US20030162194A1 - Diagnosis of diseases associated with apoptosis - Google Patents
Diagnosis of diseases associated with apoptosis Download PDFInfo
- Publication number
- US20030162194A1 US20030162194A1 US10/240,452 US24045203A US2003162194A1 US 20030162194 A1 US20030162194 A1 US 20030162194A1 US 24045203 A US24045203 A US 24045203A US 2003162194 A1 US2003162194 A1 US 2003162194A1
- Authority
- US
- United States
- Prior art keywords
- dna
- recited
- sequences
- genes
- oligomer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
- A61P11/06—Antiasthmatics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/12—Drugs for disorders of the urinary system of the kidneys
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/04—Antihaemorrhagics; Procoagulants; Haemostatic agents; Antifibrinolytic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4702—Regulators; Modulating activity
- C07K14/4703—Inhibitors; Suppressors
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/82—Translation products from oncogenes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/154—Methylation markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Definitions
- Apoptosis takes place in response to a variety of stimuli that trigger biochemical pathways that result in a characteristic set of processes leading to cell death.
- the stimuli that trigger apoptosis can include the levels of essential growth factors, treatment with glucocorticoids, irradiation, and activation of certain receptors. These trigger a variety of biochemical pathways.
- the ‘classical’, pathway comprises of a ligand-receptor interaction which triggers the activation of a protease. This leads to the release of cytochrome C from mitochondria. This in turn activates a series of proteases, whose actions culminate in the destruction of cellular structures.
- a common pathway involves activation of caspase-8 by oligomerization at an activated surface receptor.
- Caspase-8 cleaves Bid, which triggers release of cytochrome c from mitochondria.
- the cytochrome c causes Apaf-1 to oligomerize with caspase-9.
- the activated caspase-9 cleaves procaspase-3, whose two subunits then form the active protease. This cleaves various targets that lead to cell death.
- Cell death by apoptosis is characterised by processes in which the cell becomes more compact, blebbing occurs at the membranes, chromatin becomes condensed, and DNA is fragmented.
- apoptosis The correct control of apoptosis is probably essential to all higher organisms.
- Elegans 131 of the 1090 cells die at defined points of the lifecycle of the organism.
- the importance of apoptosis has been proved using knockout mouse models.
- apoptosis pathways have been implicated in a variety of diseases including neurodegenerative diseases, ageing and cancer:
- Herpes simplex virus infection Perng et. al. “Virus-Induced Neuronal Apoptosis Blocked by the Herpes Simplex Virus Latency-Associated Transcript” Science 287: 1500-1503 (2000).
- 5-methylcytosine is the most frequent covalent base modification in the DNA of eukaryotic cells. It plays a role, for example, in the regulation of the transcription, in genetic imprinting, and in tumorigenesis. Therefore, the identification of 5-methylcytosine as a component of genetic information is of considerable interest. However, 5-methylcytosine positions cannot be identified by sequencing since 5-methylcytosine has the same base pairing behavior as cytosine. Moreover, the epigenetic information carried by 5-methylcytosine is completely lost during PCR amplification.
- a relatively new and currently the most frequently used method for analyzing DNA for 5-methylcytosine is based upon the specific reaction of bisulfite with cytosine which, upon subsequent alkaline hydrolysis, is converted to uracil which corresponds to thymidine in its base pairing behavior.
- 5-methylcytosine remains umnodified under these conditions. Consequently, the original DNA is converted in such a manner that methylcytosine, which originally could not be distinguished from cytosine by its hybridization behavior, can now be detected as the only remaining cytosine using “normal” molecular biological techniques, for example, by amplification and hybridization or sequencing. All of these techniques are based on base pairing which can now be fully exploited.
- the prior art is defined by a method which encloses the DNA to be analyzed in an agarose matrix, thus preventing the diffusion and renaturation of the DNA (bisulfite only reacts with single-stranded DNA), and which replaces all precipitation and purification steps with fast dialysis (Olek A, Oswald J, Walter J. A modified and improved method for bisulphite based cytosine methylation analysis. Nucleic Acids Res. Dec. 15, 1996;24(24):5064-6). Using this method, it is possible to analyze individual cells, which illustrates the potential of the method.
- Fluorescently labeled probes are often used for the scanning of immobilized DNA arrays.
- the simple attachment of Cy3 and Cy5 dyes to the 5′-OH of the specific probe are particularly suitable for fluorescence labels.
- the detection of the fluorescence of the hybridized probes may be carried out, for example via a confocal microscope. Cy3 and Cy5 dyes, besides many others, are commercially available.
- Matrix Assisted Laser Desorption Ionization Mass Spectrometry is a very efficient development for the analysis of biomolecules (Karas M, Hillenkamp F. Laser desorption ionization of proteins with molecular masses exceeding 10,000 daltons. Anal Chem. Oct. 15, 1988;60(20):2299-301).
- An analyte is embedded in a light-absorbing matrix. The matrix is evaporated by a short laser pulse thus transporting the analyte molecule into the vapor phase in an unfragmented manner.
- the analyte is ionized by collisions with matrix molecules.
- An applied voltage accelerates the ions into a field-free flight tube. Due to their different masses, the ions are accelerated at different rates. Smaller ions reach the detector sooner than bigger ones.
- MALDI-TOF spectrometry is excellently suited to the analysis of peptides and proteins.
- the analysis of nucleic acids is somewhat more difficult (Gut I G, Beck S. DNA and Matrix Assisted Laser Desorption Ionization Mass Spectrometry. Current Innovations and Future Trends. 1995, 1; 147-57).
- the sensitivity to nucleic acids is approximately 100 times worse than to peptides and decreases disproportionally with increasing fragment size.
- the ionization process via the matrix is considerably less efficient.
- the selection of the matrix plays an eminently important role.
- This objective is achieved according to the present invention using a nucleic acid containing a sequence of at least 18 bases in length of the chemically pretreated DNA of genes associated with apoptosis according to one of Seq. ID No.1 through Seq. ID No.78 and sequences complementary thereto and/or a sequence of a chemically pretreated DNA of genes according to table 1 and sequences complementary thereto.
- the respective data bank numbers accession numbers
- GenBank was used as the underlying data bank, which is located at the National Institute of Health, internet address www.ncbi.nlm.nih.gov.
- the object of the present invention is further achieved by an oligonucleotide or oligomer for detecting the cytosine methylation state in chemically pretreated DNA, containing at least one base sequence having a length of at least 13 nucleotides which hybridizes to a chemically pretreated DNA of genes associated with apoptosis according to Seq. ID No.1 through Seq. ID No.78 and sequences complementary thereto and/or a sequence of a chemically pretreated DNA of genes according to table 1 and sequences complementary thereto.
- the oligomer probes according to the present invention constitute important and effective tools which, for the first time, make it possible to ascertain the genetic and epigenetic parameters of genes associated with apoptosis.
- At least one oligonucleotide is bound to a solid phase.
- the present invention moreover relates to a set of at least 10 n (oligonucleotides and/or PNA-oligomers) used for detecting the cytosine methylation state in chemically pretreated genomic DNA (Seq. ID No.1 through Seq. ID No.78 and sequences complementary thereto and/or a sequence of a chemically pretreated DNA of genes according to table 1 and sequences complementary thereto).
- These probes enable diagnosis and/or therapy of genetic and epigenetic parameters of genes associated with apoptosis.
- the set of oligomers may also be used for detecting single nucleotide polymorphisms (SNPs) in the chemically pretreated DNA of genes associated with apoptosis according to one of Seq.
- an arrangement of different oligonucleotides and/or PNA-oligomers (a so-called “array”) made available by the present invention is present in a manner that it is likewise bound to a solid phase.
- This array of different oligonucleotide- and/or PNA-oligomer sequences can be characterized in that it is arranged on the solid phase in the form of a rectangular or hexagonal lattice.
- the solid phase surface is preferably composed of silicon, glass, polystyrene, aluminum, steel, iron, copper, nickel, silver, or gold.
- nitrocellulose as well as plastics such as nylon which can exist in the form of pellets or also as resin matrices are possible as well.
- a further subject matter of the present invention is a method for manufacturing an array fixed to a carrier material for analysis in connection with diseases associated with apoptosis in which method at least one oligomer according to the present invention is coupled to a solid phase.
- Methods for manufacturing such arrays are known, for example, from U.S. Pat. No. 5,744,305 by means of solid-phase chemistry and photolabile protecting groups.
- a further subject matter of the present invention relates to a DNA chip for the analysis of diseases associated with apoptosis which contains at least one nucleic acid according to the present invention.
- DNA chips are known, for example, for U.S. Pat. No. 5,837,832.
- a subject matter of the present invention is a kit which may be composed, for example, of a bisulfite-containing reagent, a set of primer oligonucleotides containing at least two oligonucleotides whose sequences in each case correspond or are complementary to an 18 base long segment of the base sequences specified in the appendix (Seq. ID No.1 through Seq.
- kits along the lines of the present invention can also contain only part of the aforementioned components.
- the present invention also makes available a method for ascertaining genetic and/or epigenetic parameters of genes associated with the cycle cell by analyzing cytosine methylations and single nucleotide polymorphisms, including the following steps:
- a genomic DNA sample is chemically treated in such a manner that cytosine bases which are unmethylated at the 5′-position are converted to uracil, thymine, or another base which is dissimilar to cytosine in terms of hybridization behavior. This will be understood as ‘chemical pretreatment’ hereinafter.
- the above described treatment of genomic DNA is preferably carried out with bisulfite (hydrogen sulfite, disulfite) and subsequent alkaline hydrolysis which results in a conversion of non-methylated cytosine nucleobases to uracil or to another base which is dissimilar to cytosine in terms of base pairing behavior.
- Fragments of the chemically pretreated DNA are amplified, using sets of primer oligonucleotides according to the present invention, and a, preferably heat-stable polymerase. Because of statistical and practical considerations, preferably more than ten different fragments having a length of 100-2000 base pairs are amplified.
- the amplification of several DNA segments can be carried out simultaneously in one and the same reaction vessel. Usually, the amplification is carried out by means of a polymerase chain reaction (PCR).
- PCR polymerase chain reaction
- the set of primer oligonucleotides includes at least two olignonucleotides whose sequences are each reverse complementary or identical to an at least 18 base-pair long segment of the base sequences specified in the appendix (Seq. ID No.1 through Seq. ID No.78 and sequences complementary thereto and/or a sequence of a chemically pretreated DNA of genes according to table 1 and sequences complementary thereto).
- the primer oligonucleotides are preferably characterized in that they do not contain any CpG dinucleotides.
- At least one primer oligonucleotide is bonded to a solid phase during amplification.
- the different oligonucleotide and/or PNA-oligomer sequences can be arranged on a plane solid phase in the form of a rectangular or hexagonal lattice, the solid phase surface preferably being composed of silicon, glass, polystyrene, aluminum, steel, iron, copper, nickel, silver, or gold, it being possible for other materials such as nitrocellulose or plastics to be used as well.
- the fragments obtained by means of the amplification can carry a directly or indirectly detectable label.
- the detection may be carried out and visualized by means of matrix assisted laser desorption/ionization mass spectrometry (MALDI) or using electron spray mass spectrometry (ESI).
