WO1992005278A2

WO1992005278A2 - Method for the determination of the differential expression of mrna for the amyloid precursor protein (app)

Info

Publication number: WO1992005278A2
Application number: PCT/EP1991/001772
Authority: WO
Inventors: Francesco Della Valle; Antonio Morandi; Alessandro Negro; Lanfranco Callegaro
Original assignee: Fidia S.P.A.
Priority date: 1990-09-17
Filing date: 1991-09-17
Publication date: 1992-04-02
Also published as: AU8492591A; IT9041691A0; IT9041691A1; IT1243515B; WO1992005278A3; CN1062925A

Abstract

A method is provided for the qualitative and quantitative determination of the expression of the various mRNA's for the human Amyloid Precursor Protein (APP) in human biological tissues, which methodology can be used for a diagnostic test for Alzheimer's Disease.

Description

METHOD FOR THE DETERMINATION OF THE DIFFERENTIAL EXPRESSION OF mRNA FOR THE AMYLOID PRECURSOR PROTEIN (APP)

BACKGROUND OF THE INVENTION Alzheimer's Disease (AD), a neurodegenerative disease, can be either sporadic or familial (autoso al dominant) and results in the progressive loss of intellectual and mnemonic function until total dementia, of which it is the most common cause. Ten percent of the population over 65 years of age and 30% of that over 80 years are affected by AD.

Due to the severely disabling effects and chronic course of the disease, its social and economic costs are enormous.

The etiology of AD is unknown and, to date, no efficacious therapeutic treatment is available. Diagnosis is also fraught with problems, since in the absence of specific clinical or laboratory markers, accurate diagnosis of AD can only be guaranteed post-mortem, by pathological analysis of brain tissue. Neuropathological diagnosis is based on the presence in the brain of neurofibrillary tangles (NFT) neuronal degeneration and neuritic or senile plaques (SP) . These same lesions have also been observed in brains from sufferers from Trisomy 21 (Down's Syndrome, DS) surviving over the age of 35-40 years, and, to a lesser degree, in normal aging. SP's represent the most specific pathological marker for AD and are composed of extracellular deposits of amyloid surrounded by distrophic nerve endings and glial processes ( isniewski, H. M. et al., Prog. Neuropathol. 2 , p. 101, 1973; Perry, E. K. et al., Trends Neurosci. 8., p. 301, 1985). SP's and especially the deposits of amyloid material, seem to be an early event both in AD and DS (Giaccone, G. et al., Neurosci. Lett. 97, p. 232, 1989) , and their numbers are correlated with the severity of dementia (Blessed, G. et al., Br. J. Psychiatry 114, p. 797, 1968). The same type of amyloid deposit has been observed also in intracortical and eningeal blood vessel walls (Glenner, G. G. et al., Biochem. Biophys. Res. Commun. 120. p. 1131, 1984) .

The amyloid found in SP's and in the blood vessels has proved to be composed of a protein with 39-43 amino acid residues (PM = 4.2 kD) which aggregates in insoluble oligomeric forms (Blessed, G. et al., Br. J. Psychiatry 114, p. 797, 1968;

Masters, C. L. et al., Proc. Natl. Acad. Sci. USA 82, p. 4245, 1985) . This protein, called A4 or beta (Beta Amyloid Protein, BAP) , derives from a much larger precursor, β-amyloid precursor protein (β- APP) , with a primary structure, deduced from its isolated cDNA, which presents a membrane glycoprotein of 695 amino acids (AA) with a large extracellular portion and a small intracytoplasmic portion (Kang, J. et al., Nature 325, p. 733, 1987). In the APP sequence the βAP fragment includes 28

