equivalent, resulting in a silent substitution.
  • the protein structure can be modified by deletions, additions, inversion, insertions or substitutions of one or more amino acid residues in the sequence which do not substantially detract from the desired functional tyrosine kinases properties of the peptide.
  • Modified pTKs of the present invention, with receptor tyrosine kinase activity can be made using recombinant DNA techniques, such as excising it from a vector containing a cDNA encoding such a protein, or by synthesizing DNA encoding the desired protein mechanically and/or chemically using known techniques.
  • An alternate approach to producing the pTKs of the present invention is to use peptide synthesis to make a peptide or polypeptide having the amino acid sequence of such a protein.
  • the peptides or modified equivalents thereof can be synthesized directly by standard solid or liquid phase chemistries for peptide synthesis.
  • the pTKs of the present invention will be produced by inserting DNA encoding the proteins into an appropriate vector/host system where it will be expressed.
  • the DNA sequences can be obtained from sources in which they occur naturally, can be chemically synthesized or can be produced using standard recombinant technology.
  • This invention also pertains to an expression vector comprising a pTK gene of the present invention, encoding for a protein which exhibits receptor tyrosine kinase activity.
  • the pTK genes of the present invention can be used for a number of diagnostic and therapeutic purposes.
  • the nucleic acid sequences of the pTK genes can be used as probes to identify other protein tyrosine kinases present in other cell types, including eukaryotic and prokaryotic cell types.
  • the nucleic acid sequences can be used to design drugs that directly inhibit the kinase activity of protein tyrosine kinases, or to design peptides that bind to the catalytic domain of tyrosine kinases, thus inhibiting their activity. These sequences can also be used to design anti-sense nucleotides that can also inhibit, or destroy, tyrosine kinase activity. Such inhibition of tyrosine kinase activity would be desirable in pathological states where decreased cellular proliferation would be beneficial, such as leukemias or other malignancies.
  • nucleic acid sequences can also be used to design drugs, peptides or anti-sense nucleotides as above, but with enhancing, rather than inhibitory effects, on tyrosine kinases.
  • Such enhanced tyrosine kinase activity would result in increasing the phosphorylation of substrates (exogenous, as ⁇ well as endogenous tyrosine residues) .
  • Enhanced effects would be desirable in states where increased cellular proliferation would be beneficial, such as anemias, bleeding disorders and during surgical procedures.
  • the pTK genes of the present invention can also be used to obtain soluble fragments of receptor tyrosine kinases, capable of binding their respective ligands (i.e. fibroblast growth factor) .
  • pTK genes encoding soluble receptor tyrosine kinase fragments can be produced using recombinant DNA techniques or synthetically. In either case, the DNA obtained encodes a soluble pTK fragment which lacks a substantial portion of the hydrophobic transmembrane region to permit solubilization of the fragment.
  • soluble pTK protein fragments can be introduced exogenously to act as competitors with the endogenous, membrane bound pTK for their respective ligands, thus inhibiting tyrosine kinase activity.
  • a modified soluble pTK protein fragment can be introduced which binds the ligand but does not activate kinase activity.
  • soluble pTK protein fragments can also be used in binding assays to detect ligands such as growth and differentiation factors. Once these ligands are identified, they may be altered or modified to inhibit or enhance kinase activity. For example, the ligands may be modified or attached to substances that are toxic to the cell, such a ricin, thus destroying the target cell. The substance may be a super-activating substance which, after binding to the pTK, may substantially increase the kinase activity, or activate other growth factors.
  • pTk genes of the present invention would also be useful to develop diagnostic tools for in vitro screening assays for ligands such as growth factors or differentiation factors that inhibit or enhance kinase activity.
  • the proteins encoded by the pTK genes can also be used in such assays, or as immunogens to produce monoclonal or polyclonal antibodies to be used in such assays.
  • Such antibodies can also be used in methods of treating conditions in which an individual would benefit therapeutically if protein tyrosine kinase activity could be modified, such as increasing platelet production in bleeding disorders.
  • the first set consisted of two degenerative oligonucleotide sequences, pTK 1 (SEQ ID N0:1) and pTK 2(SEQ ID NO:2). These sequences were used as polymerase chain reaction (PCR) primers, using standard PCR techniques, to amplify tyrosine kinase DNA segments.
  • the second set consisted of two oligonucleotide sequences, pTK 3 (SEQ ID NO:3) and pTKKW (SEQ ID NO:4) selected from the highly conserved regions of the catalytic domains of the c-kit subgroup of protein tyrosine kinases. These sequences were also used as polymerase chain reaction primers in a second round of DNA amplification. Using this two-step amplification procedure, DNA fragments which hybridized to these pTK primers were identified, isolated and subsequently sequenced using known laboratory techniques.

Abstract

The identification and isolation of novel protein tyrosine kinase genes present on human megakaryocytic and lymphocytic cells, the proteins encoded by these genes, antibodies specific for the encoded proteins, RNA nucleic acid sequences which hybridize to the genes and methods of use therefor.