- MALDI matrix assisted laser desorption/ionization mass spectrometry
- ESI electron spray mass spectrometry
- the amplificates obtained in the second step of the method are subsequently hybridized to an array or a set of oligonucleotides and/or PNA probes.
- the hybridization takes place in the manner described in the following.
- the set of probes used during the hybridization is preferably composed of at least 10 oligonucleotides or PNA-oligomers.
- the amplificates serve as probes which hybridize to oligonucleotides previously bonded to a solid phase. The non-hybridized fragments are subsequently removed.
- Said PNA-oligonomers contain at least one base sequence having a length of 9 nucleotides which is reverse complementary or identical to a segment of the base sequences specified in the appendix, the segment containing at least one CpG dinucleotide.
- the cytosine of the CpG dinucleotide is the 4th to 6th nucleotide seen from the 5′-end of the 9-mer.
- One oligonucleotide exists for each CpG dinucleotide.
- the non-hybridized amplificates are removed.
- the hybridized amplificates are detected.
- labels attached to the amplificates are identifiable at each position of the solid phase at which an oligonucleotide sequence is located.
- the produced fragments may have a single positive or negative net charge for better detectability in the mass spectrometer.
- the aforementioned method is preferably used for ascertaining genetic and/or epigenetic parameters of genes associated with apoptosis.
- the method according to the present invention is used, for example, for the diagnosis and/or therapy of HIV infection, Bloom syndrome, cardiopathy,aging, neurodegenerative disorders, Herpes simplex virus infection, renal ischemia, amyotrophic lateral sclerosis, solid tumors and cancers.
- a further subject matter of the present invention relates to a diagnostic agent and/or therapeutic agent for diseases associated with apoptosis by analyzing methylation patterns of genes associated with apoptosis, the diagnostic agent and/or therapeutic agent containing at least one nucleic acid according to the present invention, possibly together with suitable additives and auxiliary agents.
- hybridization is to be understood as a bond of an oligonucleotide to a completely complementary sequence along the lines of the Watson-Crick base pairings in the sample DNA, forming a duplex structure.
- stringent hybridization conditions are those conditions in which a hybridization is carried out at 60° C. in 2.5 ⁇ SSC buffer, followed by several washing steps at 37° C. in a low buffer concentration, and remains stable.
- the term “functional variants” denotes all DNA sequences which are complementary to a DNA sequence, and which hybridize to the reference sequence under stringent conditions and have an activity similar to the corresponding polypeptide according to the present invention.
- FIG. 1 [0059]FIG. 1
- FIG. 1 shows the hybridisation of fluorescent labelled amplificates to a surface bound olignonucleotide.
- Sample I being from healthy tissue and sample II being from pilocytic astrocytoma (tumor) tissue.
- Flourescence at a spot shows hybridisation of the amplificate to the olignonucleotide.
- Hybridisation to a CG olignonucleotide denotes methylation at the cytosine position being analysed
- hybridisation to a TG olignonucleotide denotes no methylation at the cytosine position being analysed.
- Sequences having odd sequence numbers exhibit in each case sequences of the chemically pretreated genomic DNAs of different genes associated with apoptosis.
- Sequences having even sequence numbers exhibit in each case the sequences of the chemically pretreated genomic DNAs of genes associated with apoptosis which are complementary to the preceeding sequences (e.g., the complementary sequence to Seq. ID No.1 is Seq. ID No.2, the complementary sequence to Seq. ID No.3 is Seq. ID No.4, etc.)
- Sequence ID Nos. 75 to 78 show the sequences of oligonucleotides used in Example 1.
- the following example relates to a fragment of a gene associated with apoptosis, in this case, death-associated protein 1 (DAPK1) in which a specific CG-position is analyzed for its methylation status.
- DAPK1 death-associated protein 1
- a genomic sequence is treated using bisulfite (hydrogen sulfite, disulfite) in such a manner that all cytosines which are not methylated at the 5-position of the base are modified in such a manner that a different base is substituted with regard to the base pairing behavior while the cytosines methylated at the 5-position remain unchanged.
- bisulfite hydrogen sulfite, disulfite
- the DNA sample is amplified in a polymerase chain reaction, preferably using a heat-resistant DNA polymerase.
- cytosines of the gene DAPK1 are analyzed.
- a defined fragment having a length of 465 bp is amplified with the specific primer oligonucleotides ATTAATATTATGTAAAGTGA (Sequence ID No. 75) and CTTACAACCATTCACCCACA (Sequence ID No. 76).
- This amplificate serves as a sample which hybridizes to an oligonucleotide previously bonded to a solid phase, forming a duplex structure, for example GTTATATCGTGGAGGATA (Sequence ID No.
- a sample of the amplificate is further hybridized to another oligonucleotide previously bonded to a solid phase.
- Said olignonucleotide is identical to the oligonucleotide previously used to analyze the methylation status of the sample, with the exception of the position in question.
- said oligonucleotide comprises a thymine base as opposed to a cytosine base i.e GTTATATTGTGGAGGATA (Sequence ID No. 78). Therefore, the hybridisation reaction only takes place if an unmethylated cytosine was present at the position to be analysed.
- the procedure was carried out on cell samples from 2 patients, sample I being from normal healthy tissue and sample II being from a pilocytic astrocytoma tumor sample.
- sample I contained a mixture of both methylated and unmethylated cells at position of the amplificate whereas sample II contained only methylated cells at position 135 of the amplificate.
- methylation patterns In order to relate the methylation patterns to one of the diseases associated with apoptosis, it is initially required to analyze the DNA methylation patterns of a group of diseased and of a group of healthy patients. These analyses are carried out, for example, analogously to Example 1. The results obtained in this manner are stored in a database and the CpG dinucleotides which are methylated differently between the two groups are identified. This can be carried out by determining individual CpG methylation rates as can be done, for example, in a relatively imprecise manner, by sequencing or else, in a very precise manner, by a methylation-sensitive “primer extension reaction”. It is also possible for the entire methylation status to be analyzed simultaneously, and for the patterns to be compared, for example, by clustering analyses which can be carried out, for example, by a computer.
- Example 2 can be carried out, for example, for the following diseases:
Abstract
The present invention relates to the chemically modified genomic sequences of genes associated with apoptosis, to oligonucleotides and/or PNA-oligomers for detecting the cytosine methylation state of genes associated with apoptosis which are directed against the sequence, as well as to a method for ascertaining genetic and/or epigenetic parameters of genes associated with apoptosis.
Description
- The levels of observation that have been well studied by the methodological developments of recent years in molecular biology, are the genes themselves, the translation of these genes into RNA, and the resulting proteins. The question of which gene is switched on at which point in the course of the development of an individual, and how the activation and inhibition of specific genes in specific cells and tissues are controlled is correlatable to the degree and character of the methylation of the genes or of the genome. In this respect, pathogenic conditions may manifest themselves in a changed methylation pattern of individual genes or of the genome.
- The present invention relates to nucleic acids, oligonucleotides, PNA-oligomers and to a method for the diagnosis and/or therapy of diseases which have a connection with the genetic and/or epigenetic parameters of genes associated with apoptosis and, in particular, with the methylation status thereof.
- During embryogenesis, tissue turnover or metamorphosis, multi cellular eukaryotic organisms retain the ability to eliminate unwanted cells. This form of programmed cell death is termed ‘apoptosis’. Apoptosis takes place in response to a variety of stimuli that trigger biochemical pathways that result in a characteristic set of processes leading to cell death.
- The stimuli that trigger apoptosis can include the levels of essential growth factors, treatment with glucocorticoids, irradiation, and activation of certain receptors. These trigger a variety of biochemical pathways. The ‘classical’, pathway comprises of a ligand-receptor interaction which triggers the activation of a protease. This leads to the release of cytochrome C from mitochondria. This in turn activates a series of proteases, whose actions culminate in the destruction of cellular structures.
- For example, a common pathway involves activation of caspase-8 by oligomerization at an activated surface receptor. Caspase-8 cleaves Bid, which triggers release of cytochrome c from mitochondria. The cytochrome c causes Apaf-1 to oligomerize with caspase-9. The activated caspase-9 cleaves procaspase-3, whose two subunits then form the active protease. This cleaves various targets that lead to cell death. Cell death by apoptosis is characterised by processes in which the cell becomes more compact, blebbing occurs at the membranes, chromatin becomes condensed, and DNA is fragmented.
- The correct control of apoptosis is probably essential to all higher organisms. For example, in the model organismC. Elegans 131 of the 1090 cells die at defined points of the lifecycle of the organism. In vertebrates, the importance of apoptosis has been proved using knockout mouse models. In humans, apoptosis pathways have been implicated in a variety of diseases including neurodegenerative diseases, ageing and cancer:
- HIV infection; Badley et. al. “Mechanisms of HIV-associated lymphocyte apoptosis” Blood,Vol. 96; 2951-2964 (2000).
- Bloom Syndrome; Bischof et. al. ‘Selective cleavage of BLM, the Bloom syndrome protein, during apoptotic cell death.’ J Biol Chem Jan. 11, 2001.
- Cardiomyopathy; Narula et. al. “Apoptosis in heart failure: release of cytochrome c from mitochondria and activation of caspase-3 in human cardiomyopathy” Proc Natl Acad Sci USA.;96:8144-8149 (1999).
- Familial Alzheimers; Simian et. al. Presenilin-1 P264L Knock-In Mutation: Differential Effects on Aβ Production, Amyloid Deposition, and Neuronal Vulnerability The Journal of Neuroscience, 20(23):8717-8726 (1999).
- Aging; Schindowski et. al. ‘Age-related changes of apoptotic cell death in human lymphocytes.’ Neurobiol Aging 2000 Sep-Oct;21(5):661-70.
- Herpes simplex virus infection; Perng et. al. “Virus-Induced Neuronal Apoptosis Blocked by the Herpes Simplex Virus Latency-Associated Transcript” Science 287: 1500-1503 (2000).
- Renal ischemia; Yuexian et. al. “Downregulation of the calpain inhibitor protein calpastatin by caspases during renal ischemia-reperfusion” Am. J. Physiol. 279: 509-517.
- Amyotrophic lateral sclerosis; Li et. al. “Functional Role of Caspase-1 and Caspase-3 in an ALS Transgenic Mouse Model” Science 288 (5464); 335-339 (2000).
- Breast cancer; Sierra et. al. ‘Bcl-2 with loss of apoptosis allows accumulation of genetic alterations: a pathway to metastatic progression in human breast cancer.’ Int J Cancer. Mar. 20, 2000;89(2):142-7.
- The complexities of the pathways leading to apoptosis allow for many mechanisms by which it can be diverted. In addition to genomic mutations, the epigenetic control of genes has been implicated in disruptions to apoptosis pathways. The epigenetic parameter that has been best characterised, DNA methylation, has been implicated as a key factor in the resistance of tumors to chemotherapy. It has been shown (Soengas et al “Inactivation of the apoptosis effector Apaf-1 in malignant melanoma” Nature 409; 207-211;2001) that in malignant melanomas disruptions in the apoptosis pathway could be attributed to silencing of the Apaf-1 gene.