AA's immediately outside the membrane plus the first 11-14 AA's of the trans-membrane hydrophobic portion. The APP gene has been localized on chromosome 21 (Kang, J. et al., Nature 325. p. 733, 1987; Goldgaber, D. et al. , Science 235, p. 877, 1987; Robakis, N. K. et al., Proc. Natl. Acad. Sci. USA 84., p. 4190, 1987; Tanzi, R. E. et al., Science 235, p. 880, 1987) and produces at least 4 forms of mRNA by the alternative splicing of 2 exons (Ponte, P. et al., Nature 331, p. 525, 1988; Tanzi, R. E. et al., Nature 331, p. 528, 1988; Kitaguchi, C. et al., Nature 331. p. 530, 1988; Golde, T. et al. , Neuron 4., p. 253, 1990): one which encodes a domain of 56 AA's analogous to a Kunitz protease inhibitor (KPI) , the other encoding a domain of 19 AA's, homologous to a degree of 47% to the anti-gene MRC OX-2 found in neurons and thymocytes ( eidemann, A. et al., Cell 52, p. 115, 1989). A fifth form has been identified which encodes a secreted polypeptide lackin-r BAP, trans-membrane and intracytoplasmic regions, (de Sauvage, F. et al., Science 245. p. 651, 1989) .

The 4 mRNA's of the APP's are identified as APP₆₉₅, APP_71A, APP₇₅₁ and APP₇₇₀, according to the number of amino acid residues of the coded proteins. mRNA APP₆₉₅ contains none of the alternative sequences, mRNA APP₇₁₄ contains the insert of 19 AA, mRNA APP₇₅₁ contains the insert of 56 AA of the KPI, and mRNA APP₇₇₀ contains the inserts of both 19 and 56 AA's. The 4 mRNA's are expressed, in different proportions, in all tissues (Goldgaber, D. et al., Science 235, p. 877, 1987; Robakis, N. K. et al., Proc. Natl. Acad. Sci. USA .84., P- 4190, 1987; Tanzi, R. E. et al., Science 235, p. 880, 1987). However, the APP₆₉₅ form of mRNA predominates to a great extent in the central nervous system (CNS) , while in the peripheral tissues the forms with the KPI insert are the most frequent (Tanzi, R. E. et al., Nature 331. p. 528, 1988). The APP₇₁₄ form of mRNA is present only in minimal quantities (Golde, T. et al., Neuron 4_., p. 253, 1990).

Apart from data deriving from neuropathological observations, two considerations indicate a crucial role which altered expression of the gene for APP may have in amyloid deposit and in the evolution of AD:

1. Sufferers from DS, who have 3 copies of the gene for APP since this is localized on chromosome 21, express high levels of mRNA for APP and invariably develop AD if they survive over 35-40 years. Furthermore, in DS the first deposits of BAP precede the onset of evident neuro-pathological lesions, thus establishing a possible time-cause relationship (Giaccone, G. et al., Neurosci. Lett. ,97., p. 232, 1989).

2. Sufferers from a rare form of hereditary brain hemorrhage characterized by deposits of BAP in the walls of the cerebral and meningeal blood vessels as well as by diffuse cortical deposits as found in AD and DS, present a point mutation in the BAP region of the APP gene. This mutation has never been seen in normal individuals or sufferers from AD or familial AD and it therefore constitutes the principal defect in hereditary cerebral hemorrhage with amyloid deposit. Furthermore, since the mutation is very close to the normal breakage site of the APP, it alters the efficiency of the pre-disposed enzymes, causing an aberrant release of BAP (Levy, E. et al., Science 248, 1124, 1990).

However, numerous studies to investigate a mutation and duplication of the APP gene or genetic linkage in sporadic or familial AD have given negative results. Since the APP gene does not therefore seem to be structurally or quantitatively altered in AD, the deposit of BAP must derive from an aberrant metabolism of APP or regulation of the total and/or differential expression of its alternative forms of mRNA.

Altered proportions in the expression of the various forms of mRNA of APP could influence its post-translational metabolism, bringing about the release of the BAP fragment and its extracellular deposit.