Description

NOVEL PROTEIN TYROSINE KINASES
Description
Background of the Invention
Transduction of signals that regulate cell growth and differentiation is regulated in part by phosphorylation of various cellular proteins. Protein tyrosine kinases are enzymes that catalyze this process. Moreover, many act as growth factor receptors.
Summary of the Invention The present invention relates to novel protein tyrosine kinase genes present in human megakaryocytic and lymphocytic cells, the proteins encoded by these genes, antibodies specific for the encoded proteins, RNA nucleic acid sequences which hybridize to the genes and methods of use therefor.
The genes isolated as described herein are referred to, collectively, as protein tyrosine kinase (pTK) genes. The nucleic acid sequences of these genes, isolated as discussed herein, show significant homology with previously identified protein tyrosine kinases containing extracellular domains which function as growth factor receptors. The pTK genes have been shown to be present in both megakaryocytic and lymphocytic cells.
The pTK genes of the present invention show significant sequence homology with members of the c-kit subgroup of growth factor receptors with protein tyrosine kinase activity. The c-kit subgroup of receptor tyrosine kinases catalyze the phosphorylation of exogenous substrates, as well as tyrosine residues within their own polypeptide chains. (Ullrich, A. and Schlessinger, J. , Cell. 61:203 (1990)). Members of the c-kit subgroup include FLT/FLK (Fetal Liver Kinase) , FGF (Fibroblast Growth Factor Receptor) and NGF (Nerve Growth Factor Receptor) .
In particular, fourteen pTK genes have been identified. Two pTK genes, referred to as SAL-SI and SAL- D4 (also referred to as megakaryocyte derived FGF-like receptor tyrosine kinase) were identified in megakaryocytic cells. Five pTK genes, referred to as LpTKs, were identified in lymphocytic cells and have been shown to be present in megakaryocytes as well. One pTK gene, referred to a HpTKs, was identified in human hepatoma cells. Six pTK genes, referred to as bpTK genes, found in human brain tissue.
SAL-SI is related to the FLT/FLK family of pTKs. SAL-D4 is related to the FGF receptor family of pTKs, and one LpTK (LpTK 3) is related to the NGF receptor family of pTKs.
The pTK genes, which are the subject of the present invention, were identified using two sets of degenerative oligonucleotide primers: a first set which amplifies all pTK DNA segments (SEQ ID NOS:1-2), and a second set which amplifies highly conserved sequences present in the catalytic domain of the c-kit subgroup of pTKs (SEQ ID NOS:3-4). The pTK genes identified in this manner are described below. SAL-SI is expressed in several megakaryocytic cell lines, but not in erythroid cell lines. The nucleotide sequence of SAL-SI was obtained, revealing a sequence containing 158 base pairs. (SEQ ID NO:5). This isolated DNA fragment encoded an amino acid sequence (SEQ ID NO:6) which exhibited significant sequence homology with known protein tyrosine kinases of the FLT/FLK family. The full length gene sequence (SEQ ID NO: 17) contains 6827 b.p. and the deduced amino acid sequence (SEQ ID NO: 18) contains 349 residues.
SAL-D4, also expressed in megakaryocytic cells, is a DNA fragment containing the nucleotide sequence of 141 base pairs. (SEQ ID NO:7) . This isolated DNA fragment encoded an amino acid sequence (SEQ ID NO:8) which exhibited significant sequence homology with known protein tyrosine kinases of the FGF receptor family. The LpTKs, including LpTK 2, LpTK 3, LpTK 4, and LpTK 13 and LpTK 25, are expressed in lymphocytic cells, as well as megakaryocytic cells. The nucleotide sequence (151 base pairs) of the LpTK 3 gene was obtained (SEQ ID NO:11), and exhibited significant homology with known protein tyrosine kinases of the NGF receptor family. The nucleotide sequences of the LpTK 2, LpTK 4, and LpTK 13 genes contained 149 base pairs (SEQ ID NO:9), 137 base pairs (SEQ ID NO:13), and 211 base pairs (SEQ ID NO:15) respectively. LpTK 25 has a nucleotide sequence of 3120 b.p. (SEQ ID NO: 22) . A full length gene sequence has been obtained for LpTK 2 (SEQ ID NO: 19) which contains 7606 b.p. Additional sequencing of LpTK 4 revealed a sequence of 404 b.p. (SEQ ID NO: 21).
The HpTK 5 gene, expressed in human hepatoma cells, has a nucleotide sequence of 3120 b.p. (SEQ ID NO: 22) .
Nucleotide sequences of the bpTK's, including bpTK 1, bpTK 2, bpTK 3, bpTK 4, bpTK 5 and bpTK 7 are expressed in human brain tissue encode proteins having the amino acid sequences of SEQ ID NOS: 25-30 respectively. Thus the present invention includes DNA isolated from a human megakaryocytic cell line, which hybridizes to a DNA fragment which hybridizes to DNA encoding an amino acid sequence which is highly conserved in the catalytic domain of protein tyrosine kinases of the c-kit subgroup. The present invention also includes the proteins encoded by the pTK genes identified as described herein, which exhibit significant sequence homology with members of the c-kit subgroup of pTks (i.e. FLT/FLK (SAL-SI), FGF receptor (SAL-D4) or NGF receptor (LpTKS) ) as well as the proteins encoded by HpTK 5 and the bpTKs. The present invention also includes SAL-SI, SAL-D4, and LpTK, HpTK and bpTK homologues or equivalents (i.e., proteins which have amino acid sequences substantially similar, but not identical, to that of SAL-SI, SAL-D4, the LpTKs HpTK and the bpTKs, which exhibit tyrosine kinase activity.) This invention further includes peptides (SAL-SI, SAL-D4, LpTK, HpTK and bpTK fragments) which retain tyrosine kinase activity, yet are less than the entire SAL-Sl, SAL-D4, LpTK, HpTK and bpTK sequences) , monoclonal and polyclonal antibodies specific for SAL-SI, SAL-D4, the LpTKs, HpTK and the bpTKs, and uses for the SAL-SI, SAL-D4, the LpTK, HpTK and the bpTK nucleic acid sequences and SAL-SI, SAL- D4, LpTK, ΗpTK and bpTK equivalents.
The present invention further includes nucleic acid sequences which hybridize with DNA or RNA encoding the proteins described herein, which exhibit significant sequence homology with the FLT/FLK, FGF receptor or NGF receptor family of protein tyrosine kinases contained within the c-kit subgroup. Such nucleic acid sequences are useful as probes to identify pTK genes in other vertebrates, particularly mammals, and in other cell types. They can also be used as anti-sense oligonucleotides to inhibit protein tyrosine kinase activity, both in vitro and in vivo.
The SAL-SI, SAL-D4, LpTK, HpTK and bpTK, tyrosine kinases of the present invention can be used as target proteins in conjunction with the development of drugs and therapeutics to modulate cell growth, differentiation and other metabolic functions. The SAL-SI, SAL-D4, LpTK, HpTK or bpTK proteins can be used as agonists or antagonists to other tyrosine kinases. The SAL-SI, SAL-D4, LpTK, HpTK or bpTK tyrosine kinases can also be instrumental in the modulation of megakaryocyte and/or platelet adhesion interactions.