- The identification of methylation of apoptosis genes as a factor in tumor malignancy opens up the possibility of creating alternative methods of treatment. Methylation based therapies could have considerable advantages over current methods of treatment such as chemotherapy, surgery and radiotherapy. They may even, as demonstrated by Soengas et al, provide a means of treating tumors resistant to conventional therapies. In addition to the development of methylation specific therapies, experiments with Min mice have shown that inhibition of DNA methylation can suppress tumor initiation (Laird et. al. ‘Suppression of intestinal neoplasia by DNA hypomethylation’ Cell 81; 197-2051995). Furthermore, DNA methylation analysis may provide novel means for tumor diagnosis as suggested by Rosas et. al. ‘Promoter hypermethylation patterns of p16, O6-methylguanine-DNA-methyltransferase, and death-associated protein kinase in tumors and saliva of head and neck cancer patients.’ Cancer Res Feb. 1, 2001;61(3):939-42.
- 5-methylcytosine is the most frequent covalent base modification in the DNA of eukaryotic cells. It plays a role, for example, in the regulation of the transcription, in genetic imprinting, and in tumorigenesis. Therefore, the identification of 5-methylcytosine as a component of genetic information is of considerable interest. However, 5-methylcytosine positions cannot be identified by sequencing since 5-methylcytosine has the same base pairing behavior as cytosine. Moreover, the epigenetic information carried by 5-methylcytosine is completely lost during PCR amplification.
- A relatively new and currently the most frequently used method for analyzing DNA for 5-methylcytosine is based upon the specific reaction of bisulfite with cytosine which, upon subsequent alkaline hydrolysis, is converted to uracil which corresponds to thymidine in its base pairing behavior. However, 5-methylcytosine remains umnodified under these conditions. Consequently, the original DNA is converted in such a manner that methylcytosine, which originally could not be distinguished from cytosine by its hybridization behavior, can now be detected as the only remaining cytosine using “normal” molecular biological techniques, for example, by amplification and hybridization or sequencing. All of these techniques are based on base pairing which can now be fully exploited. In terms of sensitivity, the prior art is defined by a method which encloses the DNA to be analyzed in an agarose matrix, thus preventing the diffusion and renaturation of the DNA (bisulfite only reacts with single-stranded DNA), and which replaces all precipitation and purification steps with fast dialysis (Olek A, Oswald J, Walter J. A modified and improved method for bisulphite based cytosine methylation analysis. Nucleic Acids Res. Dec. 15, 1996;24(24):5064-6). Using this method, it is possible to analyze individual cells, which illustrates the potential of the method. However, currently only individual regions of a length of up to approximately 3000 base pairs are analyzed, a global analysis of cells for thousands of possible methylation events is not possible. However, this method cannot reliably analyze very small fragments from small sample quantities either. These are lost through the matrix in spite of the diffusion protection.
- An overview of the further known methods of detecting 5-methylcytosine may be gathered from the following review article: Rein, T., DePamphilis, M. L., Zorbas, H., Nucleic Acids Res. 1998, 26, 2255.
- To date, barring few exceptions (e.g., Zeschnigk M, Lich C, Buiting K, Doerfier W, Horsthemke B. A single-tube PCR test for the diagnosis of Angelman and Prader-Willi syndrome based on allelic methylation differences at the SNRPN locus. Eur J Hum Genet. 1997 March-April;5(2):94-8) the bisulfite technique is only used in research. Always, however, short, specific fragments of a known gene are amplified subsequent to a bisulfite treatment and either completely sequenced (Olek A, Walter J. The pre-implantation ontogeny of the H19 methylation imprint. Nat Genet. 1997 Nov;17(3):275-6) or individual cytosine positions are detected by a primer extension reaction (Gonzalgo M L, Jones P A. Rapid quantitation of methylation differences at specific sites using methylation-sensitive single nucleotide primer extension (Ms-SNuPE). Nucleic Acids Res. Jun. 15, 1997;25(12):2529-31, WO 95/00669) or by enzymatic digestion (Xiong Z, Laird P W. COBRA: a sensitive and quantitative DNA methylation assay. Nucleic Acids Res. Jun. 15, 1997;25(12):2532-4). In addition, detection by hybridization has also been described (Olek et al., WO 99/28498).
- Further publications dealing with the use of the bisulfite technique for methylation detection in individual genes are: Grigg G, Clark S. Sequencing 5-methylcytosine residues in genomic DNA. Bioessays. 1994 June;16(6):431-6, 431; Zeschnigk M, Schmitz B, Dittrich B, Buiting K, Horsthemke B, Doerfler W. Imprinted segments in the human genome: different DNA methylation patterns in the Prader-Willi/Angelman syndrome region as determined by the genomic sequencing method. Hum Mol Genet. 1997 March;6(3):387-95; Feil R, Charlton J, Bird A P, Walter J, Reik W. Methylation analysis on individual chromosomes: improved protocol for bisulphite genomic sequencing. Nucleic Acids Res. Feb. 25, 1994;22(4):695-6; Martin V, Ribieras S, Song-Wang X, Rio MC, Dante R. Genomic sequencing indicates a correlation between DNA hypomethylation in the 5′ region of the pS2 gene and its expression in human breast cancer cell lines. Gene. May 19, 1995;157(1-2):261-4; WO 97/46705, WO 95/15373 and WO 97/45560.
- An overview of the Prior Art in oligomer array manufacturing can be gathered from a special edition of Nature Genetics (Nature Genetics Supplement, Volume 21, January 1999), published in January 1999, and from the literature cited therein.
- Fluorescently labeled probes are often used for the scanning of immobilized DNA arrays. The simple attachment of Cy3 and Cy5 dyes to the 5′-OH of the specific probe are particularly suitable for fluorescence labels. The detection of the fluorescence of the hybridized probes may be carried out, for example via a confocal microscope. Cy3 and Cy5 dyes, besides many others, are commercially available.
- Matrix Assisted Laser Desorption Ionization Mass Spectrometry (MALDI-TOF) is a very efficient development for the analysis of biomolecules (Karas M, Hillenkamp F. Laser desorption ionization of proteins with molecular masses exceeding 10,000 daltons. Anal Chem. Oct. 15, 1988;60(20):2299-301). An analyte is embedded in a light-absorbing matrix. The matrix is evaporated by a short laser pulse thus transporting the analyte molecule into the vapor phase in an unfragmented manner. The analyte is ionized by collisions with matrix molecules. An applied voltage accelerates the ions into a field-free flight tube. Due to their different masses, the ions are accelerated at different rates. Smaller ions reach the detector sooner than bigger ones.
- MALDI-TOF spectrometry is excellently suited to the analysis of peptides and proteins. The analysis of nucleic acids is somewhat more difficult (Gut I G, Beck S. DNA and Matrix Assisted Laser Desorption Ionization Mass Spectrometry. Current Innovations and Future Trends. 1995, 1; 147-57). The sensitivity to nucleic acids is approximately 100 times worse than to peptides and decreases disproportionally with increasing fragment size. For nucleic acids having a multiply negatively charged backbone, the ionization process via the matrix is considerably less efficient. In MALDI-TOF spectrometry, the selection of the matrix plays an eminently important role. For the desorption of peptides, several very efficient matrixes have been found which produce a very fine crystallization. There are now several responsive matrixes for DNA, however, the difference in sensitivity has not been reduced. The difference in sensitivity can be reduced by chemically modifying the DNA in such a manner that it becomes more similar to a peptide. Phosphorothioate nucleic acids in which the usual phosphates of the backbone are substituted with thiophosphates can be converted into a charge-neutral DNA using simple alkylation chemistry (Gut I G, Beck S. A procedure for selective DNA alkylation and detection by mass spectrometry. Nucleic Acids Res. Apr. 25, 1995;23(8):1367-73). The coupling of a charge tag to this modified DNA results in an increase in sensitivity to the same level as that found for peptides. A further advantage of charge tagging is the increased stability of the analysis against impurities which make the detection of unmodified substrates considerably more difficult. Genomic DNA is obtained from DNA of cell, tissue or other test samples using standard methods. This standard methodology is found in references such as Fritsch and Maniatis eds., Molecular Cloning: A Laboratory Manual, 1989.
- The object of the present invention is to provide the chemically modified DNA of genes associated with apoptosis, as well as oligonucleotides and/or PNA-oligomers for detecting cytosine methylations, as well as a method which is particularly suitable for the diagnosis and/or therapy of genetic and epigenetic parameters of genes associated with apoptosis. The present invention is based on the discovery that genetic and epigenetic parameters and, in particular, the cytosine methylation pattern of genes associated with apoptosis are particularly suitable for the diagnosis and/or therapy of diseases associated with apoptosis.
- This objective is achieved according to the present invention using a nucleic acid containing a sequence of at least 18 bases in length of the chemically pretreated DNA of genes associated with apoptosis according to one of Seq. ID No.1 through Seq. ID No.78 and sequences complementary thereto and/or a sequence of a chemically pretreated DNA of genes according to table 1 and sequences complementary thereto. In the table, after the listed gene designations, the respective data bank numbers (accession numbers) are specified which define the appertaining gene sequences as unique. GenBank was used as the underlying data bank, which is located at the National Institute of Health, internet address www.ncbi.nlm.nih.gov.
- The chemically modified nucleic acid could heretofore not be connected with the ascertainment of genetic and epigenetic parameters.
- The object of the present invention is further achieved by an oligonucleotide or oligomer for detecting the cytosine methylation state in chemically pretreated DNA, containing at least one base sequence having a length of at least 13 nucleotides which hybridizes to a chemically pretreated DNA of genes associated with apoptosis according to Seq. ID No.1 through Seq. ID No.78 and sequences complementary thereto and/or a sequence of a chemically pretreated DNA of genes according to table 1 and sequences complementary thereto. The oligomer probes according to the present invention constitute important and effective tools which, for the first time, make it possible to ascertain the genetic and epigenetic parameters of genes associated with apoptosis. The base sequence of the oligomers preferably contains at least one CpG dinucleotide. The probes may also exist in the form of a PNA (peptide nucleic acid) which has particularly preferred pairing properties. Particularly preferred are oligonucleotides according to the present invention in which the cytosine of the CpG dinucleotide is the 5th-9th nucleotide from the 5′-end of the 13-mer; in the case of PNA-oligomers, it is preferred for the cytosine of the CpG dinucleotide to be the 4th-6th nucleotide from the 5′-end of the 9-mer.
- The oligomers according to the present invention are normally used in so called “sets” which contain at least one oligomer for each of the CpG dinucleotides of the sequences of Seq. ID No.1 through Seq. ID No.78 and sequences complementary thereto and/or a sequence of a chemically pretreated DNA of genes according to table 1 and sequences complementary thereto. Preferred is a set which contains at least one oligomer for each of the CpG dinucleotides from one of Seq. ID No.1 through Seq. ID No.78 and sequences complementary thereto and/or a sequence of a chemically pretreated DNA of genes according to table 1 and sequences complementary thereto.
- Moreover, the present invention makes available a set of at least two oligonucleotides which can be used as so-called “primer oligonucleotides” for amplifying DNA sequences of one of Seq. ID No. 1 through Seq. ID No.78 and sequences complementary thereto and/or a sequence of a chemically pretreated DNA of genes according to table 1 and sequences complementary thereto, or segments thereof.
- In the case of the sets of oligonucleotides according to the present invention, it is preferred that at least one oligonucleotide is bound to a solid phase.