Recent studies have shown that while there is a clear prevalence of expression of the mRNA APP₆₉₅ in the CNS compared to other tissues, quite the opposite happens in the pyramidal neurons of the hippocampus of AD sufferers, where there is a prevalence of mRNA APP751 (Johnson, S. A., Science 248. p. 854, 1990). Such neurons always express both forms of mRNA, APP₆₉₅ and APP₇₅₁, but the ratio is reversed to 2:1 in favor of the APP₇₅₁ form. This variation in ratio is due to an increase in expression of the mRNA APP₇₅₁ and not to a decrease in the mRNA APP₆₉₅, since expression of the latter remains unaltered. There is also a linear relationship between the increase in the mRNA

APP₇₅₁/APP₆₉₅ ratio and the density of SP's in the regions examined. A relationship can therefore be hypothesized between altered regulation of the differential expression of the various types of mRNA APP and the pathological evolution of the SP's and therefore of AD itself. These observations and the fact that between DS patients and controls the ratio of mRNA APP levels is higher than the expected ratio of 3:2 (Tanzi, R. E. et al., Science 235, p. 880, 1987) , emphasize the importance of regulation of APP expression over its possible structural alterations in the pathogenesis of AD.

The expression of mRNA APP can be regulated by various factors: phorbol esters, heparin binding growth factor and interleukin-1 (IL-1) (Goldgaber et al., PNAS Vol. 86, p. 7606, 1989). IL-1 is one of the most important modulators of the immune response to trauma, infection or inflammation (Dinarello, C. A., FASEB J. 2, p. 108, 1988), and it is also expressed in the CNS (Fontana, A., J. Neurosci. Res. 8., p. 443, 1982), with various roles, including the proliferative glial reaction following lesion of the nervous tissue (Giulian D. & Lachman L.B., Science, 228 p. 497, 1987). Very high levels of IL-1 have been found in AD and DS brains (Griffin, W.S.T. et al., Proc. Natl. Acad. Sci. USA 8_6, p. 7611, 1989). It therefore follows that the conditions which can lead to increased expression of the APP gene are present in both cases. Moreover, possible inter- relationships have been documented between the product of the APP gene of AD and the amyloid material of other neurodegenerative diseases, both human, such as Creutzfeldt- acob disease or the Gerst ann-Straussler syndrome (Kitamoto, T. et al, Lab. Invest. 5_7, p. 230, 1987) , and animal, such as scrapie, (De Armond, S.J., et al., Neurology 37_., p. 1271, 1987).

Descriptions of currently available data show that: - altered regulation of the APP gene is a quiescent event in AD-prone subjects; - such quiescence can be activated in the presence of specific deregulating stimuli; the deregulating stimuli are present and/or they act only in certain tissues or parts of the same, this being where there is aberrant expression of the APP gene. In the other tissues, aberrant expression stays quiescent.

DETAILED DESCRIPTION OF THE INVENTION

An object of the present invention is, therefore, a method to determine aberrant expression of the APP gene, starting from in vitro cultures of tissues suitably stimulated with biological or chemical agents. The possibility of specifically inducing, in peripheral tissue, specifically fibroblasts, a marker representing a pathological situation in the CNS, represents an efficacious diagnostic tool for neurodegenerative diseases linked with alterations in APP expression and opens up new possibilities for their prevention and therapy. Moreover, the method described here can be, in its essential points, applied to recognizing aberrant gene expression with a structural/regulatory relationship to APP.

The methodology of the present invention can be utilized with any kind of human or animal biological tissue in culture. The important criterion, however, is that the tissue be capable of differential expression of the mRNA's for human APP. As an example, described herein are procedures which utilize human fibroblasts. However, other useful tissues, i.e. peripheral tissues, could be determined by following the methodology described hereinbelow.

The methodology of the invention generally comprises:

1. Growing a cell culture. 2. Treating the cell culture to stimulate differential expression of the APP mRNA's.

3. Extracting and collecting RNA from the cell culture. 4. Subjecting the collected RNA to reverse transcription (RT) .

5. Amplifying the RT product to PCR amplification.

6. Separating the amplification products with polyacrylamide gel.

7. Staining and developing under UV to determine the differential expression of the APP mRNA's.

1. Cell Culturin : The methodologies of sample taking, culture and maintenance in vitro are those normally used in all laboratories and are therefore commonly known to those skilled in the art.

In this example, utilized are human fibroblasts from donors suffering from sporadic or familial AD and from corresponding normal and pathological controls. The cell cultures were kept in DMEM plus 10% of FCS and antibiotics.