In addition, the SAL-SI, SAL-D4, LpTK, HpTK and bpTK tyrosine kinases can be used in screening assays to detect cellular growth and/or differentiation factors. Using standard laboratory techniques, the ligands of the pTKs of the present invention can be identified. Once identified, assays can be designed to detect these ligands present endogenously, within cells, as well as exogenously, in extra cellular fluids. Assays can also be designed as diagnostic aids to detect these ligands in body fluids such as blood and urine.
Brief Description of the Drawings
Figure 1 depicts the nucleotide sequence of SAL-SI (SEQ ID NO: 5) and the deduced amino acid sequence (SEQ ID NO:6) .
Figure 2 depicts the nucleotide sequence of SAL-D4 (SEQ ID NO:7) and its deduced amino acid sequence (SEQ ID NO:8) . Figure 3A depicts the nucleotide sequence (SEQ ID O:9) and its deduced amino acid sequence (SEQ ID NO:10) for LpTK 2.
Figure 3B depicts the nucleotide sequence (SEQ ID O:11) and its deduced amino acid sequence (SEQ ID NO:12) for LpTK 3.
Figure 3C depicts the nucleotide sequence (SEQ ID NO:13) and its deduced amino acid sequence (SEQ ID NO:14) for LpTK 4. Figure 3D depicts the nucleotide sequence (SEQ ID NO:15) and its deduced amino acid sequence (SEQ ID NO:16) for the LpTK 13.
Figure 4A-4J depicts the full-length nucleotide sequence (SEQ ID NO: 17) and its deduced amino acid sequence (SEQ ID NO: 18) for SAL-SI.
Figure 5A-5J depicts the full length nucleotide sequence (SEQ ID NO: 19) and the deduced amino acid sequence (SEQ ID NO: 20) for LpTK2.
Figure 6 depicts the partial nucleotide sequence (SEQ ID NO: 21) for LpTK4.
Figure 7A-7D depicts the full length nucleotide sequence (SEQ ID NO: 22) for LpTK25.
Figure 8A-8F depicts the full length nucleotide sequence (SEQ ID NO: 23) and the deduced amino acid sequence (SEQ ID NO: 24) for HpTK5.
Figure 9 depicts the amino acid sequence (SEQ ID NO:
25) of bpTKl.
Figure 10 depicts the amino acid sequence (SEQ ID NO:
26) of bpTK2. Figure 11 depicts the amino acid sequence (SEQ ID NO:
27) of bpTK3. Figure 12 depicts the amino acid sequence (SEQ ID NO:
28) of bpTK4.
Figure 13 depicts the amino acid sequence (SEQ ID NO:
29) of bpTK5. Figure 14 depicts the amino acid sequence (SEQ ID NO:
30) of bpTK7.
Detailed Description of the Invention
Novel protein tyrosine kinase genes have been identified, their nucleic acid sequences determined, and the amino acid sequences of the encoded proteins deduced. The genes isolated as described herein are referred to, collectively, as protein tyrosine kinase (pTK) genes. The nucleic acid sequences of these genes, isolated as discussed herein, show significant homology to with previously identified protein tyrosine kinases containing extracellular domains which function as growth factor receptors. These genes have been shown to be present in both megakaryocytic and lymphocytic cells. To facilitate the isolation and identification of these novel pTKs, two sets of DNA probes were used, as described in the Exemplification. The first set consisted of two degenerative oligonucleotide sequences, pTK 1 (SEQ ID N0:l) and pTK 2 (SEQ ID NO:2) (Matthews, W. Cell 65: 1143 (1991; Wilks, A. F. Proc. Natl. Acad. Sci. USA 86:1603 (1989)). These sequences were used as primers in a polymerase chain reaction to amplify tyrosine kinase DNA segments. (Mullis, K. et al.. Cold Spring Harbor Symp. Advan. Biol. 51:263 (1986).
The second set consisted of two oligonucleotide sequences, pTK 3 (SEQ ID NO:3) and pTKK (SEQ ID NO:4) designed to amplify the nucleic acid sequence which encodes the highly conserved regions of the catalytic domains of the c-kit family of protein tyrosine kinases. These sequences were used as primers in the polymerase chain reaction in a second round of DNA amplification. Using this two-step amplification procedure, DNA fragments which hybridized to these pTK primers were identified, isolated and subsequently sequenced.
In particular, fourteen pTK genes exhibiting significant homology with the c-kit subgroup of protein tyrosine kinases have been identified. Two pTK genes, referred to as SAL-SI and SAL-D4 (also referred to as megakaryocyte derived FGF-like receptor) were identified in several megakaryocytic cell lines, including CMK 11-5, DAMI, UT-7 and UT-7 grown in erythropoietin, but not in the erythroid cell lines HEL, PMA stimulated HEL cells, or K562. Five pTK genes, referred to as LpTKs, were identified in lymphocytic, as well as in megakaryocytic cells. One pTK gene, referred to as HpTK5 was identified in human hepato a cells and six genes, referred to as bpTKs, were identified in human brain tissue.
SAL-SI (SEQ ID NO:6 and 18) encoded by the nucleic acid sequence SEQ ID NOS:5 and 17, exhibits significant homology with the FLT/FLK family of pTKs. SAL-D4 (SEQ ID NO:8) encoded by SEQ ID NO:7, is related to the FGF receptor family of pTKs, and one LpTK (LpTK 3 (SEQ ID NO:12) encoded by the SEQ ID NO:11, is related to the NGF receptor family of pTKs. The remaining LpTKs, LpTK2 (SEQ ID NO:10) encoded by SEQ ID NO:9; LpTK4 (SEQ ID NO:14) encoded by SEQ ID NO:13; LpTK13 (SEQ ID NO:16) encoded by SEQ ID NO:15 LpTK25 encoded by SEQ ID NO: 22, also exhibit sequence homology with known protein tyrosine kinases (Data not shown) .
HpTK5 (SEQ ID NO: 24) encoded by SEQ ID NO: 23 and the bpTKs 1, 2, 3, 4, 5 and 7 (SEQ ID NOS: 25-30 respectively, also exhibit sequence homology with known protein tyrosine kinases.
Thus, as described above, DNA which hybridize with DNA encoding amino acid sequences present in the catalytic domain of a protein tyrosine kinase of the c-kit subgroup of protein kinases have been isolated and sequenced.
These isolated DNA sequences, collectively referred to as pTKs genes, (and their deduced amino acid sequences) have been shown to exhibit significant sequence homology with known members of receptor tyrosine kinase families. Once isolated, these DNA fragments can be amplified using known standard techniques such as PCR. These amplified fragments can then be cloned into appropriate cloning vectors and their DNA sequences determined.
These DNA sequences can be excised from the cloning vectors, labeled with a radiolabeled nucleotide such as 32P and used to screen appropriate cDNA libraries to obtain the full-length cDNA clone.
The pTk genes as described above have been isolated from the source in which they occur naturally, i.e. megakaryocyte and lymphocytic cells. The present invention is intended to include pTk genes produced using genetic engineering techniques, such as recombinant technology, as well as pTk genes that are synthesized chemically.