- The present invention moreover relates to a set of at least 10 n (oligonucleotides and/or PNA-oligomers) used for detecting the cytosine methylation state in chemically pretreated genomic DNA (Seq. ID No.1 through Seq. ID No.78 and sequences complementary thereto and/or a sequence of a chemically pretreated DNA of genes according to table 1 and sequences complementary thereto). These probes enable diagnosis and/or therapy of genetic and epigenetic parameters of genes associated with apoptosis. The set of oligomers may also be used for detecting single nucleotide polymorphisms (SNPs) in the chemically pretreated DNA of genes associated with apoptosis according to one of Seq. ID No.1 through Seq. ID No.78 and sequences complementary thereto and/or a sequence of a chemically pretreated DNA of genes according to table I and sequences complementary thereto. According to the present invention, it is preferred that an arrangement of different oligonucleotides and/or PNA-oligomers (a so-called “array”) made available by the present invention is present in a manner that it is likewise bound to a solid phase. This array of different oligonucleotide- and/or PNA-oligomer sequences can be characterized in that it is arranged on the solid phase in the form of a rectangular or hexagonal lattice. The solid phase surface is preferably composed of silicon, glass, polystyrene, aluminum, steel, iron, copper, nickel, silver, or gold. However, nitrocellulose as well as plastics such as nylon which can exist in the form of pellets or also as resin matrices are possible as well.
- Therefore, a further subject matter of the present invention is a method for manufacturing an array fixed to a carrier material for analysis in connection with diseases associated with apoptosis in which method at least one oligomer according to the present invention is coupled to a solid phase. Methods for manufacturing such arrays are known, for example, from U.S. Pat. No. 5,744,305 by means of solid-phase chemistry and photolabile protecting groups.
- A further subject matter of the present invention relates to a DNA chip for the analysis of diseases associated with apoptosis which contains at least one nucleic acid according to the present invention. DNA chips are known, for example, for U.S. Pat. No. 5,837,832. Moreover, a subject matter of the present invention is a kit which may be composed, for example, of a bisulfite-containing reagent, a set of primer oligonucleotides containing at least two oligonucleotides whose sequences in each case correspond or are complementary to an 18 base long segment of the base sequences specified in the appendix (Seq. ID No.1 through Seq. ID No.78 and sequences complementary thereto and/or a sequence of a chemically pretreated DNA of genes according to table 1 and sequences complementary thereto), oligonucleotides and/or PNA-oligomers as well as instructions for carrying out and evaluating the described method. However, a kit along the lines of the present invention can also contain only part of the aforementioned components.
- The present invention also makes available a method for ascertaining genetic and/or epigenetic parameters of genes associated with the cycle cell by analyzing cytosine methylations and single nucleotide polymorphisms, including the following steps:
- In the first step of the method, a genomic DNA sample is chemically treated in such a manner that cytosine bases which are unmethylated at the 5′-position are converted to uracil, thymine, or another base which is dissimilar to cytosine in terms of hybridization behavior. This will be understood as ‘chemical pretreatment’ hereinafter.
- The genomic DNA to be analyzed is preferably obtained form usual sources of DNA such as cells or cell components, for example, cell lines, biopsies, blood, sputum, stool, urine, cerebral-spinal fluid, tissue embedded in paraffin such as tissue from eyes, intestine, kidney, brain, heart, prostate, lung, breast or liver, histologic object slides, or combinations thereof.
- The above described treatment of genomic DNA is preferably carried out with bisulfite (hydrogen sulfite, disulfite) and subsequent alkaline hydrolysis which results in a conversion of non-methylated cytosine nucleobases to uracil or to another base which is dissimilar to cytosine in terms of base pairing behavior. Fragments of the chemically pretreated DNA are amplified, using sets of primer oligonucleotides according to the present invention, and a, preferably heat-stable polymerase. Because of statistical and practical considerations, preferably more than ten different fragments having a length of 100-2000 base pairs are amplified. The amplification of several DNA segments can be carried out simultaneously in one and the same reaction vessel. Usually, the amplification is carried out by means of a polymerase chain reaction (PCR).
- In a preferred embodiment of the method, the set of primer oligonucleotides includes at least two olignonucleotides whose sequences are each reverse complementary or identical to an at least 18 base-pair long segment of the base sequences specified in the appendix (Seq. ID No.1 through Seq. ID No.78 and sequences complementary thereto and/or a sequence of a chemically pretreated DNA of genes according to table 1 and sequences complementary thereto). The primer oligonucleotides are preferably characterized in that they do not contain any CpG dinucleotides.
- According to the present invention, it is preferred that at least one primer oligonucleotide is bonded to a solid phase during amplification. The different oligonucleotide and/or PNA-oligomer sequences can be arranged on a plane solid phase in the form of a rectangular or hexagonal lattice, the solid phase surface preferably being composed of silicon, glass, polystyrene, aluminum, steel, iron, copper, nickel, silver, or gold, it being possible for other materials such as nitrocellulose or plastics to be used as well.
- The fragments obtained by means of the amplification can carry a directly or indirectly detectable label. Preferred are labels in the form of fluorescence labels, radionuclides, or detachable molecule fragments having a typical mass which can be detected in a mass spectrometer, it being preferred that the fragments that are produced have a single positive or negative net charge for better detectability in the mass spectrometer. The detection may be carried out and visualized by means of matrix assisted laser desorption/ionization mass spectrometry (MALDI) or using electron spray mass spectrometry (ESI).
- The amplificates obtained in the second step of the method are subsequently hybridized to an array or a set of oligonucleotides and/or PNA probes. In this context, the hybridization takes place in the manner described in the following. The set of probes used during the hybridization is preferably composed of at least 10 oligonucleotides or PNA-oligomers. In the process, the amplificates serve as probes which hybridize to oligonucleotides previously bonded to a solid phase. The non-hybridized fragments are subsequently removed. Said oligonucleotides contain at least one base sequence having a length of 13 nucleotides which is reverse complementary or identical to a segment of the base sequences specified in the appendix, the segment containing at least one CpG dinucleotide. The cytosine of the CpG dinucleotide is the 5th to 9th nucleotide from the 5′-end of the 13-mer. One oligonucleotide exists for each CpG dinucleotide. Said PNA-oligonomers contain at least one base sequence having a length of 9 nucleotides which is reverse complementary or identical to a segment of the base sequences specified in the appendix, the segment containing at least one CpG dinucleotide. The cytosine of the CpG dinucleotide is the 4th to 6th nucleotide seen from the 5′-end of the 9-mer. One oligonucleotide exists for each CpG dinucleotide.
- In the fourth step of the method, the non-hybridized amplificates are removed.
- In the final step of the method, the hybridized amplificates are detected. In this context, it is preferred that labels attached to the amplificates are identifiable at each position of the solid phase at which an oligonucleotide sequence is located.
- According to the present invention, it is preferred that the labels of the amplificates are fluorescence labels, radionuclides, or detachable molecule fragments having a typical mass which can be detected in a mass spectrometer. The mass spectrometer is preferred for the detection of the amplificates, fragments of the amplificates or of probes which are complementary to the amplificates, it being possible for the detection to be carried out and visualized by means of matrix assisted laser desorption/ionization mass spectrometry (MALDI) or using electron spray mass spectrometry (ESI).
- The produced fragments may have a single positive or negative net charge for better detectability in the mass spectrometer. The aforementioned method is preferably used for ascertaining genetic and/or epigenetic parameters of genes associated with apoptosis.
- The oligomers according to the present invention or arrays thereof as well as a kit according to the present invention are intended to be used for the diagnosis and/or therapy of diseases associated with apoptosis by analyzing methylation patterns of genes associated with apoptosis. According to the present invention, the method is preferably used for the diagnosis and/or therapy of important genetic and/or epigenetic parameters within genes associated with apoptosis.
- The method according to the present invention is used, for example, for the diagnosis and/or therapy of HIV infection, Bloom syndrome, cardiopathy,aging, neurodegenerative disorders, Herpes simplex virus infection, renal ischemia, amyotrophic lateral sclerosis, solid tumors and cancers.
- The nucleic acids according to the present invention of Seq. ID No.1 through Seq. ID No.78 and sequences complementary thereto and/or a sequence of a chemically pretreated DNA of genes according to table 1 and sequences complementary thereto can be used for the diagnosis and/or therapy of genetic and/or epigenetic parameters of genes associated with apoptosis. The present invention moreover relates to a method for manufacturing a diagnostic agent and/or therapeutic agent for the diagnosis and/or therapy of diseases associated with apoptosis by analyzing methylation patterns of genes associated with apoptosis, the diagnostic agent and/or therapeutic agent being characterized in that at least one nucleic acid according to the present invention is used for manufacturing it, possibly together with suitable additives and auxiliary agents.
- A further subject matter of the present invention relates to a diagnostic agent and/or therapeutic agent for diseases associated with apoptosis by analyzing methylation patterns of genes associated with apoptosis, the diagnostic agent and/or therapeutic agent containing at least one nucleic acid according to the present invention, possibly together with suitable additives and auxiliary agents.
- The present invention moreover relates to the diagnosis and/or prognosis of events which are disadvantageous to patients or individuals in which important genetic and/or epigenetic parameters within genes associated with apoptosis said parameters obtained by means of the present invention may be compared to another set of genetic and/or epigenetic parameters, the differences serving as the basis for a diagnosis and/or prognosis of events which are disadvantageous to patients or individuals.
- In the context of the present invention the term “hybridization” is to be understood as a bond of an oligonucleotide to a completely complementary sequence along the lines of the Watson-Crick base pairings in the sample DNA, forming a duplex structure. To be understood by “stringent hybridization conditions” are those conditions in which a hybridization is carried out at 60° C. in 2.5×SSC buffer, followed by several washing steps at 37° C. in a low buffer concentration, and remains stable.
- The term “functional variants” denotes all DNA sequences which are complementary to a DNA sequence, and which hybridize to the reference sequence under stringent conditions and have an activity similar to the corresponding polypeptide according to the present invention.
- In the context of the present invention, “genetic parameters” are mutations and polymorphisms of genes associated with apoptosis and sequences further required for their regulation. To be designated as mutations are, in particular, insertions, deletions, point mutations, inversions and polymorphisms and, particularly preferred, SNPs (single nucleotide polymorphisms).
- In the context of the present invention, “epigenetic parameters” are, in particular, cytosine methylations and further chemical modifications of DNA bases of genes associated with apoptosis and sequences further required for their regulation. Further epigenetic parameters include, for example, the acetylation of histones which, however, cannot be directly analyzed using the described method but which, in turn, correlates with the DNA methylation.
- In the following, the present invention will be explained in greater detail on the basis of the sequences and examples with reference to the accompanying figure without being limited thereto.
- FIG. 1
- FIG. 1 shows the hybridisation of fluorescent labelled amplificates to a surface bound olignonucleotide. Sample I being from healthy tissue and sample II being from pilocytic astrocytoma (tumor) tissue. Flourescence at a spot shows hybridisation of the amplificate to the olignonucleotide. Hybridisation to a CG olignonucleotide denotes methylation at the cytosine position being analysed, hybridisation to a TG olignonucleotide denotes no methylation at the cytosine position being analysed.