2. Stimulation of mRNA Expression: The cell culture is then treated with an agent capable of stimulating differential expression of the human APP on RNA's. A preferred agent is interleukin-1 (IL-1) . Also useful, however, are other agents, such as animal or human cytokinins, N- substituted derivatives of adenine which promote cell division and stimulate RNA synthesis.

To effect stimulation, once confluence is reached, the cells are treated with 10 μ/ml of human beta interleukin 1 for 24 hours. At this point the RNA is prepared.

3. Extraction of RNA:

The ribonucleic acid (RNA) is then extracted from the cells. Methods for the extraction of RNA are per se known, such as described in Maniatis et al., Molecular Cloning, A Laboratory Manual, 2nd Ed. (1989) . Particularly preferred herein is a method employing guanidine/phenol. The plates are washed with phosphate-buffered saline (PBS) , then the cells are lysed in solution A, composed of an inactivator for RNAases, 5 M guanidine isothiocyanate, 25 mM Sodium Citrate, pH7, 0.5% Sarcosyl and a reducing agent, 0.1M beta mercaptoethanol. The lysate is gathered and 200 μl of 2M sodium acetate pH4 are added. After shaking, 2 ml of phenol saturated with water are added. It is shaken again and 1ml of a 1:1 mixture of chloroform:isoamyl alcohol are added. After shaking the lysate for 10 seconds it is left in ice for 10 minutes and then centrifuged at 10,000 rpm for 20 minutes at 4^βC. The supernatant is gathered and mixed with an equal volume of isopropanol, it is left for 1 hour at -20°C and then centrifuged at 10,000 rpm for 10 minutes at 4°C. The supernatant is eliminated and the pellet resuspended in 400 μl of solution A. A further 400 μl of isopropanol are added. It is shaken and left at -20°C for 1 hour. Then it is centrifuged again at 10,000 rpm for 10 minutes at 4°C, the supernatant is eliminated and the pellet is washed with 75% of ethanol and then vacuum-dried. The RNA is resuspended in water and is then ready for subsequent treatment for synthesis of the cDNA. 4. Reverse Transcription: β-APP cDNA's are prepared by reverse transcription (RT) , described, for example, by Maniatis et al. The first copy of cDNA is synthesized using as primary sequence an oligonucleotide with 12 to 18 (preferably 17) base pairs of all thymidines, oligo(dT) , which maps on the poly A of all mRNA and MMLV as enzyme which catalyzes the reverse transcriptase reaction (RT) . Other catalyzing enzymes can also be used, such as avian or murine transcriptase. This reaction is effected as follows:

To 2 μg of total RNA are added: 100 pM of oligo(dT) (Boehringer) , 10U of RNAase inhibitor

(Promega) , 200U MMLV (BRL) , and nucleotides dATP, dTTP, dCTP and dGTP at a concentration of 0.5mM. The reaction is conducted in the presence of a reaction buffer for PCR of the Perkin-Elmer Cetus Amplifier kit in a total volume of 20 μl. After heating the mRNA and the oligonucleotides to 95°C for two minutes and then cooling them in ice, all the aforesaid reagents are added and the mixture is left to stand at 42°C for 1 hour.

5. Amplification:

Differential expression of the APP gene is assessed by using the Polymerase Chain Reaction (PCR) technique (Saiki, R.K. et al., Science 230. p 130, 1985). The use of PCR to amplify βAPP RNAs has been referred to as PRT (PCR amplification of reverse transcribed mRNA, Golde, T.E. et al., Neuron, Vol. 4, 253-267, Feb. 1990) .

Under this procedure, two synthetic oligonucleotides are used for the amplification reaction and placed round the splicing domain, to enable amplification of the transcripts of all dimensions. The distance between the two oligonucleotides is such as to maximize the information relative to the 695, 751 and 770 AA forms.

The oligonucleotides are synthesized on an Applied Biosystem Model 38OB, by a phosphora ide chemistry technique. The synthesized oligonucleotides have the following nucleotide sequences:

5'CACAGACTATGCAGATGGGAGTGAAG 3' (SEQ. ID No. 1) and

5'GGCATCAGGGGTACTGGCTGCTGTTG 3 (SEQ. ID No. 2) and refer to the sequence drawn from the APP published in Kang, J. et al., Nature 325. p. 733, 1987. The first oligonucleotide is based on the APP sequence between base pairs 642 and 667, the second oligonucleotide between base pairs 871 and 897, in this case however, taking the complementary sequence to allow for PCR.

The oligonucleotides are treated for 12 hours at 55°C and vacuum-dried. They are then resuspended in Ammonium Acetate 2.5 M pH7 and precipitated in 3 volumes of 80% ethanol, dried again and then resuspended in water and their concentration assessed by spectrophotometry. Amplification is conducted on a Perkin Elmer Cetus DNA Thermal Cycler, using as reagents those of the relative DNA

TM Amplifier kit (Perkin Elmer-Cetus) . In short, a mixture of 100 μM of each oligonucleotide was used, 0.5 μM each of nucleotides dATP, dCTP, dGTP and dTTP, 1/3 of the reverse transcriptase reaction previously described and reaction buffer in a total mixture of 50 μl with 2U of Taq polymerase.

The 50 μl of reaction product thus obtained are divided into three aliquots and applied to the DNA amplifier set as follows: 1 minute at 94°C for denaturation, 2 minutes at 54°C and 2 minutes copying at 72°C, for a total of 30 cycles. To monitor the amplification reaction, aliquots are taken from the instrument at the 20th, 25th and 30th cycles.

6. Separation and Determination of mRNA Expression:

The amplified mRNA products are next analyzed either quantitatively or qualitatively to determine the relative levels of expression of the β-APP mRNAs. Separation is preferably conducted by gel electrophoresis, e.g. on polyaery1 mide gel. Analysis of expressed mRNAs can, for example, be performed by Northern blot analysis, autoradiography or polyacrylamide gel, SI nuclease protection assay, dot and slot hybridization, primer extension assay, solution hybridization, filter hybridization (Williams et al., Meth. Enz. 128, 671, 1986; Maniatis et al., 1989) and densitometric measurement. A preferred method, however, comprises separation of the mRNAs on polyacrylamide gel followed by staining with ethidium bromide. The stained gel is then exposed to UV light and photographe . According to the invention, differential expression of mRNAs from the IL-1-treated cells is analyzed by comparison of (A) mRNA products from known normal cells, (B) mRNA products from the IL-1, treated cells, (C) a negative PCR control and (D) molecular weight markers. Comparison of mRNA expression in the IL-treated cells for altered expression as compared to that of normal cells can then be used as a diagnostic tool for Alzheimer's Disease (AD) . In particular, an altered, specifically increased expression of APP₇₅₁ as particularly measured by an increased ratio of APP₇₅₁ to APP₆₉₅.

For conducting analysis by the ethidium bromide staining procedure, the amplification products thus obtained are separated in an 8% polyacrylamide gel, then stained with a solution of 1 μg/ml ethidium bromide and quickly washed in water. The gel is photographed under UV light and the photographed gel is shown in Figure 1. In the example shown in

Figure 1, normal cells are present in line A, in line B cells treated with IL IB, in line C the negative PCR control and in line D the Boehringer molecular weight marker. Referring to the results shown in Figure 1:

The 481 bp form corresponds to the 770 Aa form of the APP protein.

The 424 bp form corresponds to the 751 Aa form of the APP protein. The 256 bp form corresponds to the 695 Aa form of the APP protein.

As can be seen, interleukin 1 is able to direct an increase in expression of the band coding the APP751 protein. The invention being thus described, it is clear that this methodology can be modified in various ways. Such modifications are not to be considered as divergences from the spirit and purpose of the invention and any modification which would be apparent to an expert in the art comes within the scope of the following claims.

Claims

1. A method for diagnosing Alzheimer's disease which comprises: stimulating mRNA expression in a cell culture comprised of tissue from a patient to be diagnosed; and analyzing the expressed mRNA products from said patient tissue culture for differential expression of mRNA of human APP as compared to normal tissue cells.

2. The method according to claim 1, wherein said stimulation of mRNA expression is conducted by treatment of said patient tissue culture with human β interleukin 1 (IL 1) .

3. The method according to claim 1, wherein said stimulation of mRNA expression is conducted by treatment of said patient tissue culture with human or animal cytokinins.

4. The method according to claim 1, wherein said tissue is peripheral cell tissue.

5. The method according to claim 4, wherein said peripheral tissue is human fibroblast cell tissue.

6. The method according to claim 1, wherein said tissue is from human central or peripheral nerve tissue.

7. The method according to claim 1, wherein the mRNA products produced by said stimulated cell culture are amplified by means of polymerase chain reaction (PCR) .

8. The method according to claim 7, wherein said PCR utilizes at least one oligonucleotide selected from

5' CACAGACTATGCAGATGGGAGTGAAG 3' (SEQ. ID No. 1) and

5' GGCATCAGGGGTACTGGCTGCTGTTG 3' (SEQ. ID No. 2).

9. The method according to claim 8, wherein said oligonucleotides are employed simultaneously.

10. The method according to claim 1, wherein said analysis is quantification of mRNA of APP by staining with ethidium bromide after separation of said mRNAs by electrophoresis on polyacrylamide gel.

11. The method according to claim 1 wherein said analysis is quantification by densitometric measurement.

12. A method for diagnosing Alzheimer's disease which comprises: culturing human fibroblasts from a patient to be diagnosed; treating said fibroblasts with human interleukin 1 to stimulate mRNA expression; subjecting the thus produced mRNA products to reverse transcription to produce βAPP cDNAs; amplifying said βAPP cDNAs by polymerase chain reaction; separating the produced mRNAs by electrophoresis on polyacrylamide gel; and analyzing the mRNA products for altered expression of mRNA of human APP by said fibroblasts as compared to normal tissue cells.

13. The method according to claim 12, wherein said analysis of mRNA products comprises: staining said polyacrylamide gel with ethidium bromide; and exposing said stained gel to UV light.

14. The method according to claim 12, wherein said PCR utilizes at least one oligonucleotide selected from

5' CACAGACTATGCAGATGGGAGTGAAG 3' (SEQ. ID No. 1) and

5' GGCATCAGGGGTACTGGCTGCTGTTG 3' (SEQ. ID No. 2) .

15. The method according to claim 14, wherein said oligonucleotides are employed simultaneously.

16. A method for the determination of differen¬ tial expression of mRNA for the amyloid precursor pro¬ tein (APP) which comprises: stimulating mRNA expression in a cell culture comprised of a first tissue; and analyzing the expressed mRNA products from said first tissue culture for differential expression of mRNA of human APP as compared to normal tissue cells.

17. The method according to claim 16, wherein said stimulation of mRNA expression is conducted by treatment of said first tissue culture with human β interleukin 1 (IL 1).

18. The method according to claim 16, wherein said stimulation of mRNA expression is conducted by treatment o said first tissue culture with human or animal cytokinins.

19. The method according to claim 17, wherein said first tissue is human fibroblast cell tissue.

20. A method for the determination of the differen¬ tial expression of mRNA for the amyloid precursor protein

(APP) which comprises: culturing human fibroblasts from a first tissue; treating said fibroblasts with human interleukin 1 to stimulate mRNA expression; subjecting the thus produced mRNA products to reverse transcription to produce βAPP cDNAs; amplifying said βAPP cDNAs by polymerase chain reaction; separating the produced mRNAs by electrophoresis on poly¬ acrylamide gel; and analyzing the mRNA products for altered expression of mRNA of human APP by said fibroblasts as compared to normal tissue cells.

21. The method according to claim 20, wherein said analysis of mRNA products comprises: staining said polyacrylamide gel with ethidium bromide; and exposing said stained gel to UV light.

22. The method according to claim 21, wherein said PCR utilizes at least one oligonucleotide selected from 5' CACAGACTATGCAGATGGGAGTGAAG 3' (SEQ. ID No. 1) and

5' GGCATCAGGGGTACTGGCTGCTGTTG 3' (SEQ. ID No. 2).