The deduced amino acid sequences of the pTK genes include amino acid sequences which encode peptides exhibiting significant homology with the catalytic domain of protein tyrosine kinases of the c-kit subgroup of tyrosine kinases. These proteins, encoded by the pTk genes, can include sequences in which functionally equivalent amino acid residues are substituted for residues within the sequence, resulting in a silent change, that is a change not detected phenotypically. For example, one or more amino acid residues within the sequence can be substituted by another amino acid of a similar polarity which acts as a functional equivalent, resulting in a silent substitution.
In addition, the protein structure can be modified by deletions, additions, inversion, insertions or substitutions of one or more amino acid residues in the sequence which do not substantially detract from the desired functional tyrosine kinases properties of the peptide.
Modified pTKs of the present invention, with receptor tyrosine kinase activity can be made using recombinant DNA techniques, such as excising it from a vector containing a cDNA encoding such a protein, or by synthesizing DNA encoding the desired protein mechanically and/or chemically using known techniques.
An alternate approach to producing the pTKs of the present invention is to use peptide synthesis to make a peptide or polypeptide having the amino acid sequence of such a protein. The peptides or modified equivalents thereof, can be synthesized directly by standard solid or liquid phase chemistries for peptide synthesis.
Preferably, the pTKs of the present invention will be produced by inserting DNA encoding the proteins into an appropriate vector/host system where it will be expressed. The DNA sequences can be obtained from sources in which they occur naturally, can be chemically synthesized or can be produced using standard recombinant technology.
This invention also pertains to an expression vector comprising a pTK gene of the present invention, encoding for a protein which exhibits receptor tyrosine kinase activity.
The pTK genes of the present invention can be used for a number of diagnostic and therapeutic purposes. For example, the nucleic acid sequences of the pTK genes can be used as probes to identify other protein tyrosine kinases present in other cell types, including eukaryotic and prokaryotic cell types.
The nucleic acid sequences can be used to design drugs that directly inhibit the kinase activity of protein tyrosine kinases, or to design peptides that bind to the catalytic domain of tyrosine kinases, thus inhibiting their activity. These sequences can also be used to design anti-sense nucleotides that can also inhibit, or destroy, tyrosine kinase activity. Such inhibition of tyrosine kinase activity would be desirable in pathological states where decreased cellular proliferation would be beneficial, such as leukemias or other malignancies. The nucleic acid sequences can also be used to design drugs, peptides or anti-sense nucleotides as above, but with enhancing, rather than inhibitory effects, on tyrosine kinases. Such enhanced tyrosine kinase activity would result in increasing the phosphorylation of substrates (exogenous, as <well as endogenous tyrosine residues) . Enhanced effects would be desirable in states where increased cellular proliferation would be beneficial, such as anemias, bleeding disorders and during surgical procedures.
The pTK genes of the present invention can also be used to obtain soluble fragments of receptor tyrosine kinases, capable of binding their respective ligands (i.e. fibroblast growth factor) . pTK genes encoding soluble receptor tyrosine kinase fragments can be produced using recombinant DNA techniques or synthetically. In either case, the DNA obtained encodes a soluble pTK fragment which lacks a substantial portion of the hydrophobic transmembrane region to permit solubilization of the fragment.
These soluble pTK protein fragments can be introduced exogenously to act as competitors with the endogenous, membrane bound pTK for their respective ligands, thus inhibiting tyrosine kinase activity. Alternately, a modified soluble pTK protein fragment can be introduced which binds the ligand but does not activate kinase activity.
These soluble pTK protein fragments can also be used in binding assays to detect ligands such as growth and differentiation factors. Once these ligands are identified, they may be altered or modified to inhibit or enhance kinase activity. For example, the ligands may be modified or attached to substances that are toxic to the cell, such a ricin, thus destroying the target cell. The substance may be a super-activating substance which, after binding to the pTK, may substantially increase the kinase activity, or activate other growth factors. pTk genes of the present invention would also be useful to develop diagnostic tools for in vitro screening assays for ligands such as growth factors or differentiation factors that inhibit or enhance kinase activity. The proteins encoded by the pTK genes can also be used in such assays, or as immunogens to produce monoclonal or polyclonal antibodies to be used in such assays.
Such antibodies can also be used in methods of treating conditions in which an individual would benefit therapeutically if protein tyrosine kinase activity could be modified, such as increasing platelet production in bleeding disorders.
The present invention will now be illustrated by the following Exemplification, which is not intended to be limiting in any way.
Exemplification: The Identification and Isolation of the TK Genes
. To facilitate the isolation and identification of these novel pTK genes, two sets of DNA probes were used. (See Table) .
The first set consisted of two degenerative oligonucleotide sequences, pTK 1 (SEQ ID N0:1) and pTK 2(SEQ ID NO:2). These sequences were used as polymerase chain reaction (PCR) primers, using standard PCR techniques, to amplify tyrosine kinase DNA segments. The second set consisted of two oligonucleotide sequences, pTK 3 (SEQ ID NO:3) and pTKKW (SEQ ID NO:4) selected from the highly conserved regions of the catalytic domains of the c-kit subgroup of protein tyrosine kinases. These sequences were also used as polymerase chain reaction primers in a second round of DNA amplification. Using this two-step amplification procedure, DNA fragments which hybridized to these pTK primers were identified, isolated and subsequently sequenced using known laboratory techniques.
TABLE
First Round of Amplification
PTK1 CGGATCCACAGNGACCT
PTK2 GGAATTCCAAAGGACCAGACGTC
Second Round of Amplification
PTK3 (kit family specific) CGGATCCATCCACAGAGATGT
PTKKW (kit family specific) GGAATTCCTTCAGGAGCCATCCACTT
Eguivalents Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.