- Sequence ID Nos. 1 to 74
- Sequences having odd sequence numbers (e.g., Seq. ID No. 1, 3, 5, . . . ) exhibit in each case sequences of the chemically pretreated genomic DNAs of different genes associated with apoptosis. Sequences having even sequence numbers (e.g., Seq. ID No. 2, 4, 6, . . . ) exhibit in each case the sequences of the chemically pretreated genomic DNAs of genes associated with apoptosis which are complementary to the preceeding sequences (e.g., the complementary sequence to Seq. ID No.1 is Seq. ID No.2, the complementary sequence to Seq. ID No.3 is Seq. ID No.4, etc.)
- Sequence ID Nos. 75 to 78
- Sequence ID Nos. 75 to 78 show the sequences of oligonucleotides used in Example 1. The following example relates to a fragment of a gene associated with apoptosis, in this case, death-associated protein 1 (DAPK1) in which a specific CG-position is analyzed for its methylation status.
- The following example relates to a fragment of the gene DAPKI in which a specific CG-position is to be analyzed for methylation.
- In the first step, a genomic sequence is treated using bisulfite (hydrogen sulfite, disulfite) in such a manner that all cytosines which are not methylated at the 5-position of the base are modified in such a manner that a different base is substituted with regard to the base pairing behavior while the cytosines methylated at the 5-position remain unchanged.
- If bisulfite solution is used for the reaction, then an addition takes place at the non-methylated cytosine bases. Moreover, a denaturating reagent or solvent as well as a radical interceptor must be present. A subsequent alkaline hydrolysis then gives rise to the conversion of non-methylated cytosine nucleobases to uracil. The chemically converted DNA (sequence ID Nos. 73 and 74) is then used for the detection of methylated cytosines. In the second method step, the treated DNA sample is diluted with water or an aqueous solution. Preferably, the DNA is subsequently desulfonated (10-30 min, 90-100° C.) at an alkaline pH value. In the third step of the method, the DNA sample is amplified in a polymerase chain reaction, preferably using a heat-resistant DNA polymerase. In the present case, cytosines of the gene DAPK1 are analyzed. To this end, a defined fragment having a length of 465 bp is amplified with the specific primer oligonucleotides ATTAATATTATGTAAAGTGA (Sequence ID No. 75) and CTTACAACCATTCACCCACA (Sequence ID No. 76). This amplificate serves as a sample which hybridizes to an oligonucleotide previously bonded to a solid phase, forming a duplex structure, for example GTTATATCGTGGAGGATA (Sequence ID No. 77), the cytosine to be detected being located at position 135 of the amplificate. The detection of the hybridization product is based on Cy3 and Cy5 flourescently labeled primer oligonucleotides which have been used for the amplification. A hybridization reaction of the amplified DNA with the oligonucleotide takes place only if a methylated cytosine was present at this location in the bisulfite-treated DNA. Thus, the methylation status of the specific cytosine to be analyzed is inferred from the hybridization product.
- In order to verify the methylation status of the position, a sample of the amplificate is further hybridized to another oligonucleotide previously bonded to a solid phase. Said olignonucleotide is identical to the oligonucleotide previously used to analyze the methylation status of the sample, with the exception of the position in question. At the position to be analysed said oligonucleotide comprises a thymine base as opposed to a cytosine base i.e GTTATATTGTGGAGGATA (Sequence ID No. 78). Therefore, the hybridisation reaction only takes place if an unmethylated cytosine was present at the position to be analysed. The procedure was carried out on cell samples from 2 patients, sample I being from normal healthy tissue and sample II being from a pilocytic astrocytoma tumor sample.
- From the results (see FIG. 1) it can be seen that the sample I contained a mixture of both methylated and unmethylated cells at position of the amplificate whereas sample II contained only methylated cells at position 135 of the amplificate.
- In order to relate the methylation patterns to one of the diseases associated with apoptosis, it is initially required to analyze the DNA methylation patterns of a group of diseased and of a group of healthy patients. These analyses are carried out, for example, analogously to Example 1. The results obtained in this manner are stored in a database and the CpG dinucleotides which are methylated differently between the two groups are identified. This can be carried out by determining individual CpG methylation rates as can be done, for example, in a relatively imprecise manner, by sequencing or else, in a very precise manner, by a methylation-sensitive “primer extension reaction”. It is also possible for the entire methylation status to be analyzed simultaneously, and for the patterns to be compared, for example, by clustering analyses which can be carried out, for example, by a computer.
- Subsequently, it is possible to allocate the examined patients to a specific therapy group and to treat these patients selectively with an individualized therapy.
- Example 2 can be carried out, for example, for the following diseases:
- HIV infection, Bloom syndrome, cardiopathy, aging, neurodegenerative disorders, Herpes simplex virus infection, renal ischemia, amyotrophic lateral sclerosis, solid tumors and cancers.
Database entry No. (GenBank, internet Gene address www.ncbi.nlm.nih.gov) TNFRSF6 (NM_000043), TNFRSF6 (NM_000043), TNFRSF6 (NM_000043), BCL2 (NM_000633), BCL2L1 (NM_001191), BCL2L2 (NM_004050), BNIP3 (NM_004052), CASP3 (NM_004346), CASP7 (NM_001227), PDCD1 (NM_005018), SFRP5 (NM_003015), STK17A (NM_004760), REQ (NM_006268) -
-
0 SEQUENCE LISTING The patent application contains a lengthy “Sequence Listing” section. A copy of the “Sequence Listing” is available in electronic form from the USPTO web site (http://seqdata.uspto.gov/sequence.html?DocID=20030162194). An electronic copy of the “Sequence Listing” will also be available from the USPTO upon request and payment of the fee set forth in 37 CFR 1.19(b)(3).
Claims (32)
1. A nucleic acid comprising a sequence at least 18 bases in length of a segment of the chemically pretreated DNA of genes associated with apoptosis according to one of the sequences taken from the group comprising Seq. ID No.1 to Seq. ID No.74 and sequences complementary thereto.
2. A nucleic acid comprising a sequence at least 18 base pairs in length of a segment of the chemically pretreated DNA of genes associated with apoptosis according to one of the sequences according to one of the genes TNFRSF6 (NM—000043), BCL2 (NM—000633), BCL2 μl (NM—001191), BCL2L2 (NM—004050), BNIP3 (NM—004052), CASP3 (NM—004346), CASP7 (NM—001227), PDCD1 (NM—005018), SFRP5 (NM—003015), STK17A (NM—004760), REQ (NM—006268) and sequences complementary thereto.
3. An oligomer, in particular an oligonucleotide or peptide nucleic acid (PNA)-oligomer, said oligomer comprising in each case at least one base sequence having a length of at least 9 nucleotides which hybridizes to or is identical to a chemically pretreated DNA of genes associated with apoptosis according to one of the Seq ID Nos 1 to 74 according to claim 1 or to a chemically pretreated DNA of genes according to claim 2 and sequences complementary thereto.
4. The oligomer as recited in claim 3; wherein the base sequence includes at least one CpG dinucleotide.
5. The oligomer as recited in claim 3;characterized in that the cytosine of the CpG dinucleotide is located approximately in the middle third of the oligomer.
6. A set of oligomers, comprising at least two oligomers according to any of claims 3 to 5 .
7. A set of oligomers as recited in claim 6 , comprising oligomers for detecting the methylation state of all CpG dinucleotides within one of the sequences according to Seq. ID Nos. 1 through 74 according to claim 1 or a chemically pretreated DNA of genes according to claim 2 , and sequences complementary thereto.
8. A set of at least two oligonucleotides as recited in claim 3 , which can be used as primer oligonucleotides for the amplification of DNA sequences of one of Seq. ID 1 through Seq. ID 74 and sequences complementary thereto and/or sequences of a chemically pretreated DNA of genes according to claim 2 , and sequences complementary thereto and segments thereof.
9. A set of oligonucleotides as recited in claim 8 , characterized in that at least one oligonucleotide is bound to a solid phase.
10. Use of a set of oligomer probes comprising at least ten of the oligomers according to any of claims 6 through 9 for detecting the cytosine methylation state and/or single nucleotide polymorphisms (SNPs) in a chemically pretreated genomic DNA according to claim 1 or a chemically pretreated DNA of genes according to claim 2 .
11. A method for manufacturing an arrangement of different oligomers (array) fixed to a carrier material for analyzing diseases associated with the methylation state of the CpG dinucleotides of one of the Seq. ID 1 through Seq. ID 74 and sequences complementary thereto and/or chemically pretreated DNA of genes according to claim 2 , wherein at least one oligomer according to any of the claims 3 through 5 is coupled to a solid phase.
12. An arrangement of different oligomers (array) obtainable according to claim 11 .
13. An array of different oligonucleotide- and/or PNA-oligomer sequences as recited in claim 12 , characterized in that these are arranged on a plane solid phase in the form of a rectangular or hexagonal lattice.
14. The array as recited in any of the claims 12 or 13, characterized in that the solid phase surface is composed of silicon, glass, polystyrene, aluminum, steel, iron, copper, nickel, silver, or gold.
15. A DNA- and/or PNA-array for analyzing diseases associated with the methylation state of genes, comprising at least one nucleic acid according to one of the preceding claims.
16. A method for ascertaining genetic and/or epigenetic parameters for the diagnosis and/or therapy of existing diseases or the predisposition to specific diseases by analyzing cytosine methylations, characterized in that the following steps are carried out:
a) in a genomic DNA sample, cytosine bases which are unmethylated at the 5-position are converted, by chemical treatment, to uracil or another base which is dissimilar to cytosine in terms of hybridization behavior;
b) fragments of the chemically pretreated genomic DNA are amplified using sets of primer oligonucleotides according to claim 8 or 9 and a polymerase, the amplificates carrying a detectable label;
c) Amplificates are hybridized to a set of oligonucleotides and/or PNA probes according to the claims 6 and 7, or else to an array according to one of the claims 12 through 15;
d) the hybridized amplificates are subsequently detected.
17. The method as recited in claim 16 , characterized in that the chemical treatment is carried out by means of a solution of a bisulfite, hydrogen sulfite or disulfite.
18. The method as recited in one of the claims 16 or 17, characterized in that more than ten different fragments having a length of 100-2000 base pairs are amplified.
19. The method as recited in one of the claims 16 through 18, characterized in that the amplification of several DNA segments is carried out in one reaction vessel.
20. The method as recited in one of the claims 16 through 19, characterized in that the polymerase is a heat-resistant DNA polymerase.
21. The method as recited in claim 20 , characterized in that the amplification is carried out by means of the polymerase chain reaction (PCR).
22. The method as recited in one of the claims 16 through 21, characterized in that the labels of the amplificates are fluorescence labels.
23. The method as recited in one of the claims 16 through 21, characterized in that the labels of the amplificates are radionuclides.
24. The method as recited in one of the claims 16 through 21, characterized in that the labels of the amplificates are detachable molecule fragments having a typical mass which are detected in a mass spectrometer.
25. The method as recited in one of the claims 16 through 21, characterized in that the amplificates or fragments of the amplificates are detected in the mass spectrometer.
26. The method as recited in one of the claims 24 and/or 25, characterized in that the produced fragments have a single positive or negative net charge for better detectability in the mass spectrometer
27. The method as recited in one of the claims 24 through 26, characterized in that detection is carried out and visualized by means of matrix assisted laser desorption/ionization mass spectrometry (MALDI) or using electron spray mass spectrometry (ESI).
28. The method as recited in one of the claims 16 through 27, characterized in that the genomic DNA is obtained from cells or cellular components which contain DNA, sources of DNA comprising, for example, cell lines, biopsies, blood, sputum, stool, urine, cerebral-spinal fluid, tissue embedded in paraffin such as tissue from eyes, intestine, kidney, brain, heart, prostate, lung, breast or liver, histologic object slides, and all possible combinations thereof.
29. A kit comprising a bisulfite (=disulfite, hydrogen sulfite) reagent as well as oligonucleotides and/or PNA-oligomers according to one of the claims 3 through 5.
30. The use of a nucleic acid according to claims 1 or 2, of an oligonucleotide or PNA-oligomer according to one of the claims 3 through 5, of a kit according to claim 29 , of an array according to one of the claims 12 through 15, of a set of oligonucleotides according to one of claims 6 through 9 for the diagnosis of HIV infection, Bloom syndrome, cardiopathy, aging, neurodegenerative disorders, Herpes simplex virus infection, renal ischemia, amyotrophic lateral sclerosis, solid tumors and cancers.
31. The use of a nucleic acid according to claims 1 or 2, of an oligonucleotide or PNA-oligomer according to one of claims 3 through 5, of a kit according to claim 29 , of an array according to one of the claims 12 through 15, of a set of oligonucleotides according to one of claims 6 through 9 for the therapy of HIV infection, Bloom syndrome, cardiopathy, aging, neurodegenerative disorders, Herpes simplex virus infection, renal ischemia, arnyotrophic lateral sclerosis, solid tumors and cancers.
32. A kit, comprising a bisulfite (=disulfite, hydrogen sulfite) reagent as well as oligonucleotides and/or PNA-oligomers according to one of claims 3 through 5.
Applications Claiming Priority (8)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
DE10019058.8 | 2000-04-06 | ||
DE10019058A DE10019058A1 (en) | 2000-04-06 | 2000-04-06 | Designing primers and probes for analyzing diseases associated with cytosine methylation state e.g. arthritis, cancer, aging, arteriosclerosis comprising fragments of chemically modified genes associated with cell cycle |
DE10019173 | 2000-04-07 | ||
DE100191738 | 2000-04-07 | ||
DE10032529A DE10032529A1 (en) | 2000-06-30 | 2000-06-30 | Diagnosis of major genetic parameters within the Major Histocompatibility Complex (MHC) |
DE100325297 | 2000-06-30 | ||
DE10043826 | 2000-09-01 | ||
DE10043826.1 | 2000-09-01 |
Publications (1)
Publication Number | Publication Date |
---|---|
US20030162194A1 true US20030162194A1 (en) | 2003-08-28 |
Family
ID=27437807
Family Applications (7)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US10/239,676 Expired - Fee Related US7195870B2 (en) | 2000-04-06 | 2001-04-06 | Diagnosis of diseases associated with gene regulation |
US10/240,454 Abandoned US20040067491A1 (en) | 2000-04-06 | 2001-04-06 | Diagnosis of diseases associated with metabolism |
US10/240,589 Abandoned US20040076956A1 (en) | 2000-04-06 | 2001-04-06 | Diagnosis of diseases associated with dna repair |
US10/240,453 Abandoned US20030148326A1 (en) | 2000-04-06 | 2001-04-06 | Diagnosis of diseases associated with dna transcription |
US10/240,485 Abandoned US20030148327A1 (en) | 2000-04-06 | 2001-04-06 | Diagnosis of diseases associated with metastasis |
US10/240,452 Abandoned US20030162194A1 (en) | 2000-04-06 | 2001-04-06 | Diagnosis of diseases associated with apoptosis |
US10/240,708 Abandoned US20050282157A1 (en) | 2000-04-06 | 2001-04-06 | Diagnosis of diseases associated with dna replication |
Family Applications Before (5)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US10/239,676 Expired - Fee Related US7195870B2 (en) | 2000-04-06 | 2001-04-06 | Diagnosis of diseases associated with gene regulation |
US10/240,454 Abandoned US20040067491A1 (en) | 2000-04-06 | 2001-04-06 | Diagnosis of diseases associated with metabolism |
US10/240,589 Abandoned US20040076956A1 (en) | 2000-04-06 | 2001-04-06 | Diagnosis of diseases associated with dna repair |
US10/240,453 Abandoned US20030148326A1 (en) | 2000-04-06 | 2001-04-06 | Diagnosis of diseases associated with dna transcription |
US10/240,485 Abandoned US20030148327A1 (en) | 2000-04-06 | 2001-04-06 | Diagnosis of diseases associated with metastasis |
Family Applications After (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US10/240,708 Abandoned US20050282157A1 (en) | 2000-04-06 | 2001-04-06 | Diagnosis of diseases associated with dna replication |
Country Status (7)
Country | Link |
---|---|
US (7) | US7195870B2 (en) |
EP (9) | EP1274866A2 (en) |
JP (3) | JP2003534780A (en) |
AT (1) | ATE353975T1 (en) |
AU (9) | AU2001254788A1 (en) |
DE (1) | DE60126593T2 (en) |
WO (8) | WO2001077164A2 (en) |
Cited By (14)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20050153347A1 (en) * | 2003-05-07 | 2005-07-14 | Affymetrix, Inc. | Analysis of methylation status using oligonucleotide arrays |
US20060134650A1 (en) * | 2004-12-21 | 2006-06-22 | Illumina, Inc. | Methylation-sensitive restriction enzyme endonuclease method of whole genome methylation analysis |
US20060292585A1 (en) * | 2005-06-24 | 2006-12-28 | Affymetrix, Inc. | Analysis of methylation using nucleic acid arrays |
US20080108073A1 (en) * | 2001-11-19 | 2008-05-08 | Affymetrix, Inc. | Methods of Analysis of Methylation |
US20080207460A1 (en) * | 2002-12-02 | 2008-08-28 | Solexa Limited | Determination of methylation of nucleic acid sequences |
US20090148842A1 (en) * | 2007-02-07 | 2009-06-11 | Niall Gormley | Preparation of templates for methylation analysis |
US20090321626A1 (en) * | 2006-05-26 | 2009-12-31 | Akos Vertes | Laser desorption ionization and peptide sequencing on laser induced silicon microcolumn arrays |
US20100323917A1 (en) * | 2009-04-07 | 2010-12-23 | Akos Vertes | Tailored nanopost arrays (napa) for laser desorption ionization in mass spectrometry |
US7901882B2 (en) | 2006-03-31 | 2011-03-08 | Affymetrix, Inc. | Analysis of methylation using nucleic acid arrays |
US20110201524A1 (en) * | 2008-10-22 | 2011-08-18 | Illumina, Inc. | Preservation of information related to genomic dna methylation |
US8003354B2 (en) | 2000-02-07 | 2011-08-23 | Illumina, Inc. | Multiplex nucleic acid reactions |
US8076063B2 (en) | 2000-02-07 | 2011-12-13 | Illumina, Inc. | Multiplexed methylation detection methods |
US8288103B2 (en) | 2000-02-07 | 2012-10-16 | Illumina, Inc. | Multiplex nucleic acid reactions |
US9000361B2 (en) | 2009-01-17 | 2015-04-07 | The George Washington University | Nanophotonic production, modulation and switching of ions by silicon microcolumn arrays |
Families Citing this family (65)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6780982B2 (en) * | 1996-07-12 | 2004-08-24 | Third Wave Technologies, Inc. | Charge tags and the separation of nucleic acid molecules |
US6818404B2 (en) | 1997-10-23 | 2004-11-16 | Exact Sciences Corporation | Methods for detecting hypermethylated nucleic acid in heterogeneous biological samples |
EP1274866A2 (en) | 2000-04-06 | 2003-01-15 | Epigenomics AG | Diagnosis of diseases associated with metastasis |
AU2001275294A1 (en) * | 2000-06-07 | 2001-12-17 | Biosynexus Incorporated. | Immunostimulatory RNA/DNA hybrid molecules |
EP1294947A2 (en) * | 2000-06-30 | 2003-03-26 | Epigenomics AG | Method and nucleic acids for pharmacogenomic methylation analysis |
AUPR142500A0 (en) * | 2000-11-13 | 2000-12-07 | Human Genetic Signatures Pty Ltd | A peptide nucleic acid-based assay for the detection of specific nucleic acid sequences |
DE10128508A1 (en) | 2001-06-14 | 2003-02-06 | Epigenomics Ag | Methods and nucleic acids for the differentiation of prostate tumors |
WO2003031932A2 (en) * | 2001-10-05 | 2003-04-17 | Case Western Reserve University | Methods and compositions for detecting colon cancers |
JP2003144172A (en) * | 2001-11-16 | 2003-05-20 | Nisshinbo Ind Inc | Oligonucleotide-immobilized board for detecting methylation |
DE10161625A1 (en) * | 2001-12-14 | 2003-07-10 | Epigenomics Ag | Methods and nucleic acids for the analysis of a pulmonary cell division disorder |
WO2003076593A2 (en) * | 2002-03-07 | 2003-09-18 | The Johns Hopkins University School Of Medicine | Genomic screen for epigenetically silenced genes associated with cancer |
EP1344832A1 (en) * | 2002-03-15 | 2003-09-17 | Epigenomics AG | Methods and nucleic acids for the analysis of methylation within the gene melastatin |
WO2003083107A1 (en) * | 2002-03-25 | 2003-10-09 | The Board Of Trustees Of The University Of Arkansas | Cpg retrieval of dna from formalin-fixed pathology specimen for promoter methylation analysis |
AU2003247880B2 (en) * | 2002-07-03 | 2010-09-02 | Coley Pharmaceutical Group, Inc. | Nucleic acid compositions for stimulating immune responses |
US20040053880A1 (en) | 2002-07-03 | 2004-03-18 | Coley Pharmaceutical Group, Inc. | Nucleic acid compositions for stimulating immune responses |
US7807803B2 (en) | 2002-07-03 | 2010-10-05 | Coley Pharmaceutical Group, Inc. | Nucleic acid compositions for stimulating immune responses |
CA2500255A1 (en) * | 2002-10-01 | 2004-04-29 | Epigenomics Ag | Method and nucleic acids for the treatment of breast cell proliferative disorders |
DE10304219B3 (en) * | 2003-01-30 | 2004-08-19 | Epigenomics Ag | Method for the detection of cytosine methylation patterns with high sensitivity |
US20050266409A1 (en) * | 2003-02-04 | 2005-12-01 | Wyeth | Compositions and methods for diagnosing, preventing, and treating cancers |
WO2004111266A1 (en) | 2003-06-17 | 2004-12-23 | Human Genetic Signatures Pty Ltd | Methods for genome amplification |
EP1660683B1 (en) | 2003-08-14 | 2017-04-19 | Case Western Reserve University | Methods and compositions for detecting colon cancers |
US8415100B2 (en) | 2003-08-14 | 2013-04-09 | Case Western Reserve University | Methods and compositions for detecting gastrointestinal and other cancers |