Claims

CLAIMSThe invention claimed is:
1. Isolated DNA of human megakaryocytic origin which hybridizes to a DNA fragment which hybridizes to DNA encoding an amino acid sequence present in the catalytic domain of a protein tyrosine kinase of the c-kit subgroup of protein tyrosine kinases.
2. Isolated DNA of Claim 1 having a nucleotide sequence selected from the group of nucleotide sequences consisting of: a) SAL-SI (SEQ ID NOS:5 and 7) ; b) SAL-D4 (SEQ ID N0:7); c) LpTK 2 (SEQ ID NOS:9 and 19); d) LpTK 3 (SEQ ID NO:11); e) LpTk 4 (SEQ ID N0S:13 and 21); f) LpTK 13 (SEQ ID N0:15); g) LpTK 25 (SEQ ID NO: 22 and h( HpTK 5 (SEQ ID NO: 23) .
3. Isolated DNA of Claim 1 which encodes an amino acid sequence selected from the group consisting of: a) SAL-SI (SEQ ID NOS:6 and 18); b) SAL-D4 (SEQ ID NO:8); c) LpTK 2 (SEQ ID NOS:10 and 20); d) LpTK 3 (SEQ ID NO: 12); e) LpTK 4 (SEQ ID NO:14); f) LpTK 13 (SEQ ID NO:16); g) HpTK 5 (SEQ ID N0:24); h) bpTK 1 (SEQ ID NO:25) i) bpTK 2 (SEQ ID NO:26) j) bpTK 3 (SEQ ID NO:27) k) bpTK 4 (SEQ ID NO:28)
1) bpTK 5 (SEQ ID NO:29) and m) bpTK 7 (SEQ ID NO:30)
Isolated DNA of human megakaryocytic origin which comprises a DNA fragment whose sequence encodes an amino acid sequence present in the catalytic domain of a protein tyrosine kinase of the c-kit subgroup of protein tyrosine kinases.
Isolated DNA of Claim 4 which encodes an amino acid sequence selected from the group consisting of: a) SAL-SI (SEQ ID NO:6); b) SAL-D4 (SEQ ID NO:8); c) LpTK 2 (SEQ ID NO:10); d) LpTK 3 (SEQ ID NO:12); e) LpTk 4 (SEQ ID NO:14); and f) LpTK 13 (SEQ ID NO:16). g) HpTK 5 (SEQ ID NO:24) h) bpTK 1 (SEQ ID NO:25) i) bpTK 2 (SEQ ID NO:26) j) bpTK 3 (SEQ ID NO:27) k) bpTK 4 (SEQ ID NO:28) 1) bpTK 5 (SEQ ID NO:29); and m) bpTK 7 (SEQ ID NO:30) A homogeneous protein of human megakaryocytic origin which includes an amino acid sequence exhibiting sequence homology with the catalytic domain of tyrosine kinases of the c-kit family.
7. A homogeneous protein of Claim 6 in which the amino acid sequence is selected from the group consisting of: a) SAL-SI (SEQ ID NO:6); b) SAL-D4 (SEQ ID NO:8); c) LpTK 2 (SEQ ID NO:10); d) LpTK 3 (SEQ ID N0:12); e) LpTk 4 (SEQ ID N0:14); and f) LpTK 13 (SEQ ID NO:16). g) HpTK 5 (SEQ ID NO:24) h) bpTK 1 (SEQ ID NO:25) i) bpTK 2 (SEQ ID NO:26) j) bpTK 3 (SEQ ID NO:27) k) bpTK 4 (SEQ ID NO:28)
1) bpTK 5 (SEQ ID NO:29); and m) bpTK 7 (SEQ ID NO:30)
8. A protein of human megakaryocytic origin which exhibits significant sequence homology with the FLT/FLK family of protein tyrosine kinases.
9. A protein of Claim 8 encoded by the nucleotide sequence (SEQ ID NO:5).
10. A protein of Claim 8 encoded by the amino acid sequence (SEQ ID NO:6).
11. A protein of Claim 8 encoded by the nucleotide sequence (SEQ ID NO:17).
12. A protein of Claim 8 encoded by the amino acid sequence (SEQ ID NO: 18) .
13. A protein of human megakaryocytic origin which exhibits significant sequence homology with the FGF receptor family of protein tyrosine kinases.
14. A protein of Claim 10 encoded by the nucleotide sequence (SEQ ID NO:7) .
15. A protein of Claim 10 encoded by the amino acid sequence (SEQ ID NO:8).
16. A protein of human megakaryocytic origin which exhibits significant sequence homology with the NGF receptor family of protein tyrosine kinases.
17. A protein of Claim 14 encoded by the nucleotide sequence (SEQ ID NO:11).
18. A protein of Claim 14 encoded by the amino acid sequence (SEQ ID NO:12).
19. A DNA expression vector containing a DNA sequence of human megakaryocytic origin which hybridizes to a DNA fragment which hybridizes to DNA encoding an amino acid sequence present in the catalytic domain of a protein tyrosine kinase of the c-kit subgroup of protein kinases.
20. The DNA expression vector of Claim 17 containing a DNA sequence selected from the group consisting of: a) SAL-SI (SEQ ID N0:5); b) SAL-D4 (SEQ ID N0:7);
C) LpTK 2 (SEQ ID N0:9); d) LpTK 3 (SEQ ID N0:11); e) LpTk 4 (SEQ ID NO:13); and f) LpTK 13 (SEQ ID NO:15). g) LpTK 25 (SEQ ID NO: 22 and h( HpTK 5 (SEQ ID NO: 23).
21. A cell transformed by the expression vector of Claim 17.
PCT/US1993/000586 1992-01-22 1993-01-22 Novel protein tyrosine kinases WO1993015201A1 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
EP93903639A EP0624192A1 (en) 1992-01-22 1993-01-22 Novel protein tyrosine kinases
JP5513345A JPH07504813A (en) 1992-01-22 1993-01-22 Novel protein tyrosine kinases
US08/446,648 US6331302B1 (en) 1992-01-22 1995-04-04 Protein tyrosine kinase agonist antibodies
US09/982,610 US6673343B2 (en) 1992-01-22 2001-10-17 SAL-S1 receptor protein tyrosine kinase agonist antibodies

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US82693592A 1992-01-22 1992-01-22
US826,935 1992-01-22

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US82693592A Continuation-In-Part 1992-01-22 1992-01-22

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US08/222,616 Continuation-In-Part US5635177A (en) 1992-01-22 1994-04-04 Protein tyrosine kinase agonist antibodies

Publications (1)

Publication Number Publication Date
WO1993015201A1 true WO1993015201A1 (en) 1993-08-05

Family

ID=25247892

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1993/000586 WO1993015201A1 (en) 1992-01-22 1993-01-22 Novel protein tyrosine kinases

Country Status (5)

Country Link
EP (1) EP0624192A1 (en)
JP (1) JPH07504813A (en)
AU (1) AU3482493A (en)
CA (1) CA2128722A1 (en)
WO (1) WO1993015201A1 (en)

Cited By (35)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995007995A2 (en) * 1993-09-13 1995-03-23 Applied Immune Sciences, Inc. Adeno-associated viral (aav) liposomes and methods related thereto
WO1995015386A1 (en) * 1993-12-02 1995-06-08 Asahi Kasei Kogyo Kabushiki Kaisha Novel receptor tyrosine kinase
WO1995027061A1 (en) * 1994-04-04 1995-10-12 Genentech, Inc. Protein tyrosine kinase agonist antibodies
WO1995033050A1 (en) * 1994-05-26 1995-12-07 Metris Therapeutics Limited Flt-4 (fms-like tyrosine-kinase), flt-15, variants thereof uses as growth factor inhibitors
WO1996002645A2 (en) * 1994-07-20 1996-02-01 Genentech, Inc. Htk ligand
WO1996026958A2 (en) * 1995-02-27 1996-09-06 President And Fellows Of Harvard College Eph RECEPTOR LIGAND ELF-2
US5709858A (en) * 1993-11-23 1998-01-20 Genentech, Inc. Antibodies specific for Rse receptor protein tyrosine kinase
US5834208A (en) * 1993-08-25 1998-11-10 Asahi Kasei Kogyo Kabushiki Kaisha Tyrosine kinase
US5891650A (en) * 1993-11-23 1999-04-06 Genentech Incorporated Kinase receptor activation assay
US6001621A (en) * 1993-11-23 1999-12-14 Genetech, Inc. Protein tyrosine kinases
US6107046A (en) * 1992-10-09 2000-08-22 Orion Corporation Antibodies to Flt4, a receptor tyrosine kinase and uses thereof
US6287784B1 (en) 1993-11-23 2001-09-11 Genentech, Inc. Kinase receptor activation assay
US6326469B1 (en) 1994-04-22 2001-12-04 Sugen, Inc. Megakaryocytic protein tyrosine kinases
US6331302B1 (en) 1992-01-22 2001-12-18 Genentech, Inc. Protein tyrosine kinase agonist antibodies
US6368796B1 (en) 1997-01-08 2002-04-09 Beth Israel Deaconess Medical Center Methods of detection and treatment of breast cancer
US6451764B1 (en) 1995-09-08 2002-09-17 Genentech, Inc. VEGF-related protein
US6506578B1 (en) * 1994-04-22 2003-01-14 Sugen, Inc. Nucelotide encoding megakaryocytic protein tyrosine kinases
US6531296B1 (en) * 1995-06-20 2003-03-11 The University Of North Carolina At Chapel Hill Nuclear tyrosine kinase Rak
US6652850B1 (en) 1993-09-13 2003-11-25 Aventis Pharmaceuticals Inc. Adeno-associated viral liposomes and their use in transfecting dendritic cells to stimulate specific immunity
US6811992B1 (en) 1998-05-14 2004-11-02 Ya Fang Liu Method for identifying MLK inhibitors for the treatment of neurological conditions
US6824777B1 (en) 1992-10-09 2004-11-30 Licentia Ltd. Flt4 (VEGFR-3) as a target for tumor imaging and anti-tumor therapy
US6864227B1 (en) 1998-04-13 2005-03-08 California Institute Of Technology Artery-and vein-specific proteins and uses therefor
US6887674B1 (en) 1998-04-13 2005-05-03 California Institute Of Technology Artery- and vein-specific proteins and uses therefor
WO2005040413A1 (en) * 2003-10-24 2005-05-06 Esbatech Ag Method for the identification and/or validation of receptor tyrosine kinase inhibitors
US6969760B2 (en) * 1993-07-29 2005-11-29 St. Jude Children's Research Hospital Jak kinases and regulation of cytokine signal transduction
US7381410B2 (en) 2003-03-12 2008-06-03 Vasgene Therapeutics, Inc. Polypeptide compounds for inhibiting angiogenesis and tumor growth
US7585967B2 (en) 2003-03-12 2009-09-08 Vasgene Therapeutics, Inc. Nucleic acid compounds for inhibiting angiogenesis and tumor growth
US7977463B2 (en) 2004-03-12 2011-07-12 Vasgene Therapeutics, Inc. Polypeptide compounds for inhibiting angiogenesis and tumor growth
US8444957B2 (en) 1998-10-09 2013-05-21 Vegenics Pty Limited Methods of screening for neoplastic disease states
US8940695B2 (en) 2001-01-19 2015-01-27 Vegenics Pty Limited Flt4 (VEGFR-3) as a target for tumor imaging and anti-tumor therapy
US8975377B2 (en) 2007-08-13 2015-03-10 Vasgene Therapeutics, Inc Cancer treatment using humanized antibodies that bind to EphB4
US8981062B2 (en) 2004-03-12 2015-03-17 Vasgene Theapeutics, Inc Polypeptide compounds for inhibiting angiogenesis and tumor growth
US9533026B2 (en) 2004-09-23 2017-01-03 Vasgene Therapeutics, Inc Polypeptide compounds for inhibiting angiogenesis and tumor growth
US9745558B2 (en) 2013-02-18 2017-08-29 Vegenics Pty Limited VEGFR-3 ligand binding molecules and uses thereof
US11672803B2 (en) 2010-06-03 2023-06-13 Pharmacyclics Llc Use of inhibitors of Brutons tyrosine kinase (Btk)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1992014748A1 (en) * 1991-02-22 1992-09-03 American Cyanamid Company Identification of a novel human receptor tyrosine kinase gene

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1992014748A1 (en) * 1991-02-22 1992-09-03 American Cyanamid Company Identification of a novel human receptor tyrosine kinase gene

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
GENE vol. 110, no. 2, 15 January 1992, AMSTERDAM NL pages 205 - 211 BR[UNINGER, A. ET AL. 'Isolation and characterization of a human gene that encodes a new subclass of protein tyrosine kinases' *
MOLECULAR AND CELLULAR BIOLOGY vol. 9, no. 4, April 1989, WASHINGTON US pages 1587 - 1593 HAO, Q.-L. ET AL. 'Isolation and sequence analysis of a novel human tyrosine kinase gene' *
NEURON vol. 6, no. 5, May 1991, pages 691 - 704 LAI, C. & LEMKE, G. 'An extended family of protein-tyrosine kinase genes differentially expressed in the verterbrate nervous system' *
PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA vol. 87, November 1990, WASHINGTON US pages 8913 - 8917 PARTANEN, J. ET AL. 'Putative tyrosine kinases expressed in K-562 human leukemia cells' *
PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA vol. 88, no. 23, 1 December 1991, WASHINGTON US pages 10411 - 10415 HOLTRICH, U. ET AL. 'Two additional protein-tyrosine kinases expressed in human lung: fourth member of the fibroblast growth factor receptor family and an intracellular protein-tyrosine kinase' *

Cited By (73)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6331302B1 (en) 1992-01-22 2001-12-18 Genentech, Inc. Protein tyrosine kinase agonist antibodies
US6673343B2 (en) 1992-01-22 2004-01-06 Genentech, Inc. SAL-S1 receptor protein tyrosine kinase agonist antibodies
US5635177A (en) * 1992-01-22 1997-06-03 Genentech, Inc. Protein tyrosine kinase agonist antibodies
US7829091B2 (en) 1992-10-09 2010-11-09 Vegenics Limited Therapy targeting FLT4 (VEGER-3) expressed in blood vessels
US6824777B1 (en) 1992-10-09 2004-11-30 Licentia Ltd. Flt4 (VEGFR-3) as a target for tumor imaging and anti-tumor therapy
US6107046A (en) * 1992-10-09 2000-08-22 Orion Corporation Antibodies to Flt4, a receptor tyrosine kinase and uses thereof
US7034105B2 (en) 1992-10-09 2006-04-25 Licentia, Ltd. FLT4 (VEGFR-3) as a target for tumor imaging and anti-tumor therapy
US6969760B2 (en) * 1993-07-29 2005-11-29 St. Jude Children's Research Hospital Jak kinases and regulation of cytokine signal transduction
US5834208A (en) * 1993-08-25 1998-11-10 Asahi Kasei Kogyo Kabushiki Kaisha Tyrosine kinase
US5861171A (en) * 1993-09-13 1999-01-19 Rhone-Poulenc Rorer Pharmaceuticals Inc. Adeno-associated viral (AAV) liposomes and methods related thereto
US6652850B1 (en) 1993-09-13 2003-11-25 Aventis Pharmaceuticals Inc. Adeno-associated viral liposomes and their use in transfecting dendritic cells to stimulate specific immunity
WO1995007995A3 (en) * 1993-09-13 1995-07-20 Applied Immunesciences Adeno-associated viral (aav) liposomes and methods related thereto
WO1995007995A2 (en) * 1993-09-13 1995-03-23 Applied Immune Sciences, Inc. Adeno-associated viral (aav) liposomes and methods related thereto
US5861314A (en) * 1993-09-13 1999-01-19 Rhone-Poulenc Rorer Pharmaceuticals Inc. Adeno-associated viral (AAV) liposomes and methods related thereto
US5834441A (en) * 1993-09-13 1998-11-10 Rhone-Poulenc Rorer Pharmaceuticals Inc. Adeno-associated viral (AAV) liposomes and methods related thereto
US7033796B2 (en) 1993-11-23 2006-04-25 Genentech, Inc. Nucleic acids encoding protein tyrosine kinases
US6096527A (en) * 1993-11-23 2000-08-01 Genentech Inc Nucleic acids encoding protein tryosine kinases
US5709858A (en) * 1993-11-23 1998-01-20 Genentech, Inc. Antibodies specific for Rse receptor protein tyrosine kinase
US5891650A (en) * 1993-11-23 1999-04-06 Genentech Incorporated Kinase receptor activation assay
US6825324B2 (en) 1993-11-23 2004-11-30 Genentech, Inc. Antibodies to receptor protein tyrosine kinases
US5914237A (en) * 1993-11-23 1999-06-22 Genentech Incorporated Kinase receptor activation assay
US6001621A (en) * 1993-11-23 1999-12-14 Genetech, Inc. Protein tyrosine kinases
US6025145A (en) * 1993-11-23 2000-02-15 Genentech, Inc. Kinase receptor activation assay
US6087144A (en) * 1993-11-23 2000-07-11 Genentech, Inc. Protein tyrosine kinases
US5766863A (en) * 1993-11-23 1998-06-16 Genentech, Inc. Kinase receptor activation assay
US6287784B1 (en) 1993-11-23 2001-09-11 Genentech, Inc. Kinase receptor activation assay
WO1995015386A1 (en) * 1993-12-02 1995-06-08 Asahi Kasei Kogyo Kabushiki Kaisha Novel receptor tyrosine kinase
EP2067790A3 (en) * 1994-04-04 2010-12-01 Genentech, Inc. Agonist antibody against protein tyrosine kinase SAL-S1
WO1995027061A1 (en) * 1994-04-04 1995-10-12 Genentech, Inc. Protein tyrosine kinase agonist antibodies
US6326469B1 (en) 1994-04-22 2001-12-04 Sugen, Inc. Megakaryocytic protein tyrosine kinases
US6908984B2 (en) 1994-04-22 2005-06-21 Sugen, Inc. Megakaryocytic protein tyrosine kinase I
US6506578B1 (en) * 1994-04-22 2003-01-14 Sugen, Inc. Nucelotide encoding megakaryocytic protein tyrosine kinases
US7037677B2 (en) 1994-04-22 2006-05-02 Sugen, Inc. Megakaryocytic protein tyrosine kinase I
WO1995033050A1 (en) * 1994-05-26 1995-12-07 Metris Therapeutics Limited Flt-4 (fms-like tyrosine-kinase), flt-15, variants thereof uses as growth factor inhibitors
US5864020A (en) * 1994-07-20 1999-01-26 Genentech, Inc. HTK ligand
AU705107B2 (en) * 1994-07-20 1999-05-13 Genentech Inc. HTK ligand
WO1996002645A2 (en) * 1994-07-20 1996-02-01 Genentech, Inc. Htk ligand
WO1996002645A3 (en) * 1994-07-20 1996-02-15 Genentech Inc Htk ligand
US5624899A (en) * 1994-07-20 1997-04-29 Genentech Inc. Method for using Htk ligand
WO1996026958A2 (en) * 1995-02-27 1996-09-06 President And Fellows Of Harvard College Eph RECEPTOR LIGAND ELF-2
WO1996026958A3 (en) * 1995-02-27 1996-10-10 Harvard College Eph receptor ligand elf-2
US6531296B1 (en) * 1995-06-20 2003-03-11 The University Of North Carolina At Chapel Hill Nuclear tyrosine kinase Rak
US7629145B2 (en) 1995-09-08 2009-12-08 Genentech, Inc. VEGF-related protein
US6451764B1 (en) 1995-09-08 2002-09-17 Genentech, Inc. VEGF-related protein
US6576608B1 (en) 1995-09-08 2003-06-10 Genentech, Inc. Methods of using VEGF-related protein
US6368796B1 (en) 1997-01-08 2002-04-09 Beth Israel Deaconess Medical Center Methods of detection and treatment of breast cancer
US7595044B2 (en) 1998-04-13 2009-09-29 California Institute Of Technology Artery-and vein-specific proteins and uses therefor
US7939071B2 (en) 1998-04-13 2011-05-10 California Institute Of Technology Artery- and vein-specific proteins and uses therefor
US6864227B1 (en) 1998-04-13 2005-03-08 California Institute Of Technology Artery-and vein-specific proteins and uses therefor
US6887674B1 (en) 1998-04-13 2005-05-03 California Institute Of Technology Artery- and vein-specific proteins and uses therefor
US7700297B2 (en) 1998-04-13 2010-04-20 California Institute Of Technology Artery- and vein-specific proteins and uses therefor
US7741272B2 (en) 1998-04-13 2010-06-22 California Institute Of Technology Artery- and vein-specific proteins and uses therefor
US7264942B2 (en) 1998-05-14 2007-09-04 Ya Fang Liu Method for identifying JNK and MLK inhibitors for treatment of neurological conditions
US7452686B2 (en) 1998-05-14 2008-11-18 Ya Fang Liu JNK inhibitors for the treatment of neurological disorders
US6811992B1 (en) 1998-05-14 2004-11-02 Ya Fang Liu Method for identifying MLK inhibitors for the treatment of neurological conditions
US8444957B2 (en) 1998-10-09 2013-05-21 Vegenics Pty Limited Methods of screening for neoplastic disease states
US8940695B2 (en) 2001-01-19 2015-01-27 Vegenics Pty Limited Flt4 (VEGFR-3) as a target for tumor imaging and anti-tumor therapy
US9260526B2 (en) 2001-01-19 2016-02-16 Vegenics Pty Limited Flt4 (VEGFR-3) as a target for tumor imaging and anti-tumor therapy
US7862816B2 (en) 2003-03-12 2011-01-04 Vasgene Therapeutics, Inc. Polypeptide compounds for inhibiting angiogenesis and tumor growth
US8063183B2 (en) 2003-03-12 2011-11-22 Vasgene Therapeutics, Inc. Polypeptide compounds for inhibiting angiogenesis and tumor growth
US8273858B2 (en) 2003-03-12 2012-09-25 Vasgene Therapeutics, Inc. Polypeptide compounds for inhibiting angiogenesis and tumor growth
US7381410B2 (en) 2003-03-12 2008-06-03 Vasgene Therapeutics, Inc. Polypeptide compounds for inhibiting angiogenesis and tumor growth
US7585967B2 (en) 2003-03-12 2009-09-08 Vasgene Therapeutics, Inc. Nucleic acid compounds for inhibiting angiogenesis and tumor growth
US7566528B2 (en) 2003-10-24 2009-07-28 Esbatech Ag Method for the identification and/or validation of receptor tyrosine kinase inhibitors
WO2005040413A1 (en) * 2003-10-24 2005-05-06 Esbatech Ag Method for the identification and/or validation of receptor tyrosine kinase inhibitors
US7977463B2 (en) 2004-03-12 2011-07-12 Vasgene Therapeutics, Inc. Polypeptide compounds for inhibiting angiogenesis and tumor growth
US8981062B2 (en) 2004-03-12 2015-03-17 Vasgene Theapeutics, Inc Polypeptide compounds for inhibiting angiogenesis and tumor growth
US9533026B2 (en) 2004-09-23 2017-01-03 Vasgene Therapeutics, Inc Polypeptide compounds for inhibiting angiogenesis and tumor growth
US8975377B2 (en) 2007-08-13 2015-03-10 Vasgene Therapeutics, Inc Cancer treatment using humanized antibodies that bind to EphB4
US11672803B2 (en) 2010-06-03 2023-06-13 Pharmacyclics Llc Use of inhibitors of Brutons tyrosine kinase (Btk)
US9745558B2 (en) 2013-02-18 2017-08-29 Vegenics Pty Limited VEGFR-3 ligand binding molecules and uses thereof
US10494617B2 (en) 2013-02-18 2019-12-03 Vegenics Pty Limited Ligand binding molecules and uses thereof
US11866739B2 (en) 2013-02-18 2024-01-09 Vegenics Pty Limited Ligand binding molecules and uses thereof

Also Published As

Publication number Publication date
CA2128722A1 (en) 1993-08-05
AU3482493A (en) 1993-09-01
JPH07504813A (en) 1995-06-01
EP0624192A1 (en) 1994-11-17

Similar Documents

Publication Publication Date Title
WO1993015201A1 (en) Novel protein tyrosine kinases
JP3193301B2 (en) Bioactive protein p160
Damen et al. The 145-kDa protein induced to associate with Shc by multiple cytokines is an inositol tetraphosphate and phosphatidylinositol 3, 4, 5-triphosphate 5-phosphatase.
Wong et al. A protein-binding domain, EH, identified in the receptor tyrosine kinase substrate Eps15 and conserved in evolution.
Beck et al. The complete coding sequence of the human A-raf-1 oncogene and transforming activity of a human A-raf carrying retrovirus
Sanchez et al. Multiple tyrosine protein kinases in rat hippocampal neurons: isolation of Ptk-3, a receptor expressed in proliferative zones of the developing brain.
Cai et al. AND-34, a novel p130Cas-binding thymic stromal cell protein regulated by adhesion and inflammatory cytokines
US6255472B1 (en) Isolated nucleic acid molecule encoding a human skeletal muscle-specific receptor
Kusk et al. Interactions of protein kinase CK2β subunit within the holoenzyme and with other proteins
US5656595A (en) Peptides having GDP exchange factor activity, nucleic acid sequences coding for these peptides, preparation and use
US20020032310A1 (en) Fibroblast growth factor receptor activating gene I and related compositions and methods
AU2001263952B2 (en) Tumour suppressor and uses thereof
JP2005519584A5 (en)
Gardner et al. Cloning, characterization, and chromosomal localization of Pnck, a Ca2+/calmodulin-dependent protein kinase
Ogawa et al. Molecular cloning of a novel RING finger-B box-coiled coil (RBCC) protein, terf, expressed in the testis
Kunita et al. Identification and characterization of novel members of the CREG family, putative secreted glycoproteins expressed specifically in brain
EP1125947B1 (en) Human H37 protein and cDNA encoding the same
WO1997045542A2 (en) Cell growth regulatory genes
WO1999001559A1 (en) Novel mapk kinase
Park Cloning, sequencing, and overexpression of SH2/SH3 adaptor protein Nck from mouse thymus
US6803204B2 (en) Biologically active alternative form of the IKKα IκB kinase
Hughes et al. Cloning and Chromosomal Localization of a Mouse cDNA with Homology to theSaccharomyces cerevisiaeGene Zuotin
AU701901B2 (en) Cytoplasmic tyrosine kinase
US20040109854A1 (en) Novel traf6 inhibiting protein
WO2002053704A2 (en) Protein-protein interactions

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU CA JP US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LU MC NL PT SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 08222616

Country of ref document: US

WWE Wipo information: entry into national phase

Ref document number: 2128722

Country of ref document: CA

Ref document number: 1993903639

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 1994 256769

Country of ref document: US

Date of ref document: 19940915

Kind code of ref document: A

WWP Wipo information: published in national office

Ref document number: 1993903639

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1993903639

Country of ref document: EP