DE10338308B4 (en) | 2003-08-15 | 2006-10-19 | Epigenomics Ag | Method for the detection of cytosine methylations in DNA |
CA2537810C (en) | 2003-09-04 | 2012-12-18 | Human Genetic Signatures Pty Ltd | Nucleic acid detection assay |
AU2004281299B2 (en) * | 2003-10-20 | 2010-11-18 | St Vincent's Hospital Sydney Limited | Assessment of disease risk by quantitative determination of epimutation in normal tissues |
EP3269826B1 (en) * | 2003-12-01 | 2020-03-11 | Epigenomics AG | Methods and nucleic acids for the analysis of gene expression associated with the development of prostate cell proliferative disorders |
EP1561821B1 (en) | 2003-12-11 | 2011-02-16 | Epigenomics AG | Prognostic markers for prediction of treatment response and/or survival of breast cell proliferative disorder patients |
EP1568786A3 (en) * | 2004-02-13 | 2007-08-29 | Affymetrix, Inc. (A US Entity) | Analysis of methylation status using nucleic acid arrays |
US8168777B2 (en) | 2004-04-29 | 2012-05-01 | Human Genetic Signatures Pty. Ltd. | Bisulphite reagent treatment of nucleic acid |
ATE476439T1 (en) | 2004-09-10 | 2010-08-15 | Human Genetic Signatures Pty | AMPLIFICATION BLOCKERS COMPRISING INTERCALATING NUCLEIC ACIDS (INA) CONTAINING INTERCALATING PSEUDONUCLEOTIDES (IPN) |
KR20060026595A (en) | 2004-09-21 | 2006-03-24 | (주)지노믹트리 | Method for detecting methylaion of promoter using restriction enzyme and dna chip |
KR100617649B1 (en) * | 2004-09-24 | 2006-09-04 | (주)지노믹트리 | Composition For Cancer diagnosis Containing Methylated Promoters of Colon Cancer Specific Expression-decreased Genes and Use Thereof |
EP1828411B1 (en) | 2004-12-03 | 2012-11-07 | Human Genetic Signatures PTY Ltd | Methods for simplifying microbial nucleic acids by chemical modification of cytosines |
WO2006088978A1 (en) | 2005-02-16 | 2006-08-24 | Epigenomics, Inc. | Method for determining the methylation pattern of a polynucleic acid |
SI1871912T1 (en) | 2005-04-15 | 2012-06-29 | Epigenomics Ag | Method for determining DNA methylation in blood or urine samples |
WO2006111586A2 (en) * | 2005-04-20 | 2006-10-26 | Proyecto De Biomedicina Cima, S.L. | Method for the in vitro determination of the degree of methylation of the line-1 promoter |
JP2008541705A (en) | 2005-05-26 | 2008-11-27 | ヒューマン ジェネティック シグネチャーズ ピーティーワイ リミテッド | Isothermal strand displacement amplification using primers containing non-standard bases |
ATE531820T1 (en) | 2005-09-14 | 2011-11-15 | Human Genetic Signatures Pty | HEALTH CONDITION TEST |
WO2007082099A2 (en) | 2006-01-11 | 2007-07-19 | Genomic Health, Inc. | Gene expression markers for colorectal cancer prognosis |
US7465544B2 (en) * | 2006-01-11 | 2008-12-16 | Wisconsin Alumni Research Foundation | Synthetic cofactor analogs of S-adenosylmethionine as ligatable probes of biological methylation and methods for their use |
EP1826278A1 (en) * | 2006-02-28 | 2007-08-29 | Epiontis GmbH | Epigenetic modification of the loci for camta1 and/or foxp3 as a marker for cancer treatment |
EP2471951A1 (en) * | 2006-05-02 | 2012-07-04 | University of Southhampton | Predicting cognitive development by gene methylation analysis |
ES2685678T3 (en) * | 2007-10-23 | 2018-10-10 | Clinical Genomics Pty Ltd | A method for the diagnosis of neoplasms - II |
EP2215250B1 (en) | 2007-11-27 | 2013-02-27 | Human Genetic Signatures Pty Ltd | Enzymes for amplification and copying bisulphite modified nucleic acids |
WO2010007083A2 (en) * | 2008-07-15 | 2010-01-21 | Epigenomics Ag | Methods and nucleic acids for analyses of cell proliferative disorders |
CA2760333A1 (en) | 2009-05-01 | 2010-11-04 | Genomic Health Inc. | Gene expression profile algorithm and test for likelihood of recurrence of colorectal cancer and response to chemotherapy |
CA2769862A1 (en) | 2009-08-28 | 2011-03-03 | Cellular Dynamics International, Inc. | Identifying genetic variation in affected tissues derived from induced pluripotent stem cells |
WO2011080314A2 (en) * | 2009-12-31 | 2011-07-07 | Deutsches Krebsforschungszentrum | Novel modulators of trail signalling |
WO2012149245A2 (en) * | 2011-04-28 | 2012-11-01 | Ostrer Harry | Genomic signatures of metastasis in prostate cancer |
WO2012162139A1 (en) | 2011-05-20 | 2012-11-29 | The Regents Of The University Of California | Method to estimate age of individual based on epigenetic markers in biological sample |
NZ622418A (en) | 2011-09-07 | 2014-12-24 | Human Genetic Signatures Pty | Molecular detection assay |
EP2821487B1 (en) * | 2012-02-29 | 2016-10-26 | Sysmex Corporation | Method for determining presence or absence of cancer cell derived from hepatocellular carcinoma, and determination marker and kit |
US10706957B2 (en) | 2012-09-20 | 2020-07-07 | The Chinese University Of Hong Kong | Non-invasive determination of methylome of tumor from plasma |
US9732390B2 (en) | 2012-09-20 | 2017-08-15 | The Chinese University Of Hong Kong | Non-invasive determination of methylome of fetus or tumor from plasma |
KR101302173B1 (en) | 2012-12-07 | 2013-08-30 | 이화여자대학교 산학협력단 | Composition for diagnosing alzheimer's disease using methylation status of hmox1 gene and method for diagnosing alzheimer's disease using the same |
US20140274757A1 (en) | 2013-03-14 | 2014-09-18 | Marie K. Kirby | Differential Methylation Level of CpG Loci That Are Determinative of a Biochemical Reoccurrence of Prostate Cancer |
SG11201608403TA (en) * | 2014-04-28 | 2016-11-29 | Sigma Aldrich Co Llc | Epigenetic modification of mammalian genomes using targeted endonucleases |
EP3850083A4 (en) * | 2018-09-14 | 2022-06-29 | Shinozaki, Gen | Systems and methods for detection of delirium risk using epigenetic markers |
CN111217900A (en) * | 2018-11-27 | 2020-06-02 | 上海交通大学 | Transcription regulation factor for angiogenesis and application thereof |
SG11202107670TA (en) | 2019-01-18 | 2021-08-30 | Univ California | Dna methylation measurement for mammals based on conserved loci |
EP4047102A4 (en) | 2019-10-14 | 2024-04-17 | Gencurix Inc | Composition for diagnosing liver cancer by using cpg methylation changes in specific genes, and use thereof |
KR102637032B1 (en) | 2020-01-28 | 2024-02-15 | 주식회사 젠큐릭스 | Composition for diagnosing bladder cancer using CpG methylation status of specific gene and uses thereof |
WO2021206467A1 (en) | 2020-04-08 | 2021-10-14 | 주식회사 젠큐릭스 | Composition for diagnosing colorectal cancer, rectal cancer, or colorectal adenoma using cpg methylation change of glrb gene, and use thereof |
CN111500702B (en) * | 2020-04-26 | 2021-04-20 | 江苏大学附属医院 | Application of cg00843506 site methylation of RPN1 gene in diagnosing asthma |
WO2023175019A1 (en) | 2022-03-15 | 2023-09-21 | Genknowme S.A. | Method determining the difference between the biological age and the chronological age of a subject |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5744305A (en) * | 1989-06-07 | 1998-04-28 | Affymetrix, Inc. | Arrays of materials attached to a substrate |
US20030036081A1 (en) * | 2001-07-02 | 2003-02-20 | Epigenomics Ag | Distributed system for epigenetic based prediction of complex phenotypes |
US20030113750A1 (en) * | 2001-06-14 | 2003-06-19 | Juergen Distler | Method and nucleic acids for the differentiation of prostate tumors |
US6783933B1 (en) * | 1999-09-15 | 2004-08-31 | The Johns Hopkins University School Of Medicine | CACNA1G polynucleotide, polypeptide and methods of use therefor |
Family Cites Families (23)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5474796A (en) * | 1991-09-04 | 1995-12-12 | Protogene Laboratories, Inc. | Method and apparatus for conducting an array of chemical reactions on a support surface |
SE501439C2 (en) | 1993-06-22 | 1995-02-13 | Pharmacia Lkb Biotech | Method and apparatus for analyzing polynucleotide sequences |
US5837832A (en) | 1993-06-25 | 1998-11-17 | Affymetrix, Inc. | Arrays of nucleic acid probes on biological chips |
DE69433180T2 (en) * | 1993-10-26 | 2004-06-24 | Affymetrix, Inc., Santa Clara | FIELDS OF NUCLEIC ACID PROBE ON ORGANIC CHIPS |
KR100392057B1 (en) | 1993-11-30 | 2003-10-30 | 맥길 유니버시티 | A Methool of Reducing Methylation of Cytosine in a Cpg Dinucleotide in a Cell |
US5858661A (en) * | 1995-05-16 | 1999-01-12 | Ramot-University Authority For Applied Research And Industrial Development | Ataxia-telangiectasia gene and its genomic organization |
US5871917A (en) | 1996-05-31 | 1999-02-16 | North Shore University Hospital Research Corp. | Identification of differentially methylated and mutated nucleic acids |
US6017704A (en) * | 1996-06-03 | 2000-01-25 | The Johns Hopkins University School Of Medicine | Method of detection of methylated nucleic acid using agents which modify unmethylated cytosine and distinguishing modified methylated and non-methylated nucleic acids |
WO1998056952A1 (en) * | 1997-06-09 | 1998-12-17 | University Of Southern California | A cancer diagnostic method based upon dna methylation differences |
DE19750172C1 (en) * | 1997-11-12 | 1998-10-01 | Deutsches Krebsforsch | DNA with promoter activity |
DE19754482A1 (en) * | 1997-11-27 | 1999-07-01 | Epigenomics Gmbh | Process for making complex DNA methylation fingerprints |
WO1999029898A2 (en) * | 1997-12-05 | 1999-06-17 | MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. | Method for identifying nucleic acids by means of matrix-assisted laser desorption/ionisation mass spectrometry |
AU5128999A (en) * | 1998-07-24 | 2000-02-14 | Yeda Research And Development Co. Ltd. | Prevention of metastasis with 5-aza-2'-deoxycytidine |
DE19905082C1 (en) * | 1999-01-29 | 2000-05-18 | Epigenomics Gmbh | Identification of methylation patterns of cytosine in genome DNA comprises chemical treatment to produce different base pairing behavior between cytosine and 5-methylcytosine |
US6331393B1 (en) * | 1999-05-14 | 2001-12-18 | University Of Southern California | Process for high-throughput DNA methylation analysis |
US7332275B2 (en) * | 1999-10-13 | 2008-02-19 | Sequenom, Inc. | Methods for detecting methylated nucleotides |
EP1283905A2 (en) * | 2000-03-15 | 2003-02-19 | Epigenomics AG | Diagnosis of diseases associated with the cell cycle |
EP1274866A2 (en) | 2000-04-06 | 2003-01-15 | Epigenomics AG | Diagnosis of diseases associated with metastasis |
EP1294947A2 (en) | 2000-06-30 | 2003-03-26 | Epigenomics AG | Method and nucleic acids for pharmacogenomic methylation analysis |
DE10037769A1 (en) | 2000-08-03 | 2002-02-21 | Epigenomics Gmbh | Diagnosis of diseases associated with CD24 |
US6812339B1 (en) * | 2000-09-08 | 2004-11-02 | Applera Corporation | Polymorphisms in known genes associated with human disease, methods of detection and uses thereof |
DE10054974A1 (en) | 2000-11-06 | 2002-06-06 | Epigenomics Ag | Diagnosis of diseases associated with Cdk4 |
DE10054972A1 (en) | 2000-11-06 | 2002-06-06 | Epigenomics Ag | Diagnosis of diseases associated with humus |
-
2001
- 2001-04-06 EP EP01953937A patent/EP1274866A2/en not_active Ceased
- 2001-04-06 US US10/239,676 patent/US7195870B2/en not_active Expired - Fee Related
- 2001-04-06 EP EP01953936A patent/EP1274865B1/en not_active Expired - Lifetime
- 2001-04-06 US US10/240,454 patent/US20040067491A1/en not_active Abandoned
- 2001-04-06 WO PCT/EP2001/003969 patent/WO2001077164A2/en active IP Right Grant
- 2001-04-06 EP EP08012765A patent/EP2014776A3/en not_active Ceased
- 2001-04-06 AU AU2001254788A patent/AU2001254788A1/en not_active Abandoned
- 2001-04-06 EP EP01969303A patent/EP1268861A2/en not_active Withdrawn
- 2001-04-06 JP JP2001575230A patent/JP2003534780A/en not_active Withdrawn
- 2001-04-06 WO PCT/EP2001/003973 patent/WO2001092565A2/en active Application Filing
- 2001-04-06 US US10/240,589 patent/US20040076956A1/en not_active Abandoned
- 2001-04-06 AT AT01953936T patent/ATE353975T1/en not_active IP Right Cessation
- 2001-04-06 AU AU2001276330A patent/AU2001276330B2/en not_active Ceased
- 2001-04-06 US US10/240,453 patent/US20030148326A1/en not_active Abandoned
- 2001-04-06 EP EP01956429A patent/EP1370685A2/en not_active Withdrawn
- 2001-04-06 WO PCT/EP2001/004016 patent/WO2001076451A2/en not_active Application Discontinuation
- 2001-04-06 AU AU7633001A patent/AU7633001A/en active Pending
- 2001-04-06 WO PCT/EP2001/003972 patent/WO2001081622A2/en active Application Filing
- 2001-04-06 WO PCT/EP2001/003971 patent/WO2001077377A2/en not_active Application Discontinuation
- 2001-04-06 AU AU2001289600A patent/AU2001289600A1/en not_active Abandoned
- 2001-04-06 EP EP01927895A patent/EP1272670A2/en not_active Withdrawn
- 2001-04-06 AU AU2001254794A patent/AU2001254794A1/en not_active Abandoned
- 2001-04-06 AU AU2001277487A patent/AU2001277487A1/en not_active Abandoned
- 2001-04-06 US US10/240,485 patent/US20030148327A1/en not_active Abandoned
- 2001-04-06 EP EP01953145A patent/EP1278893A2/en not_active Withdrawn
- 2001-04-06 AU AU2001276331A patent/AU2001276331A1/en not_active Abandoned
- 2001-04-06 JP JP2001575229A patent/JP2004508807A/en not_active Withdrawn
- 2001-04-06 EP EP01955278A patent/EP1360319A2/en not_active Withdrawn
- 2001-04-06 DE DE60126593T patent/DE60126593T2/en not_active Expired - Fee Related
- 2001-04-06 AU AU2001278420A patent/AU2001278420A1/en not_active Abandoned
- 2001-04-06 JP JP2001575634A patent/JP2003531589A/en not_active Withdrawn
- 2001-04-06 WO PCT/EP2001/003970 patent/WO2001077376A2/en active Application Filing
- 2001-04-06 WO PCT/EP2001/003968 patent/WO2001077375A2/en not_active Application Discontinuation
- 2001-04-06 AU AU2001275663A patent/AU2001275663A1/en not_active Abandoned
- 2001-04-06 WO PCT/EP2001/004015 patent/WO2001077378A2/en not_active Application Discontinuation
- 2001-04-06 US US10/240,452 patent/US20030162194A1/en not_active Abandoned
- 2001-04-06 US US10/240,708 patent/US20050282157A1/en not_active Abandoned
- 2001-04-06 EP EP01927887A patent/EP1268857A2/en not_active Withdrawn
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5744305A (en) * | 1989-06-07 | 1998-04-28 | Affymetrix, Inc. | Arrays of materials attached to a substrate |
US6783933B1 (en) * | 1999-09-15 | 2004-08-31 | The Johns Hopkins University School Of Medicine | CACNA1G polynucleotide, polypeptide and methods of use therefor |
US20030113750A1 (en) * | 2001-06-14 | 2003-06-19 | Juergen Distler | Method and nucleic acids for the differentiation of prostate tumors |
US20030036081A1 (en) * | 2001-07-02 | 2003-02-20 | Epigenomics Ag | Distributed system for epigenetic based prediction of complex phenotypes |
Cited By (33)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US8288103B2 (en) | 2000-02-07 | 2012-10-16 | Illumina, Inc. | Multiplex nucleic acid reactions |
US8076063B2 (en) | 2000-02-07 | 2011-12-13 | Illumina, Inc. | Multiplexed methylation detection methods |
US8003354B2 (en) | 2000-02-07 | 2011-08-23 | Illumina, Inc. | Multiplex nucleic acid reactions |
US8906626B2 (en) | 2000-02-07 | 2014-12-09 | Illumina, Inc. | Multiplex nucleic acid reactions |
US9850536B2 (en) | 2000-02-07 | 2017-12-26 | Illumina, Inc. | Multiplex nucleic acid reactions |
US10837059B2 (en) | 2000-02-07 | 2020-11-17 | Illumina, Inc. | Multiplex nucleic acid reactions |
US10822642B2 (en) | 2001-11-19 | 2020-11-03 | Affymetrix, Inc. | Methods of analysis of methylation |
US10407717B2 (en) | 2001-11-19 | 2019-09-10 | Affymetrix, Inc. | Methods of analysis of methylation |
US20110151438A9 (en) * | 2001-11-19 | 2011-06-23 | Affymetrix, Inc. | Methods of Analysis of Methylation |
US20080108073A1 (en) * | 2001-11-19 | 2008-05-08 | Affymetrix, Inc. | Methods of Analysis of Methylation |
US20080207460A1 (en) * | 2002-12-02 | 2008-08-28 | Solexa Limited | Determination of methylation of nucleic acid sequences |
US20050153347A1 (en) * | 2003-05-07 | 2005-07-14 | Affymetrix, Inc. | Analysis of methylation status using oligonucleotide arrays |
US20060134650A1 (en) * | 2004-12-21 | 2006-06-22 | Illumina, Inc. | Methylation-sensitive restriction enzyme endonuclease method of whole genome methylation analysis |
US20060292585A1 (en) * | 2005-06-24 | 2006-12-28 | Affymetrix, Inc. | Analysis of methylation using nucleic acid arrays |
US7901882B2 (en) | 2006-03-31 | 2011-03-08 | Affymetrix, Inc. | Analysis of methylation using nucleic acid arrays |
US8709716B2 (en) | 2006-03-31 | 2014-04-29 | Affymetrix, Inc. | Analysis of methylation using nucleic acid arrays |
US10822659B2 (en) | 2006-03-31 | 2020-11-03 | Affymetrix, Inc. | Analysis of methylation using nucleic acid arrays |
US9828640B2 (en) | 2006-03-31 | 2017-11-28 | Affymetrix, Inc. | Analysis of methylation using nucleic acid arrays |
US20110166037A1 (en) * | 2006-03-31 | 2011-07-07 | Affymetrix, Inc. | Analysis of methylation using nucleic acid arrays |
US8084734B2 (en) | 2006-05-26 | 2011-12-27 | The George Washington University | Laser desorption ionization and peptide sequencing on laser induced silicon microcolumn arrays |
US20090321626A1 (en) * | 2006-05-26 | 2009-12-31 | Akos Vertes | Laser desorption ionization and peptide sequencing on laser induced silicon microcolumn arrays |
US9868982B2 (en) | 2007-02-07 | 2018-01-16 | Illumina Cambridge Limited | Preparation of templates for methylation analysis |
US11827927B2 (en) | 2007-02-07 | 2023-11-28 | Illumina Cambridge Limited | Preparation of templates for methylation analysis |
US10954554B2 (en) | 2007-02-07 | 2021-03-23 | Illumina Cambridge Limited | Preparation of templates for methylation analysis |
US20090148842A1 (en) * | 2007-02-07 | 2009-06-11 | Niall Gormley | Preparation of templates for methylation analysis |
US20110201524A1 (en) * | 2008-10-22 | 2011-08-18 | Illumina, Inc. | Preservation of information related to genomic dna methylation |
US10174372B2 (en) | 2008-10-22 | 2019-01-08 | Illumina, Inc. | Preservation of information related to genomic DNA methylation |
US9605311B2 (en) | 2008-10-22 | 2017-03-28 | Illumina, Inc. | Tandem sequencing top and bottom strands of double stranded nucleic acid using arrays configured for single molecule detection |
US8895268B2 (en) | 2008-10-22 | 2014-11-25 | Illumina, Inc. | Preservation of information related to genomic DNA methylation |
US8541207B2 (en) | 2008-10-22 | 2013-09-24 | Illumina, Inc. | Preservation of information related to genomic DNA methylation |
US9000361B2 (en) | 2009-01-17 | 2015-04-07 | The George Washington University | Nanophotonic production, modulation and switching of ions by silicon microcolumn arrays |
US20100323917A1 (en) * | 2009-04-07 | 2010-12-23 | Akos Vertes | Tailored nanopost arrays (napa) for laser desorption ionization in mass spectrometry |
US9490113B2 (en) | 2009-04-07 | 2016-11-08 | The George Washington University | Tailored nanopost arrays (NAPA) for laser desorption ionization in mass spectrometry |
Also Published As
Similar Documents
Publication | Publication Date | Title |
---|---|---|
EP1274865B1 (en) | Diagnosis of diseases associated with apoptosis by means of assessing the methylation status of genes associated with apoptosis | |
AU2001276330A1 (en) | Diagnosis of diseases associated with apoptosis | |
US20040048254A1 (en) | Diagnosis of diseases associated with tumor supressor genes and oncogenes | |
US20040023230A1 (en) | Method and nucleic acids for pharmacogenomic methylation analysis | |
AU2006213968A1 (en) | Diagnosis of diseases associated with DNA replication | |
AU2006225250A1 (en) | Diagnosis of diseases associated with metastasis | |
AU2006203475A1 (en) | Diagnosis of Diseases Associated with Gene Regulation |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AS | Assignment |
Owner name: EPIGENOMICS AG, GERMANY Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:OLEK, ALEXANDER;PIPENBROCK, CHRISTIAN;BERLIN, KURT;REEL/FRAME:013944/0252;SIGNING DATES FROM 20021001 TO 20021007 |
|
STCB | Information on status: application discontinuation |
Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION |