US20030126634A1 - Methods and compositions for the increase of yield in plants - Google Patents

Methods and compositions for the increase of yield in plants Download PDF

Info

Publication number
US20030126634A1
US20030126634A1 US10/171,498 US17149802A US2003126634A1 US 20030126634 A1 US20030126634 A1 US 20030126634A1 US 17149802 A US17149802 A US 17149802A US 2003126634 A1 US2003126634 A1 US 2003126634A1
Authority
US
United States
Prior art keywords
plant
dna
pat
gene
plants
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US10/171,498
Inventor
T. Spencer
Thomas Adams
Richard Daines
William Gordon-Kamm
Albert Kausch
Peggy Lemaux
Catherine MacKey
Mary Mangano
Thomas Rice
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
DeKalb Genetics Corp
Original Assignee
DeKalb Genetics Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US07/565,844 external-priority patent/US5550318A/en
Priority claimed from US08/113,561 external-priority patent/US7705215B1/en
Application filed by DeKalb Genetics Corp filed Critical DeKalb Genetics Corp
Priority to US10/171,498 priority Critical patent/US20030126634A1/en
Publication of US20030126634A1 publication Critical patent/US20030126634A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01HNEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H4/00Plant reproduction by tissue culture techniques ; Tissue culture techniques therefor
    • A01H4/008Methods for regeneration to complete plants
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8206Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by physical or chemical, i.e. non-biological, means, e.g. electroporation, PEG mediated
    • C12N15/8207Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by physical or chemical, i.e. non-biological, means, e.g. electroporation, PEG mediated by mechanical means, e.g. microinjection, particle bombardment, silicon whiskers

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Cell Biology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Botany (AREA)
  • Environmental Sciences (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention provides methods for increasing yield in plants by introducing a gene encoding phosphinothricin acetyltransferase. The invention further involves a method of transferring said increased yield phenotype to other lines of plants by crossing. A maize transformant is identified in which the phosphinothricin acetyltransferase gene integration event is correlated with increased yield.

Description

  • The present application is a continuation-in-part of co-pending U.S. patent application Ser. No. 08/113,561, filed Aug. 25, 1993, and of co-pending U.S. patent application Ser. No. 08/233,067, filed Apr. 26, 1994. The Ser. No. 08/113,561 application is a continuation-in-part of co-pending U.S. patent application Ser. No. 07/565,844, filed Aug. 9, 1990, and the Ser. No. 08/233,067 application is a divisional application of Ser. No. 07/565,844. The entire text and figures of each of the above-referenced disclosures are specifically incorporated herein by reference without disclaimer.[0001]
  • BACKGROUND OF THE INVENTION
  • 1. Field of the Invention [0002]
  • The present invention relates generally to the fields of plants, such as maize, and to improved methods of plant breeding. More particularly, it provides methods of increasing yield in plants by introducing a gene encoding phosphinothricin acetyltransferase. The increased yield phenotype may be transferred to other lines of plants by crossing. [0003]
  • 2. Description of the Related Art [0004]
  • Ever since the human species emerged from the hunting-gathering phase of its existence, and entered an agricultural phase, a major goal of human ingenuity and invention has been to improve crop yield and to alter and improve the characteristics of plants. In particular, man has sought to alter the characteristics of plants to make them more tasty and/or nutritious, to produce increased crop yield or render plants more adaptable to specific environments. [0005]
  • Up until recent times, crop and plant improvements depended on selective breeding of plants with desirable characteristics. Initial breeding success was probably accidental, resulting from observation of a plant with desirable characteristics, and use of that plant to propagate the next generation. However, because such plants had within them heterogenous genetic complements, it was unlikely that progeny identical to the parent(s) with the desirable traits would emerge. Nonetheless, advances in controlled breeding have resulted from both increasing knowledge of the mechanisms operative in hereditary transmission, and by empirical observations of results of making various parental plant crosses. [0006]
  • Attempts to improve commercially important traits in plants, for example, grain yield in corn and wheat, have consumed the energies of commercial plant breeders in the twentieth century. Clever and sophisticated breeding schemes have been devised, yet the rate of improvement of economically important characters has been only a few to several percent of the mean per year for the past several decades. For various crop plants, it has beer established that roughly half of this improvement is due to improved husbandry practices, i.e., environmental effects rather than genetic changes effected by selection. (Lande & Thompson, 1990). [0007]
  • The record available from the crude crop breeding programs of the late nineteenth century through the present is littered with dead ends—failures, for one reason or another. For example, data on the ineffectiveness of mass selection for several corn ear characters as presented by Williams and Welton in 1915 are reproduced and discussed by Sprague & Eberhart (1977). Selection for long and short ears was not effective in separating the population into two distinct subpopulations defined by ear length. Yield, one of the most commercially valuable traits, has been the least responsive to selective breeding programs. Selection from 1907-1914 had no overall effect on yield. An examination of data on corn yield trials published by study stations in Illinois from 1860 to 1900 shows that many corn varieties were included for short test periods, then discarded because of poor yielding ability. (Sprague & Eberhart, 1977). This article refers to a report that visual selection practiced during inbreeding had little, if any, direct influence on yield in hybrid combinations. However, selection was effective for some other traits, e.g., maturity. Recurrent selection was somewhat more effective in improving breeding populations. [0008]
  • These failures to substantially alter plant characteristics are costly. Even the successes with recurrent selection may generally be described as incremental and long range improvements rather than mercurial saltatory jumps. Divergence of corn varieties for oil and protein content of grain was achieved if results over the 70 year history of a long-term study in Illinois are considered. However, improvement in yield has been less dramatic. Over the past 60 years, increases in yield due to genetic improvement have averaged only about one bushel/acre/year (Hallauer et al., 1988). Only a small population of hybrid plants produced commercially ever show enough improvement to be worth marketing. World-wide needs for plant derived food, both for animals and humans, warrant improved strategies. Plants are also finding uses in non-food products necessitating increased production. New methods are necessary for more efficient and successful plant breeding programs than are currently available. [0009]
  • Recent advances in molecular biology have expanded man's ability to manipulate the germplasm of animals and plants. Genes controlling specific phenotypes, for example specific polypeptides that lend antibiotic or herbicide resistance, have been located within certain germplasm and isolated from it. Even more important has been the ability to take the genes which have been isolated from one organism and to introduce them into another organism. This transformation may be accomplished even where the recipient organism is from a different phylum, genus or species from that which donated the gene (heterologous transformation). [0010]
  • Attempts have been made to genetically engineer desired traits into plant genomes by introduction of exogenous genes. These techniques have been successfully applied in some plant systems, principally in dicotyledonous species. The uptake of new DNA by recipient plant cells has been accomplished by various means, including Agrobacterium infection (Nester et al., 1984), polyethylene glycol (PEG)-mediated DNA uptake (Lorz et al., 1985), electroporation of protoplasts (Fromm et al., 1986) and microprojectile bombardment (Klein et al., 1987). Unfortunately, the introduction of exogenous DNA into monocotyledonous species and subsequent regeneration of transformed plants has proven much more difficult than transformation and regeneration in dicotyledonous plants. However, techniques are now available for transformation of barley (Wan & Lemaux, 1994), wheat (Weeks et al., 1993), corn (Gordon-Kamm et al., 1990), and sorghum (Casas et al., 1993). The availability of these transformation techniques suggests that it may now be possible to address improvement of agronomic performance of a crop plant through the techniques of genetic engineering. [0011]
  • With the advent of genetic engineering techniques that are new opportunities for increasing yield in crops. One of the goals of this technology is to introduce genes into a crop that will increase yield and/or stabilize yield across multiple environments. However, no genetic elements that contribute to important agronomic characteristics, such as yield, have been identified and introduced into crops using the techniques of genetic engineering. [0012]
  • The enzyme phosphinothricin acetyl transferase (PAT) inactivates the active ingredient in the herbicides bialaphos or phosphinothricin (PPT). PPT inhibits glutamine synthetase, (Murakami et al., 1986; Twell et al., 1989) causing rapid accumulation of ammonia and cell death. Genes that encode the enzyme phosphinothricin acetyltransferase are obtainable from species of Streptomyces (e.g., ATCC No. 21,705) and include the bar gene from [0013] Streptomyces hygroscopicus or the pat gene from Streptomyces viridochromogenes. These organisms synthesize numerous unique compounds, secondary metabolites, that often possess antibacterial, antitumor, or antiparasitic activity (Demain et al., 1983). Streptomyces viridochromogenes produces a broad spectrum tripeptide antibiotic phosphinothricyl-alanyl-alanine (phosphinothricin) [2-amino-4-(methylphosphinyl)-butanoic acid] (Bayer et al., 1972). The gene that encodes for phosphinothricin resistance has been designated pat and was first isolated from S. Viridochromogenes and shares extensive nucleotide sequence homology with the bar gene of S. hygroscopicus (Murakami et al., 1986; Thompson et al., 1987). The bar gene has been well studied and serves as a model to explain the mode of action of the pat gene. The bar gene encodes a phosphinothricin acetyltransferase, which acetylates the free NH2 group of phosphinothricin and thereby prevents autotoxicity in the producing organism (Murakami et al., 1986). Hence, the bar gene can be cloned to obtain resistance to the antibiotic bialaphos and can be used as a dominant selectable marker.
  • The bar gene has been cloned and used as a selectable marker in [0014] E. coli (Thompson et al., 1987) which is bialaphos sensitive (Murakami et al., 1986). The bar gene has also been expressed in tobacco, tomato, and potato plants (de Block et al., 1987; Leemans et al., 1987). The transgenic tobacco, tomato, and potato plants were completely resistant to high doses of the commercial formulations of both phosphinothricin and bialaphos (de Block et al., 1987). S. hygroscopicus is used for the commercial production of bialaphos (HerbiaceR, Meiji Seika Kaisha, Ltd., Yokohama, Japan) and is being used in agriculture as a nonselective herbicide (Thompson et al., 1987). Phosphinothricin is chemically synthesized and sold under the tradename of BastaR, Hoechst AG, Germany). Selection for bialaphos resistance can be made in the field by spraying seedlings with a 1% solution of Basta containing 200 g/L glufosinate (the ammonium salt of phosphinothricin).
  • The enzyme encoded by the bar gene is also-involved in the bialaphos biosynthetic pathway in [0015] S. hygroscopicus. In addition to acetylation of phosphinothricin, the enzyme catalyzes acetylation of demethyl-phosphinothricin which is an intermediate in the biosynthetic pathway (Thompson et al., 1987). PAT, however, has no activity on any substrates other than phosphinothricin and demethyl-phosphinothricin, including no activity on the amino acid glutamate of which phosphinothricine is an analog (Thompson et al., 1987). Introduction of a gene encoding PAT into a plant would, therefore, be expected to confer resistance to the herbicide phosphinothricin on the plant, but not effect the phenotype of the plant in any other way.
  • SUMMARY OF THE INVENTION
  • The present invention relates to the surprising discovery that the introduction of a PAT gene into plants, such as corn, correlates with increased yield in the resultant plants. The invention therefore provides new methods and compositions for use in plant breeding and genetic engineering to specifically alter yield. [0016]
  • A transformed plant or transformed plant line is defined herein as a plant or plant line into which a DNA sequence, preferably from a source with which the recipient plant is not sexually compatible, has been introduced through the use of genetic engineering techniques. [0017]
  • A DNA sequence that encodes the enzyme phosphinothricin acetyl transferase (PAT) is herein defined as a “PAT gene”, regardless of the source of the gene. Genes encoding PAT include the bar gene isolated from [0018] Streptomyces hygroscopicus and the pat gene isolated from Streptomyces viridochromogenes.
  • pat gene compositions are described in U.S. Pat. No. 5,273,894, incorporated herein by reference, which patent also describes the use of the pat gene as a resistance marker. The pat gene is further exemplified by DNA segments. that include a DNA sequence as set forth herein by SEQ ID NO:1 and that encode a polypeptide that includes an amino acid sequence as set forth in SEQ ID NO:2. A pat gene sequence with modified codon usage for advantageous expression in plants is described in U.S. Pat. No. 5,276,268, incorporated herein by reference. In U.S. Pat. No. 5,276,268, the DNA sequence termed sequence III, as shown in Table III, is the sequence adapted for expression in plants. This sequence is contemplated for use in the present invention. [0019]
  • The bar gene is currently the preferred gene for use with the present invention. The bar gene is described in issued European Patents EP 0,242,236 and EP 0,242,246, and shown in FIG. 2 thereof. EP 0,242,246 also discloses the pat gene in FIG. 9. The bar gene is further exemplified by DNA segments that include a DNA sequence as set forth herein by SEQ ID NO:3 and that encode a polypeptide that includes an amino acid sequence as set forth in SEQ ID NO:4. [0020]
  • Irrespective of the source of the gene, it is preferred that the PAT gene be operatively linked to a constitutive promoter so that the promoter functions to express the gene. In a currently preferred embodiment, the gene encoding PAT is constitutively expressed by functionally linking the gene downstream of a Cauliflower Mosaic Virus (CMV) 35S promoter. A variety of other promoters and plasmid constructs could be employed, as described, for example, in U.S. Pat. Nos. 5,276,268 and 5,273,894; in European Patents EP 0,242,236 and EP 0,242,246; and in co-pending U.S. patent application Ser. No. 08/113,561. [0021]
  • A “PAT gene integration event DNA segment” is the result of an integration event of a gene encoding a PAT enzyme. This is more particularly defined herein as a DNA sequence encoding PAT as well as adjacent plant DNA sequences, preferably, maize DNA sequences, the function of which flanking sequences are affected by the integration of the gene encoding PAT. [0022]
  • Plants, plant lines or hybrids that contain a PAT gene integration event DNA segment are referred to as GR plants, GR lines, GR inbreds or GR hybrids. In particular, an integration event referred to as the B16 integration event is defined as the DNA sequence derived from pDPG165, including the bar gene, that was introduced into maize through genetic engineering techniques as well as maize DNA sequences, the function of which are affected by the integration of the bar gene in the transformant designated B16. [0023]
  • “Crossing” a plant to provide a plant line having an increased yield relative to a starting plant line, as disclosed herein, is defined as the techniques that result in a PAT gene being introduced into a plant line by crossing a starting line with a donor plant line that comprises a PAT gene. To achieve this one would, generally, perform the following steps: [0024]
  • (a) plant seeds of the first (starting line) and second (donor plant line that comprises a PAT gene) parent plants, [0025]
  • (b) grow the seeds of the first and second parent plants into plants that bear flowers; [0026]
  • (c) pollinate the female flower of the first parent plant with the pollen of the second parent plant; and [0027]
  • (d) harvest seeds produced on the parent plant bearing the female flower. [0028]
  • Backcross conversion is herein defined as the process including the steps of: [0029]
  • (a) crossing a plant of a first genotype containing a desired gene, DNA sequence or element to a plant of a second genotype lacking said desired gene, DNA sequence or element; [0030]
  • (b) selecting one or more progeny plant containing the desired gene, DNA sequence or element; [0031]
  • (c) crossing the progeny plant to a plant of the second genotype; and [0032]
  • (d) repeating steps (b) and (c) for the purpose of transferring said desired gene, DNA sequence or element from a plant of a first genotype to a plant of a second genotype. [0033]
  • Introgression of a DNA element into a plant genotype is defined as the result of the process of backcross conversion. A plant genotype into which a DNA sequence has been introgressed may be referred to as a backcross converted genotype, line, inbred, or hybrid. Similarly a plant genotype lacking said desired DNA sequence may be referred to as an unconverted genotype, line, inbred, or hybrid. [0034]
  • It is contemplated that an increase in yield in PAT gene transformants may be a result of an effect of PAT gene activity on plant cell metabolism. It is know that phosphinothricin is an analog of the amino acid glutamate. Furthermore, it is known in plants that inorganic nitrogen is first assimilated into the amino acids glutamate and glutamine and subsequently into aspartate and asparagine and that these amino acids served as a nitrogen reservoir for the plant. It is proposed that the activity of the PAT gene may effect nitrogen metabolism in the plant through acetylation of one or more of these amino acids, or perhaps other compounds, and, therefore, PAT gene activity may effect nitrogen metabolism in the plant cell through the assimilation of inorganic nitrogen into organic compounds. It is contemplated that this alteration in nitrogen assimilation may contribute to increased plant vigor and be further manifested in increased yield. [0035]
  • However, irrespective of the underlying mechanism, the present invention provides methods for increasing the yield of a crop plant that are clearly useful. The invention in one embodiment provides a method for increasing yield of a crop plant that comprises stable transformation of a plant with a DNA sequence that encodes the enzyme phosphinothricin acetyltransferase (PAT). In a preferred embodiment the plant is [0036] Zea mays.
  • In a further embodiment of the present invention, the DNA sequence comprising a PAT gene and adjacent plant genomic DNA sequences is transferred from a PAT gene transformed donor plant to a recipient plant whereby the yield of the recipient plant is increased following introduction of the PAT gene-flanking sequence DNA segment. The DNA sequence is further transferred to other genotypes through the process of backcross conversion and the yield of said backcross converted plants, or hybrids derived therefrom, is increased relative to the unconverted plant. [0037]
  • It is contemplated that increased yield in lines derived by the B16 transformant may be due to the B16 integration event itself. It is proposed that integration of pDPG165 DNA sequences in the B16 transformant inactivated a maize genomic DNA sequence that in the untransformed maize plant contributes to a decrease in yield. For example, plasmid DNA sequences may have integrated into and disrupted a gene that encodes a protein that limits yield and in the absence of the expression of said disrupted gene there is an observed increase in yield. Alternatively, the DNA integration event in B16 may have effected the maize genome in such a manner that the activity of a yield enhancing element is increased with a resultant increase in yield. Defining the precise mechanism(s) that operate, although of scientific interest, is not necessary to the practice of the invention. [0038]
  • In another embodiment of the present invention, an integration event of the bar gene in maize, designated B-3-14-7, or alternatively designated B-3-14-4 or E2 or E5 or E2/ES or B01C16 or B16, increases grain yield when said integration event is introgressed into lines of maize by backcross conversion, including, but not limited to hybrids. [0039]
  • In another embodiment of the present invention, the flanking maize genomic DNA sequences that are situated adjacent to pDPG165 derived DNA sequences in a PAT gene integration event are isolated. Said flanking DNA sequences are employed to identify and clone the maize genomic DNA sequence into which pDPG165 sequences were integrated in the integration event. [0040]
  • In a further embodiment of the present invention, the pDPG165 derived sequences and maize DNA sequences into which pDPG165 was inserted in the integration event are used as a genetic marker in marker assisted breeding for purposes of selecting maize plants with increased yield based on the presence of said pDPG165 or maize DNA sequences into which pDPG165 integrated without having to grow said plants and assay directly for yield. In a preferred embodiment, said integration event is a PAT gene integration event in [0041] Zea mays and more particularly is the bar gene integration event in transformant B16.
  • BRIEF DESCRIPTION OF THE DRAWINGS
  • FIG. 1A. Map of plasmid pDPG165 containing the bar gene. [0042]
  • FIG. 1B. Map of plasmid pDPG208 containing the uidA gene. [0043]
  • FIG. 1C. Map of plasmid pDPG319 containing the aroA gene and the α-tubulin promoter in addition to the bar expression cassette derived from pDPG165. [0044]
  • FIG. 1D. Map of plasmid pDPG354 containing a synthetic Bt gene. [0045]
  • FIG. 1E. Map of plasmid pDPG215 containing a luciferase gene. [0046]
  • FIG. 1F. Map of plasmid pDPG415 containing a synthetic Bt gene. [0047]
  • FIG. 1G. Map of plasmid pDPG417 containing a bar gene. [0048]
  • FIG. 1H. Map of plasmid pDPG344 containing the proteinase inhibitor II gene from tomato. [0049]
  • FIG. 2. Analysis of number of insertion sites in B16 by Southern blot hybridization. B16 DNA was digested with Nsil (lane 1), Stul (lane 2), or Xhol (lane 3). DNA from a nontransformed hybrid plat was digested with Xhol as a negative control (lane 4). [0050] Lane 5 contained EcoRI digested pDPG 165 loaded to represent approximately one copy of pDPG 165 per maize genome. The DNA was probed with 32P-labelled pDPG 165.
  • FIG. 3. Restriction map of the pDPG 165 DNA insertion and flanking maize DNA sequences in B16. [0051]
  • FIG. 4. Field design for analysis of eight hybrids into which a PAT encoding integration event has been introgressed.[0052]
  • DESCRIPTION OF THE PREFERRED EMBODIMENTS
  • It is contemplated that in order to practice the present invention it is necessary to introduce a gene encoding phosphinothricin acetyltransferase into a plant species and regenerate transgenic plants. Furthermore, in those species which are reproduced by sexual methods, it is contemplated that fertile/transgenic plants will be regenerated. However, as some crop species are commonly propagated by asexual means, e.g., potatoes and sugarcane, it is contemplated that the practice of the present invention will not require regeneration of fertile plants. Practice of the invention only requires that a transgenic plant containing the PAT gene be produced and that it be possible to multiply said plant either by sexual or asexual means. [0053]
  • It is believed that introduction of the PAT gene into any plant will lead to an increase in yield of the desired agricultural product. It is well known that a large number of dicotyledonous species may be transformed via [0054] Agrobacterium tumefaciens and that in recent years the applicability of particle bombardment to transformation of monocotyledonous species has been demonstrated. The examples that follow exemplify methods that may be used to produce stable transformants of maize containing the PAT gene. It is understood, however, that this invention is not limited to transformants generated by the methods disclosed herein, but may be practiced following introduction of a PAT gene into plants using any method of transformation.
  • EXAMPLE I Transformation of Cultured Embryogenic Maize Cells
  • It is contemplated that cultured embryogenic maize cells are one of many possible targets for introduction of a gene encoding PAT. Methods for introducing DNA elements into cultured maize cells via particle bombardment are described in U.S. patent application Ser. No. 07/974,379 (incorporated herein by reference) and Gordon-Kamm et al. (1990), and further described as follows. [0055]
  • A. Recipient Cells [0056]
  • Tissue culture requires media and controlled environments. “Media” refers to the numerous nutrient mixtures that are used to grow cells in vitro, that is, outside of the intact living organism. The medium is usually a suspension of various categories of ingredients (salts, amino acids, growth regulators, sugars, buffers) that are required for growth of most cell types. However, each specific cell type requires a specific range of ingredient proportions for growth, and an even more specific range of formulas for optimum growth. Rate of cell growth will also vary among cultures initiated with the array of media that permit growth of that cell type. [0057]
  • Nutrient media is prepared as a liquid, but this may be solidified by adding the liquid to materials capable of providing a solid support. Agar is most commonly used for this purpose. Bactoagar®, Hazelton agar, Gelrite®, and Gelgro® are specific types of solid support that are suitable for growth of plant cells in tissue culture. [0058]
  • Some cell types will grow and divide either in liquid suspension or on solid media. As disclosed herein, maize cells will grow in suspension or on solid medium, but regeneration of plants from suspension cultures requires transfer from liquid to solid media at some point in development. The type and extent of differentiation of cells in culture will be affected not only by the type of media used and by the environment, for example pH, but also by whether media is solid or liquid. Table 1 illustrates the composition of various media useful for creation of recipient cells and for plant regeneration. [0059]
  • B. Culturing Cells to be Recipients for Transformation [0060]
  • The studies described below set forth techniques which have been successfully applied by the inventors to generate transformable and regenerable cultures of maize cells. A variety of different types of media have been developed by the inventors and employed in carrying out various aspects of the invention. The following table, Table 1, sets forth the composition of the media preferred by the inventors for carrying out these aspects of the invention. [0061]
    TABLE 1
    Illustrative Embodiments of Tissue Culture Media Which
    are Used for Type II Callus Development, Development of
    Suspension Cultures and Regeneration of Plant Cells
    (Specifically Maize Cells)
    MEDIA BASAL OTHER COMPONENTS**
    NO. MEDIUM SUCROSE pH (Amount/L)
    52 MS 2% 6.0 .25 mg thiamine
    1 mg 2,4-D
    10−7 M ABA
    Bactoagar ®
    101 MS 3% 6.0 MS vitamins
    100 mg myo-inositol
    Bactoagar ®
    142 MS 6% 6.0 MS vitamins
    5 mg BAP
    0.186 mg NAA
    0.175 mg IAA
    0.403 mg 2IP
    Bactoagar ®
    171 MS 3% 6.0 MS vitamins
    .25 mg 2,4-D
    10 mg BAP
    100 mg myo-inositol
    Bactoagar ®
    173 MS 6% 6.0 MS vitamins
    5 mg BAP
    .186 mg NAA
    .175 mg IAA
    .403 mg 2IP
    10−7 M ABA
    200 mg myo-inositol
    Bactoagar ®
    177 MS 3% 6.0 MS vitamins
    .25 mg 2,4-D
    10 mg BAP
    10−7 M ABA
    100 mg myo-inositol
    Bactoagar ®
    178 MS 5.8 MS vitamins
    1 mg BAP
    1 mg NAA
    10−7 M ABA
    Bactoagar ®
    189 MS 5.8 3 mg BAP
    0.04 mg NAA
    0.5 mg niacin
    800 mg L-asparagine
    100 mg casamino acids
    20 g sorbitol
    1.4 g L-proline
    100 mg myo-inositol
    Gelgro ®
    201 N6 2% 5.8 N6 vitamins
    2 mg L-glycine
    1 mg 2,4-D
    100 mg casein
    hydrolysate
    2.9 g L-proline
    Gelgro ®
    205 N6 2% 5.8 N6 vitamins
    2 mg L-glycine
    .5 mg 2,4-D
    100 mg casein
    hydrolysate
    2.9 g L-proline
    Gelgro ®
    209 N6 6% 5.8 N6 vitamins
    2 mg L-glycine
    100 mg casein
    hydrolysate
    0.69 g L-proline
    Bactoagar ®
    223 N6 2% 5.8 3.3 mg dicamba
    1 mg thiamine
    .5 mg niacin
    800 mg L-asparagine
    100 mg casein
    hydrolysate
    100 mg myoinositol
    1.4 g L-proline
    3 mg bialaphos
    Gelgro ®****
    227 N6 2% 5.8 N6 vitamins
    2 mg L-glycine
    13.2 mg dicamba
    100 mg casein
    hydrolysate
    2.9 g L-proline
    Gelgro ®
    279 N6 2% 5.8 3.3 mg dicamba
    1 mg thiamine
    .5 mg niacin
    800 mg L-asparagine
    100 mg casein
    hydrolysate
    100 mg myoinositol
    1.4 g L-proline
    Gelgro ®****
    401 MS 3% 6.0 3.73 mg Na2EDTA
    .25 mg thiamine
    1 mg 2,4-D
    2 mg NAA
    200 mg casein
    hydrolysate
    500 mg K2SO4
    400 mg KH2PO4
    100 mg myo-inositol
    402 MS 3% 6.0 3.73 mg Na2 EDTA
    .25 mg thiamine
    1 mg 2,4-D
    200 mg casein
    hydrolysate
    2.9 g L-proline
    500 mg K2SO4
    400 mg KH2PO4
    100 mg myo-inositol
    409 MS 3% 6.0 3.73 mg Na2 EDTA
    .25 mg thiamine
    9.9 mg dicamba
    200 mg casein
    hydrolysate
    2.9 g L-proline
    500 mg K2SO4
    400 mg KH2PO4
    100 mg myo-inositol
    425 MS 3% 6.0 3.73 mg Na2EDTA
    .25 mg thiamine
    9.9 mg dicamba
    200 mg casein
    hydrolysate
    2.9 g L-proline
    500 mg K2SO4
    400 mg KH2PO4
    100 mg myo-inositol
    3 mg bialaphos
    431 MS 3% 6.0 3.73 mg Na2 EDTA
    .25 mg thiamine
    9.9 mg dicamba
    200 mg casein
    hydrolysate
    2.9 g L-proline
    500 mg K2SO4
    400 mg KH2PO4
    100 mg myo-inositol
    200 mOsm sorbitol
    501 Clark's 2% 5.7
    Medium***
    607 1/2 × MS 3% 5.8 1 mg thiamine
    1 mg niacin
    Gelrite ®
    734 N6 2% 5.8 N6 vitamins
    2 mg L-glycine
    1.5 mg 2,4-D
    0.7 g Fe sequestrene
    200 mg casein
    hydrolysate
    0.69 g L-proline
    Gelrite ®
    735 N6 2% 5.8 1 mg 2,4-D
    .5 mg niacin
    .91 g L-asparagine
    100 mg myo-inositol
    1 mg thiamine
    .5 g MES
    .75 g MgCl2
    100 mg casein
    hydrolysate
    0.69 g L-proline
    Gelgro ®
    739 N6 2% 5.8 1 mg 2,4-D
    .5 mg niacin
    .91 g L-asparagine
    100 mg myo-inositol
    1 mg thiamine
    .5 g MES
    .75 g MgCl2
    100 mg casein
    hydrolysate
    0.69 g L-proline
    1 mg bialaphos
    Gelgro ®
    750 N6 2% 5.8 1 mg 2,4-D
    .5 mg niacin
    .91 g L-asparagine
    100 mg myo-inositol
    1 mg thiamine
    .5 g MES
    .75 g MgCl2
    100 mg casein
    hydrolysate
    0.69 g L-proline
    0.2 M mannitol
    1 mg bialaphos
    Gelgro ®
    758 N6 2% 5.8 1 mg 2,4-D
    .5 mg niacin
    .91 g L-asparagine
    100 mg myo-inositol
    1 mg thiamine
    .5 g MES
    .75 g MgCl2
    100 mg casein
    hydrolysate
    0.69 g L-proline
    3 mg bialaphos
    Gelgro ®
    2004 N6 3% 5.8 1 mg thiamine
    0.5 mg niacin
    3.3 mg dicamba
    17 mg AgNO3
    1.4 g L-proline
    0.8 g L-asparagine
    100 mg casein
    hydrolysate
    100 mg myo-inositol
    Gelrite ®
    2008 N6 3% 5.8 1 mg thiamine
    0.5 mg niacin
    3.3 mg dicamba
    1.4 g L-proline
    0.8 g L-asparagine
    Gelrite ®
  • C. Initiation of the Suspension Culture (A188 X B73)82 (Designated SC82) for Use in Transformation [0062]
  • This Example describes the development of a cell line employed in various of the transformation studies set forth below, termed SC82. In the development of SC82, inoculum for suspension culture initiation was visually selected from a Type II callus that was initiated from A188 x B73 immature embryos plated on a N6-based medium containing 13.2 mg/l dicamba (227, Table 1). The suspension culture was initiated within three months of initiation of the Type II callus. Small amounts (50 to 100 mg) of callus, distinguishable by visual inspection because of its highly proembryonic morphology, were isolated from more mature or organized structures and inoculated into a 50 ml flask containing 5 mls of filter-sterilized conditioned medium from the various G(A188 x B73) 716 suspension cultures (402 medium with four types of capsule treatments and 409 medium). [0063]
  • After one week, this 5 ml culture was sieved through a 710 micron mesh and used to inoculate 20 mls of corresponding fresh and filter-sterilized conditioned medium from the established G(A188 x B73) 716 cultures in 150 ml flasks. After one week or more of growth, two mls of packed cells were subcultured to fresh media by the method described above. The suspension culture maintained on 409 by this method was then cryopreserved within three months. The original cell line, which was maintained on 409 (not a reinoculated cryopreserved culture), was used in [0064] Studies 1 and 2 months later which resulted in stable transformation and selection.
  • D. Initiation and Maintenance of Cell Line AT824. [0065]
  • This example describes the initiation and maintenance of cell line AT824 which has been used routinely for transformation studies. Immature embryos (0.5 to 1.0 mm) were excised from the B73-derived inbred line AT and cultured on N6 medium with 100 μM silver nitrate, 3.3 mg/L dicamba, 3% sucrose and 12 mM proline (2004). Six months after initiation Type I callus was transferred to medium 2008. Two months later Type I callus was transferred to a medium with a lower concentration of sucrose (279). A sector of Type II callus was identified 17 months later and was transferred to 279 medium. This cell line was uniform in nature, unorganized, rapid growing, and embryogenic. This culture was desirable in the context of this invention as it was easily adaptable to culture in liquid or on solid medium. [0066]
  • The first suspension cultures of AT824 were initiated 31 months after culture initiation. Suspension cultures may be initiated in a variety of culture media including media containing 2,4-D as well as dicamba as the auxin source, e.g., media designated 210, 401, 409, 279. Cultures are maintained by transfer of approximately 2 ml packed cell volume to 20 ml fresh culture medium at 3% day intervals. AT824 can be routinely transferred between liquid and solid culture media with no effect on growth or morphology. [0067]
  • Suspension cultures of AT824 were initially cryopreserved 33 to 37 months after culture initiation. The survival rate of this culture was improved when it was cryopreserved following three months in suspension culture. AT824 suspension cultures have been cryopreserved and reinitiated from cryopreservation at regular intervals since the initial date of freezing. Repeated cycles of freezing have not affected the growth or transformability of this culture. [0068]
  • E. Preferred Methods of Delivering DNA to Cells [0069]
  • There are several potential cellular targets for DNA delivery to produce fertile transgenic plants: pollen, microspores, meristems, immature embryos and cultured embryogenic cells are but a few examples. [0070]
  • Microprojectile bombardment is now recognized as a routine technique for introduction of exogenous DNA into plant cells. The details of this technique and its use to introduce exogenous DNA into various plant cells are discussed in Wang et al. (1988); Wan & Lemaux (1994); Weeks et al. (1993); Casas et al. (1993); Gordon-Kamm et al. (1990); Christou et al. (1991) and Christou et al. (1988). One method of determining the efficiency of DNA delivery into the cells via microprojectile bombardment employs detection of transient expression of the enzyme β-glucuronidase (GUS) in bombarded cells. For this method, plant cells are bombarded with a DNA construct which directs the synthesis of the GUS enzyme. [0071]
  • Apparati are available which perform microprojectile bombardment. A commercially available source is an apparatus made by Biolistics, Inc. (now DuPont), but other microprojectile or acceleration methods are within the scope of this invention. Of course, other “gene guns” may be used to introduce DNA into cells. [0072]
  • Several modifications of the microprojectile bombardment method were made by the inventors. For example, stainless steel mesh screens were introduced below the stop plate of the bombardment apparatus, i.e., between the gun and the cells. Furthermore, modifications to existing techniques were developed by the inventors for precipitating DNA onto the microprojectiles. [0073]
  • Another newly emerging technique for the introduction of DNA into plant cells is electroporation of intact cells. The details of this technique are described in Krzyzek and Laursen (PCT publication WO 92/12250). Similar to particle bombardment, the efficiency of DNA delivery into cells by electroporation can be determined by using the P-glucuronidase gene. The method of electroporation of intact cells and by extension intact tissues, e.g., immature embryos, was developed by Krzyzek and Laursen and represents improvements over published procedures. Generation of fertile plants using these techniques were described by Spencer et al. (Spencer et al., 1994) and Laursen et al. (1994). [0074]
  • It is contemplated that other methods may also be used for introduction of DNA into plant cells. [0075]
  • F. Microprojectile Bombardment [0076]
  • For bombardment, friable, embryogenic Type-II callus (Armstrong & Green, 1985) was initiated from immature embryos essentially as set forth above. The callus was initiated and maintained on N6 medium (Chu et al., 1975) containing 2 mg/l glycine, 2.9 g/l L-proline, 100 mg/l casein hydrolysate, 13.2 mg/l dicamba or 1 mg/[0077] l 2,4-D, 20 g/l sucrose, pH 5.8, solidified with 2 g/l Gelgro® (ICN Biochemicals). Suspension cultures initiated from these callus cultures were used for bombardment.
  • In the case of SC82, suspension culture SC82 was initiated from Type-II callus maintained in culture for three months. SC82 cells were grown in liquid medium for approximately four months prior to bombardment. SC82 cells were also cryopreserved five months after suspension culture initiation, stored frozen for five months, thawed and used for bombardment. [0078]
  • Prior to bombardment, recently subcultured suspension culture cells were sieved through 1000 μm stainless steel mesh. From the fraction of cell clusters passing through the sieve, approximately 0.5 ml packed cell volume (PCV) were pipetted onto 5 cm filters (Whatman #4) and vacuum-filtered in a Buchner funnel. The filters were transferred to petri dishes containing three 7 cm filters (Whatman #4) moistened with 2.5 ml suspension culture medium. [0079]
  • The dish containing the filters with the suspension cells was positioned 6 cm below the lexan plate used to stop the nylon macroprojectile. With respect to the DNA, when more than a single plasmid was used, plasmid DNA was precipitated in an equimolar ratio onto tungsten particles (average diameter approximately 1.2 μm, GTE Sylvania) using a modification of the protocol described by Klein et al., (1987). In the modified procedure, tungsten was incubated in ethanol at 65° C. for 12 hours prior to being used for precipitation. The precipitation mixture included 1.25 mg tungsten particles, 25 μg plasmid DNA, 1.1 M CaCl[0080] 2 and 8.7 mM spermidine in a total volume of 575 μl. After adding the components in the above order, the mixture was vortexed at 4° C. for 10 minutes, centrifuged (500× G) for 5 minutes and 550 μl of supernatant was decanted. From the remaining 25 μl of suspension, a 1 μl aliquot was pipetted onto the macroprojectile for bombardment.
  • Each plate of suspension cells was bombarded twice at a vacuum of 28 inches Hg. In bombarding the embryogenic suspensions of A188 X B73, 100 μm or 1000 μm stainless steel screens were placed about 2.5 cm below the stop plate in order to increase the number of foci while decreasing their size and also to ameliorate injury to the bombarded tissue. After bombardment, the suspension cells and the supporting filter were transferred onto solid medium or the cells were scraped from the filter and resuspended in liquid culture medium. [0081]
  • Cells from embryogenic suspension cultures of maize were bombarded with the bar-containing plasmid pDPG165 (FIG. 1A) alone or in combination with a plasmid encoding GUS, pDPG208 (FIG. 1B). In studies in which a GUS plasmid was included, two of the filters containing bombarded cells were histochemically stained 48h post-bombardment. The total number of foci (clusters of cells) per filter transiently expressing GUS was at least 1000. In two separate studies designed to quantitate transiently expressing cells (using an SC82 (A188 x B73) suspension culture), the mean number of GUS-staining foci per filter was 1472 and 2930. The number of cells in individual foci that expressed GUS averaged 2 to 3 ([0082] range 1 to 10). Although histochemical staining can be used to detect cells transformed with the gene encoding GUS, those cells will no longer grow and divide after staining. For detecting stable transformants and growing them further, e.g., into plants, selective systems compatible with viability are required.
  • G. Microprojectile Bombardment—AT824 [0083]
  • Suspension culture AT824 was subcultured to fresh medium 409 two days prior to particle bombardment. Cells were plated on solid 409 medium 16 to 24 hours before bombardment (about 0.5 ml packed cell volume per filter). Tissue was treated with 409 medium containing 200 mOsm sorbitol (medium 431) for one hour prior to bombardment. [0084]
  • DNA was introduced into cells using the DuPont Biolistics PDS1000He particle bombardment device. [0085]
  • DNA was precipitated onto gold particles as follows. A stock solution of gold particles was prepared by adding 60 mg of 1 μm gold particles to 1000 μl absolute ethanol and incubating for at least three hours at room temperature followed by storage at −20° C. Twenty to 35 μl sterile gold particles were centrifuged in a microcentrifuge for one minute. The supernatant was removed and one ml sterile water was added to the tube, followed by centrifugation at 2000 rpm for five minutes. Microprojectile particles are resuspended in 30 μl of DNA solution (30 μg total DNA) containing 10 μg each of the following vectors: pDPG165 (bar), pDPG344 (tomato proteinase inhibitor II gene), and pDPG354 ([0086] B. thuringiensis crystal toxin protein gene). Two hundred twenty microliters sterile water, 250 μl 2.5 M CaCl2 and 50 μl spermidine were added. The mixture was thoroughly mixed and placed on ice, followed by vortexing at 4° C. for 10 minutes and centrifugation at 500 rpm for five minutes. The supernatant was removed and the pellet resuspended in 600 μl absolute ethanol. Following centrifugation at 500 rpm for five minutes the pellet was resuspended in 36 μl of absolute ethanol.
  • Ten μl of the particle preparation were dispensed on the surface of the flyer disk and the ethanol was allowed to dry completely. Particles were accelerated by a helium blast of approximately 1100 psi. One day following bombardment, cells were transferred to liquid medium 409 (10 ml). Tissue was subcultured twice per week. During the first week there was no selection pressure applied. [0087]
  • H. Further Optimization of Ballistic Transformation [0088]
  • This example describes the optimization of the ballistic transformation protocol. Both physical and biological parameters for bombardment have been addressed. Physical factors are those that involve manipulating the DNA/microprojectile precipitate or those that affect the flight and velocity of either the macro- or microprojectiles. Biological factors include all steps involved in manipulation of cells immediately after bombardment. The prebombardment culturing conditions, such as osmotic environment, the bombardment parameters, and the plasmid configuration have been adjusted to yield the maximum numbers of stable transformants. [0089]
  • Physical Parameters [0090]
  • Gap Distance The variable nest (macro holder) can be adjusted to vary the distance between the rupture disk and the macroprojectile, i.e., the gap distance. This distance can be varied from 0 to 2 cm. The predicted effects of a shorter gap are an increase of velocity of both the macro- and microprojectiles, an increased shock wave (which leads to tissue splattering and increased tissue trauma), and deeper penetration of microprojectiles. Longer gap distances would have the opposite effects but may increase viability and, therefore, the total number of recovered stable transformants. [0091]
  • The effect of gap distance was investigated by bombarding an embryogenic suspension with pDPG208. Plates were shot in triplicate at gaps of 3, 6, 9, and 12 mm. Tissue was assayed for GUS activity and foci were counted. Using a 3 mm gap, GUS foci were the most numerous and well distributed across the filter. The gas shock wave appeared to be the greatest at this distance as shown by the degree of tissue splattering. Previous studies performed at this gap size also have shown poor tissue recovery. Gaps of 6 mm and 9 mm showed little to no tissue splattering. GUS foci were well distributed across the filter but were fewer in number than those in the 3 mm samples. Samples bombarded with a gap distance of 12 mm showed nearly equivalent numbers of GUS foci as with sample bombarded at 6 mm and 9 mm but they were located almost exclusively at the center of the filter. No tissue splattering was observed. Based on these observations, it is suggested that bombardments be conducted with a gap distance of 6 to 9 mm. [0092]
  • Flight Distance The fixed nest (contained within the variable nest) can be varied between 0 and 2 cm in predetermined increments by the placement of spacer rings to adjust the flight path traversed by the macroprojectile. Short flight paths allow for greater stability of the macroprojectile in flight but reduce the overall velocity of the microprojectiles. Increased stability in flight increases the number of centered GUS foci. Greater flight distances (up to some point) increase velocity but also increase instability in flight. [0093]
  • The effect of the macroprojectile flight path length was investigated using El suspension cells. The flight distances tested were 0, 1.0, 1.5, and 2.0 cm. Samples were bombarded with pDPG208 GUS vector and were assayed 48 hours after bombardment for GUS activity. The number of GUS foci was the greatest at a flight path length of 1.0 cm and least at 0 cm. No tissue splattering was observed at 0 cm, very little at 1.0 cm, and a greater amount at 1.5 and 2.0 cm. Based on these observations, it is recommended that bombardments be done with a flight path length of 1.0 cm. [0094]
  • Tissue distance Placement of tissue within the gun chamber should have significant effects on microprojectile penetration. Increasing the flight path of the microprojectiles will decrease velocity and trauma associated with the shock wave. A decrease in velocity will also result in shallower penetration of the microprojectiles. [0095]
  • Helium pressure By manipulation of the type and number of rupture disks, pressure can be varied between 400 and 2000 psi within the gas acceleration tube. Optimum pressure for stable transformation has been determined to be between 1000 and 1200 psi. [0096]
  • Biological Parameters [0097]
  • Culturing conditions and other factors can influence the physiological state of the target cells and may have profound effects on transformation and integration efficiencies. First, the act of bombardment could stimulate the production of ethylene which could lead to senescence of the tissue. The addition of antiethylene compounds could increase transformation efficiencies. Second, it is proposed that certain points in the cell cycle may be more appropriate for integration of introduced DNA. Hence synchronization of cell cultures may enhance the frequency of production of transformants. Third, the degree of tissue hydration may also contribute to the amount of trauma associated with bombardment as well as the ability of the microprojectiles to penetrate cell walls. [0098]
  • It has also been reported that slightly plasmolyzed yeast cells allow increased transformation efficiencies (Armaleo et al., 1990). It was hypothesized that the altered osmotic state of the cells helped to reduce trauma associated with the penetration of the microprojectile. Lastly, the growth and cell cycle stage may be important with respect to transformation. [0099]
  • Osmotic adjustment It has been suggested that osmotic pre-treatment could potentially reduce bombardment associated injury as a result of the decreased turgor pressure of the plasmolyzed cell. Two studies were done in which E1 suspension cells were osmotically adjusted with media supplemented with sorbitol. Cells were plated onto osmotic media 24 hours prior to bombardment. The osmotic values of the media were 200, 400, and 600 mOSM/kg. Samples were bombarded with either pDPG208 (GUS) or pDPG165 (bar). GUS samples were assayed and foci were counted and plotted. Cells osmotically adjusted at 400 mOSM/kg showed an approximately 25% increase in the number of transient GUS foci. Samples bombarded with bar were selected in liquid (2 mg/l bialaphos) and thin plated on medium containing 3 mg/l bialaphos. Cells treated with 600 mOSM/kg medium grew more slowly than cells treated with media of other osmotic strengths in this study. [0100]
  • A second study investigated the effects of short duration osmotic adjustment at 500 mOSM/kg on both transient GUS expression and stable transformation. The rationale for the short duration of osmotic adjustment was that cells should be plasmolyzed just before bombardment, using longer time periods of pretreatment may allow the cells to adjust to the osmoticum (i.e. re-establishing turgor). The first control was bombarded (0 minutes, no new medium) followed by cells pretreated for 45 minutes and 90 minutes with 500 mOSM/kg medium with either pDPG208 or pDPG165. Since the pretreatment required media changes (i.e. fresh 500 mOSM/kg media), a set of controls was also washed using fresh medium without the osmoticum. After bombardment the cells were put onto solid medium to recover overnight followed by resuspension in liquid medium. After one week, liquid selection was started using 2 μg/ml bialaphos. Cells were plated on 3 μg/ml bialaphos at 0.1 ml PCV eleven days after bombardment. Transient GUS activity was assayed 48 hours after bombardment. [0101]
  • The number of cells transiently expressing GUS increased following subculture into both fresh medium and osmotically adjusted medium. Pretreatment times of 90 minutes showed higher numbers of GUS expressing foci than shorter times. Cells incubated in 500 mOSM/kg medium for 90 minutes showed an approximately 3.5-fold increase in transient GUS foci than the control. [0102]
  • I. Identification of Transformed Cells Using Selectable Markers [0103]
  • It is believed that DNA is introduced into only a small percentage of cells in any one study. In order to provide a more efficient system for identification of those cells receiving DNA and integrating it into their genomes one may desire to employ a means for selecting those cells that are stably transformed. One exemplary embodiment of such a method is to introduce into the host cell a marker gene which confers resistance to some normally inhibitory agent, e.g. an antibiotic or herbicide. The potentially transformed cells are then exposed to the agent. In the population of surviving cells are those cells wherein generally the resistance-conferring gene has been integrated and expressed at sufficient levels to permit cell survival. Cells may be tested further to confirm stable integration of the exogenous DNA. Using embryogenic suspension cultures, stable transformants are recovered at a frequency of approximately one per 1000 transiently expressing foci. [0104]
  • One of the difficulties in cereal transformation, e.g., corn, has been the lack of an effective selective agent for transformed cells, from totipotent cultures (Potrykus, 1989). Stable transformants were recovered from bombarded nonembryogenic Black Mexican Sweet (BMS) maize suspension culture cells, using the neo gene and selection with the aminoglycoside, kanamycin (Klein, 1989). This approach, while applicable to the present invention, is not preferred because many monocots are insensitive to high concentrations of aminoglycosides (Dekeyser et al., 1989; Hauptmann et al., 1988). The stage of cell growth, duration of exposure and concentration of the antibiotic may be critical to the successful use of aminoglycosides as selective agents to identify transformants (Lyznik et al., 1989; Yang et al., 1988; Zhang et al., 1988). For example, D'Halluin et al. (1992) demonstrated that using the neo gene and selecting with kanamycin transformants could be isolated following electroporation of immature embryos of the genotype H99 or Type I callus of the genotype PA91. [0105]
  • One herbicide which has been demonstrated as a desirable selection agent is the broad spectrum herbicide bialaphos (Gordon-Kamm et al., 1990; Casas et al., 1993; and Weeks et al., 1993). Bialaphos is a tripeptide antibiotic produced by [0106] Streptomyces hygroscopicus and is composed of phosphinothricin (PPT), an analogue of L-glutamic acid, and two L-alanine residues. Upon removal of the L-alanine residues by intracellular peptidases, the PPT is released and is a potent inhibitor of glutamine synthetase (GS), a pivotal enzyme involved in ammonia assimilation and nitrogen metabolism (Ogawa et al., 1973). Synthetic PPT, the active ingredient in the herbicides Basta® or Ignite® is also effective as a selection agent. Inhibition of GS in plants by PPT causes the rapid accumulation of ammonia and death of the plant cells.
  • The organism producing bialaphos and other species of the genus Streptomyces also synthesizes an enzyme phosphinothricin acetyl transferase (PAT) which is encoded by the bar gene in [0107] Streptomyces hygroscopicus and the pat gene in Streptomyces viridochromogenes. The use of the herbicide resistance gene encoding phosphinothricin acetyl transferase (PAT) is referred to in the published German patent application DE 3642 829 A, wherein the gene is isolated from Streptomyces viridochromogenes. In the bacterial source organism this enzyme acetylates the free amino group of PPT preventing auto-toxicity (Thompson et al., 1987). The bar gene has been cloned (Murakami et al., 1986; Thompson et al., 1987) and expressed in transgenic tobacco, tomato and potato plants (De Block, 1987) and Brassica (De Block, 1989). In previous reports, some transgenic plants which expressed the resistance gene were completely resistant to commercial formulations of PPT and bialaphos in greenhouses.
  • PCT Application No. WO 87/00141 refers to the use of a process for protecting plant cells and plants against the action of glutamine synthetase inhibitors. This application also refers to the use of such of a process to develop herbicide resistance in determined plants. The gene encoding resistance to the herbicide BASTA® (Hoechst, phosphinothricin) or Herbiace® (Meiji Seika, bialaphos) was said to be introduced by Agrobacterium infection into tobacco ([0108] Nicotiana tabacum cv Petit Havan SR1), potato (Solanum tuberosum cv Benolima) and tomato (Lycopersicum esculentum) and conferred on plants resistance to application of herbicides.
  • An exemplary embodiment of vectors capable of delivering DNA to plant host cells is the plasmid, pDPG165. The plasmid pDPG165 is illustrated in FIG. 1A. A very important component of this plasmid for purposes of genetic transformation is the bar gene which encodes a marker for selection of transformed cells exposed to bialaphos or PPT. [0109]
  • J. Selection of Bar Transformants Using Bialaphos in the Cell Line SC82 Following Particle Bombardment [0110]
  • The suspension culture (designated SC82) used in the initial studies was derived from embryogenic Type-II callus of A188 X B73. Following bombardment , cells on filters were resuspended in nonselective liquid medium, cultured for one to two weeks and transferred to filters overlaying solid medium containing 1 or 3 mg/l bialaphos. The degree of inhibition of tissue growth during selection was dependent upon the density of the cells on the filter and on the concentration of bialaphos used. At the density plated (0.5 PCV/filter), growth of cells cultured on 1 mg/l bialaphos was only partially inhibited (˜30-50% of nonselected growth) and after three to four weeks much of this tissue was transferred as discrete clumps (˜5 mm in diameter) to identical medium. On medium containing 3 mg/l bialaphos, the growth of cells on the original selection filter was severely inhibited (˜10% of nonselected growth) and selection was carried out without removing the tissue from the original filter. [0111]
  • Using either selection protocol (1 or 3 mg/l bialaphos), resistant cell colonies emerged on the selection plates of SC82 bombarded with pDPG165 approximately six to seven weeks after bombardment. Bialaphos-resistant calli were maintained and expanded on selection medium. Much of this tissue was embryogenic. No colony growth occurred on plates to which cells were added from untransformed suspension cultures. These were controls which confirm the prediction that cells without the bar gene are not resistant to bialaphos. [0112]
  • Colonies on solid supports are visible groups of cells formed by growth and division of cells plated on such support. The cells capable of growth are those that are resistant to the presence of the herbicide bialaphos, said resistance resulting from integration and expression of the bar gene. Exposure of cells was to 1 mg/l bialaphos. Bialaphos-resistant cultures maintained on selection media were embryogenic. One transformant recovered in this study was designated B-3-14-7 and is also referred to as E2/E5 or B16 [0113]
  • As a confirmation that the cells forming the colonies had indeed incorporated the bar gene and were expressing it, bialaphos-resistant callus lines were analyzed for activity of the bar gene product, phosphinothricin acetyl transferase (PAT), by thin-layer chromatography. Protein extracts from eleven callus lines (E1 to E11) isolated from SC82 bombardment studies contained PAT activity and activity levels varied approximately 10-fold among the isolates. [0114]
  • Still further and more direct confirmation of the presence of the bar gene was obtained by analysis of the genomic DNA of potential transformants by DNA gel blots. The sources of DNA which were electrophoresed through the gel were the bialaphos-resistant callus lines designated E1 to E11 and a non-selected control, EO. After the DNA was electrophoresed through the gel and transferred to nylon membranes, the resulting blot was hybridized with a [0115] 32P-labeled bar gene sequence from the plasmid pDPG165. The radioactivity used per blot was approximately 25×106 Cerenkov cpm.
  • Genomic DNA from all eleven bialaphos-resistant isolates contained bar-hybridizing sequences. The hybridization in all isolates to a fragment migrating slightly larger than 2 kb may be due to contaminating pUC19 sequences contained in this bar probe preparation; no such hybridization occurred in subsequent studies using the same genomic DNA and a different preparation of the bar probe. Hybridization to a 1.9 kb fragment in eight of the 11 isolates indicated that these isolates contained intact copies of the 1.9 kb bar expression unit. The estimated copy numbers of the intact unit ranged from one or two (E1, E7, E8, E10, E11) to approximately 20 (E3, E4, E6). Hybridization with the bar probe in isolate B16 occurred only to a single, higher molecular weight fragment (˜3 kb). [0116]
  • To establish that the PAT coding sequence was intact in isolate B16 (also known as E2 or E5) genomic DNA was digested with SmaI, which releases a 559 bp fragment containing the PAT structural gene (FIG. 1A), and subjected to DNA gel blot analysis using [0117] 32P-labeled bar. This analysis confirmed the presence of a single intact copy of bar. Expression of PAT in these isolates may not be dependent on the 35S promoter or the Tr7 3′ end. The hybridization patterns of some of the isolates were identical (E2 and E5; E7 and E8; E3, E4, and E6); therefore, it is probable that some isolates did not arise from independent transformation events but represent transformants that were separated during selection.
  • Seven hybridization patterns were unique, likely representing seven independent single-cell transformation events. The patterns and intensities of hybridization for the seven transformants were unchanged during four months in culture, providing evidence for the stability of the integrated sequences. The seven independent transformants were derived from two separate bombardment studies. Four independent transformants representing isolates E2/E5, E3/E4/E6, E1 and E7/E8, were recovered from a total of four original filters from a first study and the three additional independent transformants, E9, E10, and E11, were selected from tissue originating from six bombarded filters in a second study. [0118]
  • K. Transformation of Cell Line AT824 Using Bialaphos Selection Following Particle Bombardment—Selection in Liquid Medium [0119]
  • The suspension culture (designated AT824) used in this study was derived from an elite B73-derived inbred. The culture was maintained in medium 409. Four filters were bombarded as described in the present example. [0120]
  • Following one week culture in liquid medium 409 without selection pressure, tissue was transferred to liquid medium 409 containing 1 mg/L bialaphos. Cells were transferred twice per week into fresh medium containing 1 mg/L bialaphos for two weeks. Tissue was thin plated three weeks following bombardment at a concentration of 0.1 ml packed cell volume per petri dish containing medium 425 (with 3 mg/L bialaphos). Transformants were identified as discreet colonies six weeks following bombardment. It is the experience of the inventors that all cell lines that grow on 3 mg/L bialaphos contain the bar gene. Fifty transformed cell lines were recovered from this study. [0121]
  • L. Transformation of Cell Line AT824 Using Bialaphos Selection Following Particle Bombardment—Solid Medium Selection [0122]
  • Cells in study S10 were bombarded as described earlier in 2 this example, except the gold particle-DNA preparation was made using 25 μl pDPG319 DNA (bar gene and aroA expression cassette containing the a-tubulin promoter). Following particle bombardment, cells remained on solid 279 medium in the absence of selection for one week. At this time cells were removed from solid medium, resuspended in liquid 279 medium, replated on Whatman filters at 0.5 ml PCV per filter, and transferred to 279 medium containing 1 mg/L bialaphos. Following one week, filters were transferred to 279 medium containing 3 mg/L bialaphos. One week later, cells were resuspended in liquid 279 medium and plated at 0.1 ml PCV on 279 medium containing 3 mg/L bialaphos. Nine transformants were identified seven weeks following bombardment. [0123]
  • M. Regeneration of Plants from SC82 [0124]
  • One efficient regeneration system involved transfer of embryogenic callus to MS (Murashige & Skoog, 1962) medium containing 0.25 mg/[0125] l 2,4-dichlorophenoxyacetic acid and 10.0 mg/l 6-benzyl-aminopurine. Tissue was maintained on this medium for approximately two weeks and subsequently transferred to MS medium without growth regulators (Shillito et al., 1989). Shoots that developed after two to four weeks on growth regulator-free medium were transferred to MS medium containing 1% sucrose and solidified with 2 g/l Gelgro®R in Plant ConR containers where rooting occurred.
  • Another successful regeneration scheme involved transfer of embryogenic callus to N6 (Chu et al., 1975) medium containing 6% sucrose and no growth regulators (Armstrong & Green, 1985) for two weeks followed by transfer to MS medium without growth regulators as described above. Regeneration was performed at 25° C. under fluorescent lights (250 microeinsteins·m[0126] −2·s−1). After approximately two weeks developing plantlets were transferred to a Plant Con® container containing medium 501. When plantlets had developed three leaves and two to three roots they were transferred to soil, hardened off in a growth chamber (85% relative humidity, 600 ppm CO2, 250 microeinsteins·m−2·s−1), and grown to maturity either in a growth chamber or a greenhouse.
  • Regeneration of plants from transformed cells requires careful attention to details of tissue culture techniques. One of the major factors is the choice of tissue culture media. There are many media which will support growth of plant cells in suspension cultures, but some media give better growth than others at different stages of development. Moreover, different cell lines respond to specific media in different ways. A further complication is that treatment of cells from callus initiation through transformation and ultimately to the greenhouse as plants, requires a multivariate approach. A progression consisting of various media types, representing sequential use of different media, is needed to optimize the proportion of transformed plants that result from each cell line. [0127]
  • A preferred embodiment for use on cell lines SC82, at least initially, is the combination of culture media 227, 171, 101, 501. Media 227 is a good media for the selective part of the studies, for example, to use for growth of callus in the presence of bialaphos. This media contains the growth regulator dicamba. NAA and 2,4-D are growth regulators in other media. [0128]
  • Thus, it can be seen from Table 1 that the various media are modified so as to make them particularly applicable to the development of the transformed plant at the various stages of the transformation process. For example, subculture of cells in media 171 after applying the selective agent, yields very small embryos. Moreover, it is believed that the presence of BAP in the media facilitates development of shoots. Myo-inositol is believed to be useful in cell wall synthesis. Shoot elongation and root development proceeds after transfer to media 101. 101 and 501 do not contain the growth regulators that are required for earlier stages of regeneration. [0129]
  • Transfer of regenerating plants is preferably completed in an agar-solidified media adapted from a nutrient solution developed by Clark (1982), media 501. The composition of this media facilitates the hardening of the developing plants so that they can be transferred to the greenhouse for final growth as a plant. The salt concentration of this media is significantly different from that of the three media used in the earlier stages, forcing the plant to develop its own metabolic pathways. These steps toward independent growth are required before plants can be transferred from tissue culture vessels (e.g. petri dishes, plant cans) to the greenhouse. [0130]
  • Approximately 50% of transformed callus lines derived from the initial SC82 studies were regenerable by the routes tested. Transgenic plants were regenerated from four of seven independent SC82 transformants and 10 of 20 independent SC716 transformants. [0131]
  • Regeneration of transformed SC82 selected cell lines yielded 76 plants transferred to the soilless mix, and 73 survived. The plants were regenerated from six bialaphos-resistant isolates, representing four of seven clonally independent transformants. Eighteen protocols were used successfully to regenerate the 76 plants (Table 2). Differences in morphology between cell lines deemed some protocols more suitable than others for regeneration. [0132]
    TABLE 2
    EFFECTS OF PROGRESSION OF MEDIA ON THE NUMBER OF PLANTS REGENERATED (SC82)*
    227B 227B 227B 227B 227B
    227B 227B 227B 227B 227B 227B 227B 201B 227B 201B 201B 201B 201B
    227B 227B 227B 227A 227A 227A 171 52 52 52 171 201B 227B 205 227B 205 1 52
    142 173 171 205 209 173 173 173 173 171 173 173 178 171 177 177 178 171
    CELL 101 101 101 101 101 101 101 101 101 101 101 101 101 101 101 101 101 101 # OF
    LINE 501 501 501 501 501 501 501 501 501 501 501 501 501 501 501 501 501 501 PLANTS
    B3-14-4 1 X 14 X X X 1 1 X 2 X X 5 X 5 X X X 29
    B3-14-9 X X 1 1 X 4 1 X X X X X X 1 X 1 X X 9
    B3-14-7 X X X X X X X X X X 6 2 X X X X X 1 9
    B3-14-6 X X X X 1 X X X X X X X X X X X X X 1
    B3-14-3 X X X X X X X X X X X X X X X X X X 0
    B3-14-2 X X X X X X X X X X X X X X X X X X 0
    B3-14-1 X X X X X X X X X X X X X X X X X X 0
    B3-14-5 X X X X X X X X X X X X X X X X X X 0
    B3-13-5 X X X X X X X X X X X X X X X X X X 0
    B3-13-2 X 1 13 X X X 3 2 2 X X X X X 1 X X X 22
    B3-13-1 X 3 X 1 X X X X 1 X X X X X X X 1 X 6
    TOTAL 1 4 28 2 1 4 5 3 3 2 6 2 5 1 6 1 1 1 76
  • Prior to regeneration, the callus was transferred to either a) an NG-based medium containing either dicamba or 2,4-D or b) an MS-based medium containing 2,4-D. These steps allowed further embryoid development prior to maturation. Most of the maturation media contained high BAP levels (5 to 10 mg/l) to enhance shoot development and cause proliferation. An MS-based medium with low 2,4-D (0.25 mg/l) and high BAP (10 mg/l), as described by Shillito et al. (1989) was found to be quite effective for regeneration. [0133]
  • Likewise, an MS-based medium containing 1 μm NAA, 1 μm IAA, 2 μm 2-IP, and 5 mg/l BAP (modified from Conger et al., 1987) also promoted plant regeneration of these transformants. After plantlets recovered by any of the regenerative protocols had grown to 5 cm, they were transferred to a nutrient solution described by Clark (1982) supplemented with 2% sucrose and solidified with Gelgro®. Plantlets which were slow to develop roots were treated with 3 μl droplets of 0.3% IBA at the base of the shoot to stimulate rooting. Plants with well-developed root systems were transferred to a soilless mix and grown in controlled environmental chambers from five to 10 days, prior to transfer to the greenhouse. [0134]
  • N. Regeneration of AT824 Transformants [0135]
  • Transformed tissue was first transferred to solid medium 223 and incubated for two weeks. Transformants may be initially subcultured on any solid culture that supports callus growth, e.g., 223, 425, 409 and so forth. Subsequently transformants were subcultured one to three times, but usually twice on 189 medium (first passage in the dark and second passage in low light) and once or twice on 101 medium in petri dishes before being transferred to 607 medium in Plant Con® containers. Variations in the regeneration protocol were normal based on the progress of plant regeneration. Hence some of the transformants were first subcultured once on 425 medium, twice on 189 medium, once or twice on 101 medium followed by transfer to 501 medium in Plant Cons® containers. As shoots developed on 101 medium, the light intensity was increased by slowly adjusting the distance of the plates from the light source located overhead. All subculture intervals were for about two weeks at 24° C. Transformants that developed three shoots and two to three roots were transferred to soil. [0136]
  • Plantlets in soil were incubated in an illuminated growth chamber and conditions were slowly adjusted to adapt or condition the plantlets to the drier and more illuminated conditions of the greenhouse. After adaptation/conditioning in the growth chamber, plants were transplanted individually to five gallon pots of soil in the greenhouse. [0137]
  • O. Recovery of Fertile Plants [0138]
  • To recover progeny the regenerated, genetically transformed maize plants (designated R[0139] 0), were backcrossed with pollen collected from nontransformed plants derived from seeds. Alternatively pollen was collected from R0 plants and used to pollinate nontransformed plants. Progeny (designated R1) that contained and expressed bar were recovered from crosses in which the transformant was used as a male or female parent.
  • Pollination of transgenic R[0140] 0 ears with non-transformed B73 pollen resulted in kernel development. In addition, kernels developed from pistillate flowers on male inflorescences that were pollinated with non-transformed B73 pollen. Kernels on transformed R0 plants from SC82 developed normally for approximately 10 to 14 days post-pollination but after this period the kernels ceased development and often collapsed. Most plants exhibited premature senescence at this time. A total of 153 kernels developed sporadically on numerous plants: eight of 37 E2/E5 plants, two of 22 E10 plants, and three of six E11 plants. Viable progeny were recovered by embryo rescue from 11 E2/E5 plants and one E10 plant.
  • Fertile plants from over 250 transgenic lines have produced over 59,000 seed (about 227 R[0141] 1 seed per transgenic line). These plants were derived from 11 different cell lines. In addition, both male and female fertility has been observed in many of these cells lines. Kernels routinely mature on plants for which the transformant is either the male or the female parent. Embryo rescue was only necessary under unusual circumstances.
  • P. Embryo Rescue [0142]
  • In cases where embryo rescue was required, developing embryos were excised from surface disinfected kernels 10 to 20 days post-pollination and cultured on medium containing MS salts, 2% sucrose and 5.5 g/l Seakem agarose. Large embryos (>3 mm) were germinated directly on the medium described above. Smaller embryos were cultured for approximately one week on the above medium containing 10[0143] −5M abscisic acid and transferred to growth regulator-free medium for germination. Embryos that became bacterially contaminated were transferred to medium containing 300 μg/ml cefoxitin. Developing plants were subsequently handled as described for regeneration of Ro plants.
  • Viable progeny, recovered from seven SC82 E2/E5 plants and one SC82 E10 plant, were sustained by embryo rescue. This method consisted of excising embryos from kernels that developed on Ro plants. Embryos ranged in size from about 0.5 to 4 mm in length. Small embryos were cultured on maturation medium containing abscisic acid while larger embryos were cultured directly on germination medium. [0144]
  • Pollen obtained from transformed R[0145] 1 plants has been successfully employed to pollinate B73 ears and a large number of seeds have been recovered. The fertility characteristics of the R1 generation has been confirmed both from a standpoint of the pollen's ability to fertilize non-transformed ears, and the ability of R1 ears to be fertilized by pollen from non-transformed plants.
  • EXAMPLE II Transformation of Immature Embryos by Particle Bombardment
  • Immature embryos of maize (Koziel et al., 1993), barley (Wan & Lemaux, 1994), sorghum (Casas et al., 1993), wheat (Weeks et al., 1993) and rice (Christou et al., 1991) have been demonstrated to be a suitable target for production of transformed plants via microprojectile bombardment. The following example exemplifies the transformation of maize via microprojectile bombardment of immature embryos. Although the process is exemplified with the genotype HiII (Armstrong et al., 1991), the method is not limited to this genotype and has been successfully applied to other genotypes of maize including H99, PA91, A188 x B73 and various crosses of the HiII genotype to elite inbred lines. [0146]
  • A. Bombardment of Immature Embryos [0147]
  • Immature embryos (1.2 to 2.0 mm in length) were excised from surface-sterilized, greenhouse-grown ears of Hi-[0148] II 11 to 12 days post-pollination. The Hi-II genotype was developed from an A188 x B73 cross for high frequency development of Type II callus from immature embryos (Armstrong et al., 1991). Approximately 30 embryos per petri dish were plated axis side down on a modified N6 medium containing 1 mg/l 2,4-D, 100 mg/l casein hydrolysate, 6 mM L-proline, 0.5 g/l 2-(N-morpholino) ethanesulfonic acid (MES), 0.75 g/l MgCl2, and 2% sucrose solidified with 2 g/l Gelgro®, pH 5.8 (#735 medium) Embryos were cultured in the dark for two days at 24° C.
  • Approximately four hours prior to bombardment, embryos were transferred to the above culture medium with the sucrose concentration increased from 3% to 12%. When embryos were transferred to the high osmoticum medium they were arranged in concentric circles on the plate, starting 2 cm from the center of the dish, positioned such that their coleorhizal end was orientated toward the center of the dish. Usually two concentric circles were formed with 25 to 35 embryos per plate. [0149]
  • Preparation of gold particles carrying plasmid DNA was as described herein. Particles were prepared containing 10 μg pDPG215 (luciferase), pDPG415 (Bt), and pDPG417 (bar) or 30 μg pDPG265 containing the maize R and C1B genes for anthocyanin biosynthesis. [0150]
  • The plates containing embryos were placed on the third shelf from the bottom, 5 cm below the stopping screen. The 1100 psi rupture discs were used. Each plate of embryos was bombarded once. A total of 420 embryos were bombarded on 14 plates with the luciferase, bar, and Bt genes. Embryos were allowed to recover overnight on high osmotic strength medium prior to initiation of selection. A set of plates was also bombarded with the C1B vector pDPG265. Red spots representing transient expression of anthocyanin pigments were observed 24 hours after DNA introduction. [0151]
  • B. Transformation of Immature Embryos of the Genotype Hi-II Using Bialaphos as a Selective Agent Following Particle Bombardment [0152]
  • Embryos were allowed to recover following bombardment on high osmoticum medium (735, 12% sucrose) overnight (16-24 hours) and were then transferred to selection medium containing 1 mg/l bialaphos (#739, 735 plus 1 mg/l bialaphos or #750, 735 plus 0.2M mannitol and 1 mg/l bialaphos). Embryos were maintained in the dark at 24° C. After three to four weeks on the initial selection plates about 90% of the embryos had formed Type II callus and were transferred to selective medium containing 3 mg/l bialaphos (#758, medium #735 plus 3 mg/l bialaphos). Responding tissue was subcultured about every two weeks onto fresh selection medium (#758). Nineteen transformants were identified six to eight weeks after bombardment. Plants were regenerated following the procedures outlined herein. Regenerated plants were transferred to the greenhouse, pollinated by inbred plants and seed harvested. [0153]
  • EXAMPLE III Transformation by Electroporation
  • A. Electroporation Study EP413: Stable Transformation of Cells Using pDPG165 and pDPG208 [0154]
  • Transformation of [0155] Zea mays via electroporation and production of fertile transgenic plants have been demonstrated by D'Halluin et al. (1992) and Laursen et al. (1994). D'Halluin et al. (1992) demonstrated production of fertile transformants of Zea mays following electroporation of maize Type I callus or immature embryo whereas Laursen et al. (1994) demonstrated transformation of maize suspension culture cells and recovery of fertile transgenic plants. The following exemplifies electroporation of maize suspension cells, but the method is equally applicable to other maize cell types including Type I callus and immature embryos and other genotypes of maize.
  • Maize suspension culture cells were enzyme treated and electroporated using conditions described in Krzyzek and Laursen (PCT Publication WO 92/12250). AT824 suspension culture cells, three days post subculture, were sieved through 1000 μm stainless steel mesh and washed, 1.5 ml packed cells per 10 ml, in incubation buffer (0.2 M mannitol, 0.1% bovine serum albumin, 80 mM calcium chloride, and 20 mM 2-(N-morpholino)-ethane sulfonic acid, pH 5.6). Cells were then treated for 90 minutes in incubation buffer containing 0.5% pectolyase Y-23 (Seishin Pharmaceutical, Tokyo, Japan) at a density of 1.5 ml packed cells per 5 ml of enzyme solution. During the enzyme treatment, cells were incubated in the dark at approximately 25° C. on a rotary shaker at 60 rpm. Following pectolyase treatment, cells were washed once with 10 ml of incubation buffer followed by three washes with electroporation buffer (10 mM HEPES, 0.4 mM mannitol). Cells were resuspended in electroporation buffer at a density of 1.5 ml packed cells in a total volume of 3 ml. [0156]
  • Linearized plasmid DNA, 100 μg of EcoRI digested pDPG165 and 100 μg of EcoRI digested pDPG208, was added to 1 ml aliquots of electroporation buffer. The DNA/electroporation buffer was incubated at room temperature for approximately 10 minutes. To these aliquots, 1 ml of suspension culture cells/electroporation buffer (containing approximately 0.5 ml packed cells) were added. Cells and DNA in electroporation buffer were incubated at room temperature for approximately 10 minutes. One-half ml aliquots of this mixture were transferred to the electroporation chamber (Puite, 1985) which was placed in a sterile 60×15 mm petri dish. Cells were electroporated with a 70, 100, or 140 volt (V) pulse discharged from a 140 microfarad (μf) capacitor. [0157]
  • Approximately 10 minutes post-electroporation, cells were diluted with 2.5 ml 409 medium containing 0.3 M mannitol. Cells were then separated from most of the liquid medium by drawing the suspension up in a pipet, and expelling the medium with the tip of the pipet placed against the petri dish to retain the cells. The cells, and a small amount of medium (approximately 0.2 ml) were dispensed onto a filter ([0158] Whatman #1, 4.25 cm) overlaying solid 227 medium (Table 1) containing 0.3 M mannitol. After five days, the tissue and the supporting filters were transferred to 227 medium containing 0.2 M mannitol. After seven days, tissue and supporting filters were transferred to 227 medium without mannitol.
  • B. Transformation of AT824 Using Bialaphos Selection Following Electroporation [0159]
  • Cells of AT824 were electroporated and allowed to recover from electroporation as described above. Five days later, tissue growing on filters was removed from the filter and transferred as clumps (approximately 0.5 cm in diameter) to the surface of solid selection medium. The selection medium consisted of 227 medium supplemented with 1 mg/L bialaphos. Three weeks later, slowly growing tissue was transferred, as 0.5 cm clumps, to 227 medium containing 3 mg/L bialaphos. Three to four weeks later, callus sectors that continued to grow were transferred to fresh 227 medium containing 3 mg/L bialaphos. Callus lines that continued to grow after this subculture were considered to be transgenic and perpetuated further, by transfer to fresh selection medium every two weeks. Seven AT824 callus lines were selected in this example. Three AT824 callus lines were recovered from 140 μf, 70 V electroporations and four AT824 callus lines were recovered from electroporation at 140 μf, 140 V. [0160]
  • Two bialaphos resistant callus lines selected in this example were randomly chosen and assayed for phosphinothricin acetyltransferase (PAT) activity. PAT is the bar gene product, and PAT activity is determined by the ability of total protein extracts from potentially transformed cells to acetylate phosphinothricin (PPT), using [0161] 14C-acetyl coenzyme A as the acetyl donor. This transfer is detected, using thin layer chromatography and autoradiography, by a shift in the mobility of 14C labelled compound from that expected for 14C-acetyl coenzyme A to that expected for 14C-N-acetyl PPT. The assay used for detection of PAT activity has been described in detail (Adams et al., published PCT application no. WO91/02071; Spencer et al., 1990). All three callus lines tested contained PAT activity.
  • In this example, suspension culture cells were electroporated with a second plasmid, pDPG208, encoding β-glucuronidase (GUS). Detection of GUS activity can be performed histochemically using 5-bromo-4-chloro-3-indolyl glucuronide (X-gluc) as the substrate for the GUS enzyme, yielding a blue-precipitate inside of cells containing GUS activity. This assay has been described in detail (Jefferson, 1987). One of the seven AT824 callus lines selected in this example, EP413-13, contained cells that turned blue in the histochemical assay. [0162]
  • Southern blot analysis was performed on three bialaphos resistant callus lines to determine the presence and integration of the bar gene in genomic callus DNA. Southern blot analysis was performed as follows. Genomic DNA was isolated using a procedure modified from Shure et al. (1983). Approximately one gram of callus tissue from each line was lypholyzed overnight in 15 ml polypropylene tubes. Freeze-dried tissue was ground to a powder in the tube using a glass rod. Powdered tissue was mixed thoroughly with 3 ml extraction buffer (7.0 M urea, 0.35 M NaCl, 0.05 M Tris-HCl pH 8.0, 0.01 M EDTA, 1% sarcosine). Tissue/buffer homogenate was extracted with 3 ml phenol/chloroform. The aqueous phase was separated by centrifugation, and precipitated twice using {fraction (1/10)} volume of 4.4 M ammonium acetate pH 5.2, and an equal volume of isopropanol. The precipitate was washed with 75% ethanol and resuspended in 100-500 μl TE (0.01 M Tris-HCl, 0.001 M EDTA, pH 8.0). Genomic DNA was digested with a 3-fold excess of restriction enzymes, electrophoresed through 0.8% agarose (FMC), and transferred (Southern, 1975) to Nytran® (Schleicher and Schuell) using lox SCP (20× SCP: 2 M NaCl, 0.6 M disodium phosphate, 0.02 M disodium EDTA). Filters were prehybridized in 6× SCP, 10% dextran sulfate, 2% sarcosine, and 500 μg/ml heparin (Chomet et al., 1987) for approximately 10 minutes. Filters were hybridized overnight at 65° C. in 6× SCP containing 100 μg/ml denatured salmon sperm DNA and [0163] 32P-labelled probe. Probe was generated by random priming (Feinberg & Vogelstein, 1983) Hybridized filters were washed in 2× SCP, 1% SDS at 65° C. for 30 minutes and visualized by autoradiography using Kodak XAR5 film.
  • In this example, genomic DNA isolated from bialaphos resistant callus lines was digested with HindIII and EcoRI, which release a 1.9 kb bar fragment from pDPG165 (FIG. 1A). Genomic DNA was probed with [0164] 32P labelled 0.6 kb SmaI bar fragment from pDPG165. (FIG. 1A). All three EP413 callus lines analyzed contained DNA that hybridized to the bar probe. Copy number in the transformed callus ranged from one to two copies (EP413-3) to greater than 20 copies of bar (EP413-1). Furthermore, the restriction digest used, yielded bar-hybridizing fragments in callus DNA samples that were larger than the bar fragment released from pDPG165 in the same restriction digest. This result is indicative of stable integration of introduced DNA into the maize genome.
  • Thirty-nine plants were regenerated from seven of the eight bialaphos resistant callus lines selected in this example. Plants were regenerated from six AT824 callus lines. For plant regeneration, callus growing on 227 medium containing 3 mg/L bialaphos, was transferred to 189 medium (Table 1). Somatic embryos matured on 189 medium after one, two, or three two-week subculture periods in the dark at 25° C. As somatic embryos developed on 189 medium, clumps of tissue containing these embryos were transferred to growth regulator free 101 medium (Table 1) and placed in the light (25-250 μM[0165] −2s−1). Plantlets developed on this medium after one, two, or three subculture periods. Plantlets were subsequently transferred to 501 medium (Table 1) in Plant ConR containers for rooting and further growth. Regenerates (Ro plants) were subsequently transferred to a soilless mix in 0.5 liter pots and acclimated to ambient humidity in a growth chamber (200-450 μE M−2s−1; 14 h photoperiod). The soilless mix has been described in detail (Adams et al., published PCT application no. WO91/02071). Plants were then transferred to a soilless mix in 16 liter pots and grown to maturity in a greenhouse.
  • Plants regenerated from five different EP413 callus lines were assayed for PAT activity as described for callus earlier in this example. All five plants contained PAT activity. Three plants regenerated from the single EP413 callus line that exhibited GUS activity (EP413-13) were analyzed for GUS activity. All three EP413-13 R[0166] 0 plants were positive for GUS activity. Files of blue cells were observed in leaf tissue of EP413-13 plants upon incubation with X-Gluc.
  • EP413 R[0167] 0 plants were also analyzed for the presence and integration of bar by Southern blot. DNA was isolated from leaf tissue as described for callus except that fresh, rather than lypholyzed tissue was used. Prior to the addition of extraction buffer, fresh leaf tissue was frozen in liquid nitrogen and ground to a fine powder in a 15 ml polypropylene tube using liquid nitrogen and a glass rod. DNA was isolated from four EP413 Ro plants, each representing a different callus line. DNA was analyzed, digested with HindIII and BglII, or undigested, for hybridization to bar. Ro DNA was probed with 32P labelled 0.6 kb SmaI bar fragment from pDPG165 (FIG. 1A). HindIII/BglII digestion of pDPG165 releases a fragment containing 35S-bar of approximately 1.3 kb (FIG. 1A). Genomic DNA from all four plants contained at least one copy of the 1.3 kb HindIII/BglII 35S-bar fragment. In addition, undigested genomic DNA from all four plants exhibited hybridization to bar only in high molecular weight DNA (>20 kb), indicating integration of pDPG16S into maize chromosomal DNA.
  • Progeny were recovered from outcrosses made between electroporation-derived, transgenic R[0168] 0 plants and non-transformed inbred plants. Four EP413-3 R0 plants were the first of the plants to reach maturity and flower. One of the plants was outcrossed as the male to a CD inbred plant. This cross resulted in 22 kernels. Sixteen of these kernels were planted in soilless mix and all germinated. Approximately two weeks post-germination, the progeny (R1) plants were analyzed for PAT-activity. Three of 16 plants contained PAT activity.
  • Four transgenic EP413-3 R[0169] 0 plants were also outcrossed as the female, using pollen collected from nontransformed inbred plants. Kernels developed on ears of all four EP413-3 R0 plants. Thirty-seven kernels were recovered from an ear on an EP413-3 R0 plant treated with pollen collected from a seed-derived, non-transformed FBLL inbred plant. Sixteen of these kernels were planted in soil and 12 germinated. Eight of these plants were analyzed for PAT activity; three of eight were positive for PAT activity.
  • These eight plants were also analyzed by Southern blot hybridization for the presence of bar. Genomic DNA isolated from these eight EP413-3 R[0170] 1 plants was digested with restriction enzymes HindIII and BglII, which release a 1.3 kb fragment containing bar from pDPG165. In addition to DNA from the eight EP413-3 R1 plants, DNA isolated from EP413-3 callus and DNA from the EP413-3 R0 plant yielding these eight R1 plants was included in the analysis. Genomic DNA was probed with 32P labelled 0.6 kb SmaI bar fragment from pDPG165. Hybridization to bar was detected in the DNA isolated from callus, R0 and the three R1 plants that contained PAT activity. Each of the bar-positive plants contained the expected 1.3 kb HindIII/BglII fragment from pDPG165 as well as an additional, larger bar-hybridizing fragment of approximately 2.0 kb. This result, as well as the PAT activity found to be present in EP413-3 R1 plants, conclusively demonstrates the sexual transmission to progeny of a functional gene introduced into maize cells by electroporation.
  • EXAMPLE IV Analysis of Integration of Exogenous DNA in Transformants and Progeny Plants
  • Transformed plants derived from particle bombardment of cultured cells or immature embryos or derived from electroporation are analyzed in a similar manner. Although analysis of plants derived from particle bombardment of cultured cells are disclosed herein, similar analysis could be undertaken on any transformed plant. [0171]
  • A. General Methods for Assays [0172]
  • A method to detect the presence of phosphinothricin acetyl transferase (PAT) activity is to use an in vitro enzyme reaction followed by thin layer chromatography. [0173]
  • Various protein extracts prepared from homogenates of potentially transformed cells, and from control cells that have neither been transformed nor exposed to bialaphos selection, were assayed by incubation with PPT and [0174] 14C-Acetyl Coenzyme A followed by thin layer chromatography. Twenty-five μg of protein extract were loaded per lane. The source in lanes E1 to E11 were SC82 transformants; B13 was a BMS (Black Mexican Sweet corn nonembryogenic) bar transformant. EO was a nonselected, nontransformed control.
  • All lanes except the nontransformed control exhibit PAT activity by the formation of a compound with the appropriate mobility expected for [0175] 14C-N-Acetyl PPT. Variation in activity levels among the transformants was approximately 10-fold, as demonstrated by the relative intensity of the bands. The results of this assay provide confirmation of the expression of the bar gene which codes for PAT. For analysis of PAT activity in plant tissue, 100-200 mg of leaf tissue was extracted in sintered glass homogenizers and assayed as described previously.
  • DNA analysis was performed as follows. Genomic DNA was isolated using a procedure modified from Shure et al. (1983). Approximately 1 gm callus tissue was ground to a fine powder in liquid N2 using a mortar and pestle. Powdered tissue was mixed thoroughly with 4 ml extraction buffer (7.0 M urea, 0.35 M NaCl, 0.05 M Tris-HCl pH 8.0, 0.01 M EDTA, 1k sarcosine). Tissue/buffer homogenate was extracted with 4 ml phenol/chloroform. The aqueous phase was separated by centrifugation, passed through Miracloth®, and precipitated twice using {fraction (1/10)} volume of 4.4 M ammonium acetate, pH 5.2 and an equal volume of isopropanol. The precipitate was washed with 70% ethanol and resuspended in 200-500 μl TE (0.01 M Tris-HCl, 0.001 M EDTA, pH 8.0). Plant tissue may also be employed for the isolation of DNA using the foregoing procedure. [0176]
  • The presence of a gene in a transformed cell may be detected through the use of polymerase chain reaction (PCR). Using this technique, specific fragments of DNA can be amplified and detected following agarose gel electrophoresis. For example the bar gene may be detected using PCR. Two hundred to 1000 ng genomic DNA is added to a reaction mix containing 10 mM Tris-HCl pH 8.3, 1.5 mM MgCl[0177] 2, 50 mM KCl, 0.1 mg/ml gelatin, 200 AM each dATP, dCTP, dGTP, dTTP, 0.5 μM each forward and reverse DNA primers, 20% glycerol, and 2.5 units Taq DNA polymerase. The forward primer is CATCGAGACAAGCACGGTCAACTTC (position 114 to position 147 of SEQ ID NO:3). The reverse primer is AAGTCCCTGGAGGCACAGGGCTTCAAGA (position 364 to position 391 of SEQ ID NO:3). PCR amplification of bar using these primers requires the presence of glycerol, but this component is not needed for most other applications. The reaction is run in a thermal cycling machine as follows: three minutes at 94° C., 39 repeats of the cycle one minute at 94° C., one minute at 50° C., 30 seconds at 72° C., followed by five minutes at 72° C. Twenty μl of each reaction mix is run on a 3.5% NuSieve gel in TBE buffer (90 mM Tris-borate, 2 mM EDTA) at 50V for two to four hours. Using these primers a 279 base pair fragment of the bar gene is amplified.
  • For Southern blot analysis genomic DNA was digested with a 3-fold excess of restriction enzymes, electrophoresed through 0.8% agarose (FMC), and transferred (Southern, 1975) to Nytran® (Schleicher and Schuell) using 10× SCP (20× SCP: 2 M NaCl, 0.6 M disodium phosphate, 0.02 M disodium EDTA). Filters were prehybridized at 65° C. in 6× SCP, 10% dextran sulfate, 2% sarcosine, and 500 μg/ml heparin (Chomet et al., 1987) for 15 minutes. Filters were hybridized overnight at 65° C. in 6× SCP containing 100 μg/ml denatured salmon sperm DNA and [0178] 32P-labeled probe. The 0.6 kb SmaI fragment from pDPG165 and the 1.8 kb BamHI/EcoRI fragment from pCEV5 were used in random priming reactions (Feinberg & Vogelstein, 1983) to generate labeled probes for detecting sequences encoding PAT or GUS, respectively. Filters were washed in 2× SCP, 1% SDS at 65° C. for 30 minutes and visualized by autoradiography using Kodak XAR5 film. Prior to rehybridization with a second probe, the filters were boiled for 10 min. in distilled H2O to remove the first probe and then prehybridized as described above.
  • B. Assays for Integration of Exogenous DNA and Expression of DNA in R[0179] 0 R1 Plants
  • Studies were undertaken to determine the expression of the transformed gene(s) in transgenic R[0180] 0 and R1 plants. Functional activity of PAT was assessed by localized application of a commercial herbicide formulation containing PPT to leaves of SC82 R0 and R1 plants. No necrosis was observed on leaves of Ro plants containing either high levels (E2/E5), or low levels (E3/E4) of PAT. Herbicide was also applied to leaves of E2/E5 progeny segregating for bar.
  • Twenty-one R[0181] 0 plants, representing each of the four regenerable transformed SC82 callus lines, were also analyzed for expression of the bar gene product, PAT, by thin-layer chromatographic techniques. Protein extracts from the leaves of the plants were tested.
  • All 21 plants tested contained PAT activity. Furthermore, activity levels were comparable to levels in the callus lines from which the plants were regenerated. The nontransformed plant showed no PAT activity (no band is in the expected position for acetylated PPT in the autoradiograph from the PAT chromatogram). A band appears in the BMS lane that is not in lanes containing protein extracts from the plant leaves. This extra band was believed to be an artifact. [0182]
  • As another method of confirming that genes had been delivered to cells and integrated, genomic (chromosomal) DNA was isolated from a nontransformed plant, the four regenerable callus lines and from two Ro plants derived from each callus line. The transformed callus and all plants regenerated from transformed callus contained sequences that hybridized to the bar probe, indicating the presence of DNA sequences that were complementary to bar. Furthermore, in all instances, hybridization patterns observed in plant DNA were identical in pattern and intensity to the hybridization profiles of the corresponding callus DNA. [0183]
  • DNA from E3/E4/E6 callus and the desired Ro plants contained approximately 20 intact copies of the 1.9 kb bar expression unit ([0184] Cauliflower Mosaic Virus 35S promoter-bar-Agrobacterium transcript 7 3′-end) as well as numerous other bar-hybridizing fragments. Ell callus and plant DNA contained one to two copies of the intact expression unit and five to six additional non-intact hybridizing fragments. E10 callus and plants contained one to two copies of the intact bar expression unit. E2/E5 DNA contained a single fragment of approximately 3 kb that hybridized to the probe. To confirm that the hybridizing sequence observed in all plants was integrated into the chromosomal DNA, undigested genomic DNA from one plant derived from each independent transformant was analyzed by DNA gel blot hybridization. Hybridization to bar was observed only in high molecular weight DNA providing evidence for the integration of bar into the maize genome.
  • EXAMPLE V Analysis of Transformant B16
  • A detailed analysis of SC82 transformant B16 was undertaken. The B16 integration event was mapped to the long arm of [0185] chromosome 3 by use of waxy translocation lines of maize provided by the Maize Genetics Cooperation, Sarah Hake, and Paul Chomet. The integration event was specifically mapped using waxy translocations wx09A and wx08A. The examples that follow provide further characterization of the B16 transformant.
  • A. DNA Analysis of the Transformant B16 [0186]
  • DNA analysis of the Ignite-resistant line, B16, involved restriction digest mapping and Southern blot hybridization analysis to determine the number of plasmid DNA insertions into genomic DNA and to define the organization and identity of the integrated plasmid DNA. This analysis was also used to determine the location of plasmid pDPG165 insert/maize genomic DNA junctions. DNA isolation, restriction digests, and Southern blot hybridization were performed as described in Gordon-Kamm et al. (1990). A restriction map of pDPG165, the plasmid used for transformation of B16, is shown in FIG. 1A. It was shown in Gordon-Kamm et al. (1990) that a HindIII/EcoRI digest of B16 callus or R[0187] 0 DNA, probed with bar, yielded a fragment of approximately 3 kb (B16 was referred to as “E2/E5” in Gordon-Kamm et al., 1990) Unique HindIII and EcoRI sites flank the bar expression cassette in pDPG165 (FIG. 1A), and digestion of pDPG165 with EcoRI/HindIII released a fragment of 1.9 kb containing bar. This indicated that either the HindIII site or the EcoRI site, or both, were missing or rearranged in the plasmid DNA that integrated in B16. This analysis, as well as the intensity of bar hybridization observed, indicated that B16 contained a single copy of the bar gene. It was also demonstrated in Gordon-Kamm et al. that a SmaI digest of B16 R0 and R1 DNA yielded a single, approximately 0.6 kb fragment that hybridized to bar, demonstrating an intact copy of bar.
  • Subsequent analyses were performed using DNA isolated from plants of a hybrid line, DK591GR, into which the B16 integration event was introgressed according to Example VI. To confirm that B16 contained a single pDPG165 insertion site, B16 DNA was digested with restriction enzymes that do not cut within pDPG165, and was probed with the entire pDPG165 plasmid. Digestion of B16 DNA with two of these enzymes, XhoI and Stul, yielded pDPG165 hybridization to unresolved, high molecular weight genomic DNA. Digestion of B16 DNA with NsiI yielded a single fragment of approximately 8 kb that hybridized to pDPG165, indicative of a single insertion site (FIG. 2). A restriction map of the pDPG165 derived DNA insertion and flanking maize genomic DNA is shown in FIG. 3; this restriction map was derived from analyses described below. [0188]
  • Plasmid pDPG165 contains unique BamHI and BgIII sites that flank the bar gene. Digestion of B16 DNA with BamHI/BglII yielded, as expected, an approximately 0.6 kb fragment that hybridized to bar. B16 and pDPG165 DNA were digested with BamHI/EcoRI or BglII/HindIII and probed with bar. Comparing the size of bar-hybridizing restriction fragments generated from B16 genomic DNA with those derived from pDPG165 demonstrated that the genomic fragments were significantly larger than the plasmid fragments. This analysis indicated that both the HindIII and EcoRI sites that flank the bar expression cassette in pDPG165 were not cutting in B16, or were missing, or were rearranged as to their original orientation to bar in pDPG165. [0189]
  • A series of restriction digests of B16 DNA were probed various parts of pDPG165 to map the EcoRI and HindIII sites internal to and/or flanking the pDPG165 insertion, as well as to determine specifically what parts of pDPG165 were integrated in B16. Two identical Southern blots were produced; each blot was probed with three different probes. Six pDPG165 fragments were isolated for use as probes, representing nonoverlapping pieces of the entire vector: a HindIII/BamHI fragment containing 35S, a SmaI fragment containing bar, a BglII/EcoRI fragment containing Tr7, an EcoRI/SspI fragment containing lacZ, a SspI/AlwNI fragment containing the β-lactamase gene (amp), and an AlwNI/HindIII fragment containing the ColE1 origin of replication (FIG. 1A). [0190]
  • Five of the six probes hybridized to B16 DNA; the probe containing the ColE1 origin of replication did not hybridize to B16 DNA, indicating that the B16 insertion lacked the AlwNI/HindIII fragment containing the ColE1 origin. Digestion of B16 DNA with NsiI/BamHI yielded two fragments that hybridized to the pDPG165 probes, one approximately 3 kb and one approximately 5 kb. The bar and 35S probes hybridized to different NsiI/BamHI fragments as expected, given that a unique BamHI site exists between bar and 35S in pDPG165. (FIG. 1A). The bar probe hybridized to the 5 kb B16 NsiI/BamHI fragment, indicating that there is a [0191] genomic NsiI site 3′ to bar, approximately 5 kb from the BamHI site between 35S and bar (FIG. 3). The 35S probe hybridized to the 3 kb NsiI/BamHI fragment, indicating the presence of a genomic NsiI site about 3 kb 5′ to bar (FIG. 3). The lacZ and amp probes both hybridized to the 3 kb NsiI/BamHI fragment, indicating possible fragmentation and recombination of parts of pDPG165 prior to, or during integration into B16. The Tr7 probe hybridized to both NsiI/BamHI fragments, providing further evidence for pDPG165 recombination prior to or during the B16 integration event.
  • Probing EcoRI-digested B16 DNA with the pDPG165 probes described above indicated that there is an EcoRI site internal to the B16 insertion, its orientation to bar being different than in pDPG165, probably due to recombination (FIG. 3). The 35S, bar, and TR7 probes hybridized to an unresolved EcoRI fragment >20 kb while the lacZ and amp probes hybridized to an EcoRI fragment of about 5 kb. This result indicated again that recombination of at least two fragments of pDPG165 had occurred, with a fragment containing at least partial copies of lacZ, amp, and Tr7 lying upstream relative to bar. The fragment containing lacZ, amp, and Tr7 appears to be in the opposite orientation to bar, as compared to the orientation in pDPG165, due to the fact that Tr7 hybridization was observed to only the B16 EcoRI fragment that hybridized to 35S and bar (FIG. 3). The data also indicates that there is a genomic EcoRI site about 5 kb upstream (relative to bar) from the internal EcoRI site. [0192]
  • The orientation of the recombined pDPG165 fragments in B16 was further demonstrated by the hybridization of the pDPG165 probes to an EcoRI/BamHI digest of B16 DNA. Hybridization of the probe was observed to a single EcoRI/BamHI fragment of approximately 1 kb, corresponding to the small EcoRI/BamHI fragment internal to the B16 insert as the result of pDPG165 recombination (FIG. 3). The lacZ and amp probes hybridized to a 5 kb fragment in the EcoRI/BamHI digest, perhaps corresponding to the 5 kb EcoRI fragment containing the upstream plasmid-genomic DNA junction that was positive for lacZ and amp hybridization above. The bar probe hybridized to a large, unresolved (>20 kb) fragment in the B16 EcoRI/BamHI digest. This fragment contains the downstream (relative to bar) plasmid-genomic DNA junction. As would be expected, based on the restriction map in FIG. 3, the Tr7 probe hybridized to two fragments in the B16 EcoRI/BamHI digest. Tr7 hybridization was observed to the internal 1 kb EcoRI/BamHI fragment and the >20 kb downstream EcoRI/BamHI (or only BamHI) junction fragment described above (FIG. 3). [0193]
  • Probing a HindIII B16 digest with the pDPG165 probes revealed the same pattern of hybridization for all five probes. 35 Two bands were observed, one approximately 4.5 kb and one approximately 6.5 kb. The single HindIII site present in pDPG165 (FIG. 1A) appears to be missing in the B16 insertion, based on the fact that probing a BglII/HindIII digest of B16 DNA with bar yielded a larger bar-hybridizing fragment than the same digest of pDPG165 (see above). This observation, along with the fact that the same HindIII restriction pattern was observed for B16 DNA, regardless of the probe, indicates that one genomic HindIII site flanking the insert may be partially digesting, perhaps the result of partial methylation, resulting in two HindIII fragments that hybridize to all five probes. This was further demonstrated by probing an EcoRI/HindIII digest of B16 DNA with the six pDPG165 probes. One fragment, approximately 1.3 kb, hybridized to the lacZ and amp probes, indicating the presence of a genomic HindIII site, 1.3 kb upstream from the internal EcoRI site (FIG. 3). Probing the EcoRI/HindIII digest with 35S, bar, and Tr7 resulted in two fragments that hybridized to all three probes, one approximately 3.2 kb and one approximately 5.2 kb. This result indicated that there is one genomic HindIII site about 3.2 kb downstream from the internal EcoRI site and this HindIII site is only partially digested. There is second genomic HindIII site 5.2 kb downstream from the internal EcoRI site (FIG. 3). In the B16 analysis described in Gordon-Kamm et al. (1990) it appears that the downstream HindIII site proximal to bar cut to completion yielding only one EcoRI/HindIII fragment of about 3.2 kb that hybridized to bar. [0194]
  • Several additional restriction sites; present in pDPG165, have been confirmed to be present in the B16 insert (FIG. 3). The ends of the B16 insert were more clearly defined by comparing fragment sizes in digests of pDPG165 and B16 DNA. The upstream end was more clearly defined by digesting pDPG165 and B16 DNA with EcoRI in combination with SspI, Asp700, ScaI, BsaI, or AlwNI. These digests were probed with the EcoRI/SspI lacZ fragment. The size of the hybridizing fragments from B16 digests matched those from the corresponding pDPG165 digests up to and including the BsaI site. Therefore, the upper end of the insert occurs in the approximately 700 base pair region between the BsaI and AlwNI sites of pDPG165. The downstream end of the B16 insert was mapped in a similar manner. B16 and pDPG165 DNA were digested with BamHI in combination with Asp700, EcoRV, SacI, or EcoRI. The size of the hybridizing fragments from B16 digests matched those from the corresponding pDPG165 digests down to and including SacI. The downstream end of the insert occurs in the approximately 200 base pair region between the SacI and EcoRI sites in Tr7. [0195]
  • B. Expression Analysis of the Transformant B16 [0196]
  • 1. Production of Purified PAT Protein [0197]
  • To produce and purify PAT protein, a PAT fusion protein was expressed in E. coli. The bar gene was isolated as an EcoRI/PstI fragment from pIJ4104 (White et al., 1990) and ligated into EcoRI/PstI digested pMAL-p1 (New England Biolabs, Beverly, Mass.). The pMAL-p1 vector contains the [0198] E. coli malE gene located upstream of the polylinker region into which the bar gene was cloned. Expression of the malE-bar fusion resulted in production of a maltose binding protein (MBP)::PAT fusion protein. The MBP::PAT fusion protein was expressed in E. coli, purified, and cleaved according to the manufacturer's recommendations. Cleavage was accomplished using the specific protease factor Xa; the pMAL-p2 vector encodes a factor Xa cleavage site just upstream of the polylinker into which bar was inserted. SDS-PAGE analysis (Laemelli, 1970) of the cleavage reaction resulted in two major protein bands as detected by Comassie staining. -One band was approximately 43 kD, corresponding to the molecular weight of the maltose binding protein. The other band was approximately 22 kD, corresponding to the molecular weight of PAT (Thompson et al., 1987). The cleavage reaction was concentrated and desalted in a Microcon-10 protein concentrator (Amicon, Beverly, Mass.) and resuspended in 30 mM MOPS (3-[N-Morholino]propane-sulfonic acid) pH 8.0. The concentrated cleavage reaction was applied to a MonoQ column (Pharmacia, Piscataway, N.J.) using an FPLC system (Pharmacia). The column was washed with 30 mM MOPS pH 8.0 and eluted with a linear gradient of NaCl from 0 to 350 mM. Fractions were assayed for PAT by dot blot using a polyclonal anti-PAT antibody (see below). Dot blots were performed as described (Harlow & Lane, 1988) using a 1:200 dilution of anti-PAT followed by a 1:2000 dilution of anti-rabbit IgG-peroxidase (Boehringer Mannheim, Indianapolis, Ind.) and visualized colorimetrically using chloronapthol (Harlow & Lane, 1988). Fractions exhibiting antigenicity eluted between 100-200 mM NaCl. These fractions were tested for purity by Western blot and pooled.
  • 2. Production of Anti-PAT Antibody [0199]
  • Approximately 1500 μg of PAT protein was gel-purified (SDS-PAGE) following proteolytic cleavage of the MBP::PAT fusion protein. Gel slices containing PAT were sent to East Acres Biologicals (Southbridge, Mass.) for preparation of rabbit anti-PAT antibody. Using Western blots (see below), purified IgG fractions were tested and found to have immunoaffinity for cleaved PAT fusion protein and PAT produced in plant tissues expressing the bar gene. [0200]
  • 3. Quantification of PAT in B16 Plants [0201]
  • Tissue samples from various plant tissues were weighed and ground fresh in sintered glass homogenizers with 100-500 μl of extraction buffer. (150 mM NaCl, 1% NP-40 (octylphenoxypolyetoxyethanol), 0.1% SDS, 50 mM Tris HCl pH 8.0). Extracts were clarified by microcentrifugation for five minutes. Total soluble protein in the extracts was quantified according to Bradford (1976). Fifteen to 250 μg of protein from B16 plant extracts were electrophoresed (SDS PAGE) with purified PAT standards for quantification. Five to seven PAT standards, representing a range of ten to 200 μg, were loaded per gel to generate a standard curve. For Western blotting, proteins were electrophoretically transferred to nitrocellulose using a semi-dry electroblotter (Integrated Separation Systems, Enprotech, Inc., Hyde Park, Mass.). Nitrocellulose protein blots were washed for ten minutes in 50 ml of 1× TBS/0.3% Tween-20 (TBS/T). Blots were then incubated in 50 ml of 5% non-fat dry milk/TBS/T containing a 1:500 dilution of anti-PAT antibody for one hour, followed by 4×50 ml washes in milk/TBS/T for ten minutes each. Blots were incubated in 50 ml of milk/TBS/T and a 1:2000 dilution of anti-rabbit IgG-peroxidase (Boehringer Mannheim) for one hour and washed three times for ten minutes each in milk/TBS/T and one final wash in TBS/T. PAT protein on Western blots was visualized using the Enhanced Chemiluminescent System (ECL) from Amersham (Arlington Heights, Ill.). Autoradiograms produced using the ECL system were scanned and quantitation was accomplished using Whole Band Analysis on Bio Image software on a Sun SPARCstation IPC computer (hardware and software package supplied by Millipore Corporation, Bio Image Products, Ann Arbor, Mich.). Standards were plotted using Sigma Plot (Jandel Scientific, San Rafael, Calif.) and linear regression analysis and interpolation of experimental values was accomplished using Lotus 123 software (Lotus Development Corporation, Cambridge, Mass.). [0202]
  • PAT levels were initially determined in leaf tissue of several different hybrids that were converted with the B16 transformation event. PAT levels were fairly consistent from hybrid to hybrid, ranging from 0.5-1 ng of PAT per μg of total soluble protein in the five hybrids tested. One hybrid line converted with the B16 transformation event, DK591, was chosen for further analysis. A summary of PAT levels observed in various B16/DK591 tissues is shown in Table 1. PAT levels were highest in vegetative tissues, based on ng/μg total soluble protein. PAT levels detected in coleoptile, leaf, root, prop root, stalk, cob, and husk were in the range of 1-4.6 ng PAT per μg of total soluble protein. This range corresponds to 0.1-0.46% of total soluble protein. PAT levels determined in a developmental analysis of F[0203] 2 seed ranged from 0.8 ng/μg total soluble protein in unfertilized ovules to less than 0.1 ng/μg of total soluble protein in mature seed (a band was apparent but below the lowest standard). No PAT protein was detected in B16/DK591 pollen or hybrid seed.
    TABLE 3
    PAT Levels in Various B16/DK591 Tissues Determined by
    Western Blotting.
    PAT concentration PAT concentration
    (ng/μg total protein) (ng/mg fresh
    Tissue (age) proteprotein) in ( weight)
    Coleoptile (6 days) 1.8 ng/82 g 13.8 ng/mg
    Leaf (24 days) 1.0 ng/82 g 55.6 ng/mg
    Leaf (44 days) 2.8 ± 0.1 ng/82 g 166.0 ± 24.2
    Leaf (93 days) 2.1 ng/82 g 106.1 ng/mg
    F2 ovule (0 days pp) 0.8 ng/82 g 5.5 ng/mg
    Immature F2 seed (16 0.3 ng/82 g 3.4 ng/mg
    Immature F2 seed (27 0.3 ng/82 g 5.7 ng/mg
    Mature dry F2 seed (45 <0.1 ng/82 g
    zHybrid seed (F1) not detecteda
    Root (24 days) 1.3 ng/82 g 8.1 ng/mg
    Root (44 days) 1.9 ± 0.3 ng/82 g 19.8 ± 2.4 ng/mg
    Prop root (49 days) 2.4 ng/82 g 67.2 ng/mg
    Cob (56 days) 2.2 ng/82 g 2.5 ng/mg
    Husk (56 days) 1.1 ng/82 g 4.2 ng/mg
    Silk not detecteda
    Stalk (24 days) 2.0 ng/82 g 15.7 ng/mg
    Stalk (77 days) 4.6 ± 0.4 ng/82 g 11.2 ± 2.7 ng/mg
    Immature tassel (49 2.0 30.8 ng/mg
    Pollen not detectedb
  • C. Isolation of Maize Genomic DNA Sequences Situated Adjacent to pDPG165 DNA Sequences in the B16 Integration Event [0204]
  • The maize genomic DNA sequences that are situated adjacent to pDPG165 DNA sequences in the B16 integration event are isolated using various techniques that are familiar to a practitioner of skill in the art. [0205]
  • 1. Polymerase Chain Reaction (PCR) Techniques [0206]
  • DNA sequences flanking pDPG165 plasmid sequences in transformant B16 are cloned using polymerase chain reaction (PCR) techniques, including RAGE (rapid amplification of genomic ends) and IPCR (Inverse PCR). It is anticipated that other PCR methods may be useful for cloning of genomic DNA sequence adjacent to a plasmid integration site and are familiar to a practitioner of skill in the art. [0207]
  • Maize genomic DNA sequences adjacent to the B16 integration event described herein are cloned using rapid amplification of genomic DNA ends (RAGE) (Mizobuchi & Frohman, 1993). The restriction map of the B16 integration event (FIG. 3) provides information as to DNA sequences that are present in the pDPG165 derived portion of the B16 integration event and that are situated immediately adjacent to maize genomic DNA sequences. It is possible using the software oligo™, and inputting DNA sequences derived from pDPG165 that are adjacent to maize genomic DNA sequences in the B16 integration event and DNA sequences from the plasmid vector that is used in the RAGE technique, to design a pair of matched oligonucleotide primers that following PCR using the RAGE technique will generate a DNA fragment that will begin in pDPG165 derived sequences, span adjacent maize genomic DNA sequences, and end in DNA sequences derived from the plasmid vector that was used in the RAGE technique. Using this technique it is necessary to design oligonucleotide primers for RAGE that will begin in each of the two ends of the integrated pDPG165 derived DNA, span maize genomic DNA on either end of the integrated plasmid DNA sequences and terminate in RAGE plasmid DNA. As a result of using the RAGE technique, two PCR DNA products are produced, and each PCR product contains maize genomic DNA sequences that are located adjacent to pDPG165 sequences in the B16 integration event. A practitioner of skill in the art optimizes the PCR amplification protocol so as to maximize the yield of desirable DNA product and minimize the production of non-specific DNA products. Sambrook et al. (1989) provide instruction for optimization of PCR amplification of DNA. [0208]
  • Alternatively, maize genomic DNA sequences adjacent to the B-16 integration event described herein are cloned using Inverse PCR (IPCR) (Ochman et al., 1990). The restriction map of the B16 integration event (FIG. 3) provides information as to DNA sequences that are present in the pDPG165 derived portion of the B16 integration event and that are situated immediately adjacent to maize genomic DNA sequences. It is possible using the software Oligo™, and inputting DNA sequences derived from pDPG165 that are adjacent to maize genomic DNA sequences in the B16 integration event, to design a pair of matched oligonucleotide primers that following PCR using the IPCR technique with generate a DNA fragment that will begin in pDPG165 derived sequences, span ligated adjacent maize genomic DNA sequences, and end in pDPG165 derived sequences. Using this technique it is necessary to design oligonucleotide primers for IPCR that will begin in each of the two ends of the integrated pDPG165 derived DNA sequences and result in amplification of genomic DNA on either end of the insertion that is ligated together using the IPCR technique. As a result of using the IPCR technique, a single PCR DNA product is produced, and the PCR product contains maize genomic DNA sequences that are located adjacent to pDPG165 sequences in the B16 integration event. A practitioner of skill in the art optimizes the PCR amplification protocol so as to maximize the yield of desirable DNA product and minimize the production of non-specific DNA products. Sambrook et al. (1989) provide instruction for optimization of PCR amplification of DNA. [0209]
  • 2. Plasmid Based Cloning [0210]
  • The restriction enzyme digestion map of the B16 integration event (FIG. 3) provides sufficient information for a practitioner of skill in the art to clone flanking maize DNA sequences in the B16 integration event from a plasmid library. The maize genomic DNA sequences flanking each side of the pDPG165 derived sequences in the B16 integration event are cloned separately, because it is difficult to clone large DNA fragments in plasmid vectors. For example, approximately five kilobase pair EcoRI DNA fragments produced following restriction enzyme digestion of maize genomic DNA containing the B16 integration event are enriched using gel electrophoresis and said EcoRI DNA fragments are cloned in a plasmid vector. The plasmid library produced is screened by hybridization to the amp or lacZ gene. A clone is identified that contains the amp and lacZ genes derived from pDPG165 and approximately 3.5 kilobases of maize genomic DNA which flanks said pDPG165 DNA in the B16 integration event. Similarly, flanking maize DNA from the opposite end of the B16 integration event is cloned from gel electrophoresis enriched approximately 5 kilobase pair NsiI-BamHI DNAs fragments derived from restriction enzyme digested B16 genomic cloned in a plasmid vector. A clone is identified by screening said NsiI-BamHI plasmid library with the bar gene which contains the bar gene and approximately 4 kilobases of flanking maize genomic DNA. [0211]
  • DNA fragments generated from other restriction enzyme digestions are also cloned in plasmid libraries. The fragments cloned are those DNA elements which based on the restriction enzyme digestion map of the B16 insertion event will produce a cloned DNA fragment that contains DNA derived from pDPG165 and flanking maize genomic DNA. Sambrook et al. (1989, incorporated herein by reference) provide detailed instructions for production of plasmid libraries and identification of DNA sequences from said libraries. [0212]
  • 3. λ Phage Cloning [0213]
  • The methods described above for cloning of flanking maize DNA fragments using a plasmid library are followed except a X phage library prepared from B16 genomic DNA is used. Because a recombinant λ phage contains a larger DNA insert than is possible in a phage, the B16 insertion event is also cloned as a single DNA fragment containing pDPG165 derived DNA sequences and maize DNA flanking both sides of the pDPG165 insert. A method of cloning a DNA of unknown sequence which is located adjacent to a second DNA element of known sequence are disclosed in U.S. Pat. No. 4,732,856 (incorporated herein by reference). Sambrook et al. (1989, incorporated herein by reference) provide detailed instructions for production of λ phage libraries and identification of DNA sequences from said libraries. [0214]
  • 4. Isolation of Intact Maize DNA Sequence into which pDPG165 DNA Sequences Were Integrated [0215]
  • A λ phage library is prepared from maize genomic DNA that does not contain the B16 integration event. Said λ library is screened using genomic DNA that flanks the B16 integration event which was isolated using RAGE or plasmid or λ phage libraries as described herein. A λ clone is identified which contains the intact maize genomic DNA sequence into which pDPG165 was integrated in the B16 transformation event. Sambrook et al. (1989, incorporated herein by reference) provide detailed instructions for production of λ phage libraries and identification of DNA sequences from said libraries. [0216]
  • EXAMPLE VI Introgression of a Gene Encoding Phosphinothricin Acetyltransferase into Elite Inbreds of Maize.
  • Backcrossing can be used to improve an inbred plant. Backcrossing transfers a specific desirable trait from one inbred source to an inbred that lacks that trait. This can be accomplished, for example, by first crossing a superior inbred (A) (recurrent parent) to a donor inbred (non-recurrent parent), which carries the appropriate gene(s) for the trait in question. The progeny of this cross are then mated back to the superior recurrent parent (A) followed by selecting in the resultant progeny for the desired trait to be transferred from the non-recurrent parent. After five or more backcross generations with selection for the desired trait, the progeny are heterozygous for loci controlling the characteristic being transferred, but are like the superior parent for most or almost all other genes. The last backcross generation would be selfed to give pure breeding progeny for the gene(s) being transferred. [0217]
  • Therefore, through a series of breeding manipulations, a selected gene encoding phosphinothricin acetyltransferase may be moved from one corn line into an entirely different corn line without the need for further recombinant manipulation. Introduced transgenes are valuable in that they behave genetically as any other corn gene and can be manipulated by breeding techniques in a manner identical to any other corn gene. Exemplary procedures of this nature have been successfully carried out by the inventors. In these backcrossing studies, the transformant B16 as well as two other transformants were introgressed into three elite inbred lines by backcrossing. It is possible from these three inbreds to make a large number of hybrids of commercial importance. Seven of the possible hybrids have been made and were field tested for yield and other agronomic characteristics and herbicide tolerance. Additional backcrossing to a further 116 inbred lines is underway. [0218]
  • The elite inbreds FBLL and FBLA were backcrossed five times to the B16 transformant. A third inbred, 78551, was backcrossed six times to the B16 transformant. These three inbreds comprise one parent of each of seven elite commercial corn hybrids. At each backcross generation plants containing the bar gene were identified based on resistance to phosphinothricin. Following five generations of backcrossing to a recurrent elite inbred parent, it is anticipated that the transformed line will be present in a genetic background that is at least 97% identical to the recurrent parent. Following backcross conversion, the plants were self-pollinated twice in order to identify plants homozygous for the introgressed gene of interest, i.e., the B16 insertion event. Hybrids were produced by crossing two inbred parents, one of which contained the introgressed B16 insertion event. [0219]
  • EXAMPLE VII Yield Analysis of a Transformant Containing a Gene Encoding Phosphinothricin Acetyltransferase
  • A. Field Design [0220]
  • Seven hybrids containing the B16 transformation event were field tested for yield and other agronomic traits. These hybrids are referred to as GR hybrids and were produced according to the methods of Example VI. Yield data was collected from the hybrids. [0221]
  • The study was arranged in a split plot design. The main plots consisted of hybrids and each main plot spanned two rows and four ranges. Treatments were randomly assigned for each hybrid to the two-row subplot in each range. Treatments were: 1) the unconverted hybrid, unsprayed, 2) the converted hybrid, OX rate of phosphinothricin (i.e. water only), 3) the converted hybrid, 1× rate of phosphinothricin, and 4) the converted hybrid, 4× rate of phosphinothricin. The 1× field application rate is 0.40 kg active ingredient/hectare. Main plots were separated by two rows of buffer to absorb spray drift. So within one range, there were two rows of experimental material, two rows of buffer, two rows of experimental material, etc. The total width of one repeat depended on the number of hybrids to be tested at each location. Two hybrids were tested at the locations in Group A, five hybrids at Group B locations and five hybrids at Group C locations. Thus, one repeat of the study without surrounding borders was four ranges long and six, 22, or 30 rows wide for Group A, Group B, and Group C, respectively. The study was replicated three times. The replicates were stacked or arranged side-by-side. A sample field design map is shown in FIG. 4. [0222]
  • Field studies were grown under standard agronomic conditions at 12 locations in Indiana, Tennessee, Illinois, Wisconsin, Minnesota, Iowa, and Nebraska. The early hybrids (DK 381 and DK 485) were grown at locations in the 100-105 relative maturity range, whereas the mid-maturity hybrids (DK 512, DK 554, DK 580, DK 591, and DK 623) were grown at locations in the 105-120 relative maturity range. Limited seed quantities of DK 554GR restricted the number of sites including versions of DK 554. Data from sites where there were adverse environmental conditions during the growing condition were-excluded from the combined analysis. The following traits were evaluated: shelled grain weight, grain moisture at harvest, test weight, dropped ears, stalk lodging, root lodging, barrenness, stay green, intactness, seedling vigor, plant height, ear height, 50% pollen shed, 50% silking, and greensnap. Test weight estimates were obtained using meters installed on the combines. Stay green, intactness, and seedling vigor were rated on a 1 to 9 scale, with 9 representing the most favorable rating. Yield estimates were computed using the shelled grain weights, adjusted to 15.5% moisture. The percentages of plants not exhibiting dropped ears, stalk lodging, root, lodging, or barrenness were computed based on final stand counts for each subplot. Silk delay was calculated for each entry as the interval between 505 pollen shed and 50% silking. Data were analyzed using the SAS GLM procedure. Only hybrids to which no phosphinothricin was applied were compared in order to remove any effects of herbicide application rates and/or weed competition on grain yield. The discussion herein will concentrate on results relating to grain yield. [0223]
  • When all hybrids and locations were averaged, the increase in grain yield was about 4.8 bushes/acre (Table 4). T-test analysis of the data indicated that the yield increase over the unconverted hybrids, which do not contain a gene encoding PAT, is statistically significant. Furthermore, there is a 99% confidence interval that the increase in yield in the tested hybrids is between 1.25 and 8.35 bushels/acre. Furthermore, there is a statistically significant increase in seedling vigor in GR hybrids. Table 5, however, indicates that there was a larger increase in yield in certain hybrids, e.g., DK485 and DK512, and negligible yield increases in other hybrids, e.g., DK 591. Across all locations the yield increase averaged up to over 10 bushels per acre depending on the particular hybrid analyzed. The objective of backcross conversions is to recover the genotype of the recurrent parent plus the trait to be introgressed. Following five backcross generations, converted lines are expected to contain greater than 98% recurrent germplasm and are therefore expected to perform similarly to the unconverted hybrid. Therefore, it is common following backcross conversions for hybrids to demonstrate yields that are randomly distributed around the unconverted hybrid mean. It is indeed unexpected to observe the means for yield of hybrids produced from nine different backcross converted inbreds to all be increased relative to the unconverted control hybrid, and this result certainly indicates that the hybrid containing a phosphinothricin acetyltransferase gene tends to have higher yield. Although the yield increases for only the individual hybrids DK 485 and DK 512 were statistically significant, the results when averaged across all locations and all hybrids indicated that the presence of a phosphinothricin acetyltransferase gene in these hybrids leads to a statistically significant increase in yield. [0224]
    TABLE 4
    Agronomic Performance of Hybrids Compared to The
    Counterpart Hybrids with the B16 Integration Event
    Introgressed
    Increase
    in GR
    Trait N Hybrid SE
    Yield (bu/A) 137   4.8** 1.38
    Grain Moisture (%) 137   0.1 0.09
    Test Weight (#/bu) 85   0.2 0.13
    Not Ear Dropped (%) 137 −0.1 0.04
    Not Stalk Lodged (%) 137   0 0.19
    Not Root Lodged (%) 137   0 0.11
    Not Barren (%) 81   0.6 0.44
    Intactness (1-9) 76 −0.5 0.83
    Seedling Vigor (1-9) 95   0.5** 0.09
    Plant Height (in.) 138   1.3** 0.42
    Ear Height (in.) 111   0.1 0.49
    50% Pollen Shed (gdu) 119   1.2 2.21
    50% Silk (gdu) 80   1.5 3.28
    Silk Delay (gdu) 80   1.4 2.28
    Stay Green (1-9) 118   0.1 0.09
    Green Snap (%) 34   0.3 1.94
  • [0225]
    TABLE 5
    GR Hybrid Yield Performance Relative to Unconverted
    Counterpart
    Yield Increase In
    Hybrid (bu/A) Yield
    DK381 149.7
    DK381GR 152.7 3.0
    DK485 155.8
    DK485GR 166.3** 10.5
    DK512 159.6
    DK512GR 168.8** 9.2
    DK554 164.6
    DK554GR 167.3 2.7
    DK580 171.7
    DK580GR 180.0 8.3
    DK591 183.2
    DK591GR 183.3 0.1
    DK623 166.4
    DK623GR 169.3 2.9
  • Table 6 shows data in a hybrid by hybrid and location by location fashion. Three separate analyses of these data were conducted depending on the number of locations at which a set of hybrids were tested, i.e., data set one comprised DK 381 and DK485 at 5 locations, data set two comprised DK 512, DK 580, DK 591, and DK 623 at 9 locations, and data set three comprised DK 512, DK 554, DK 580, DK 591, and DK 623 at 3 locations. Yield differences between the unconverted and GR hybrids were significant at the 0.99 confidence level in analysis of the data comprising set one and set two. Numerically, the GR hybrid version of DK 554 out yielded the unconverted hybrid, but the power of the test was not significant to detect statistical differences, i.e., there were not enough observations. The statistical significance of the yield increases in data sets one and two and the numerical increase in the yield in data set three indicated that there was a yield increase in GR hybrids. The yield increase observed in the GR hybrids was not an artifact produced by the backcross conversion program as these same GR hybrids showed no significant differences for grain moisture, test weight, ear drop, stalk lodging, root lodging, barrenness, stay green, intactness, seedling vigor, plant height, ear height, time to 50% pollen shed, time to 50% silking, silk delay, and green snap. Therefore, the only observed change in agronomic performance in GR hybrids in the absence of herbicide application was a significant increase in grain yield. [0226]
    TABLE 6
    Yield Performance of Unconverted and GR Hybrids
    (Unsprayed) By Location (bu/A)
    Unconverted GR Increase
    Hybrid Location Hybrid Hybrid In Yield
    DK381 Waterman, IL 127.9 126.3 −1.6
    Dayton, IA 141.4 153.4 12.0
    Owatonna, MN (1) 156.5 153.7 −2.8
    Owatonna, MN (2) 152.8 152.5 −0.3
    Olivia, MN 170.1 177.5 7.4
    DK485 Waterman, IL 154.9 159.1 4.2
    Dayton, IA 159.0 164.7 5.7
    Owatonna, MN (1) 147.4 158.1 10.7
    Owatonna, MN (2) 140.4 154.1 13.7
    Olivia, MN 177.1 195.3 18.2
    DK512 Waterman, IL 164.7 171.7 7.0
    Dayton, IA 169.2 178.8 9.6
    Windfall, IN 142.4 150.8 8.4
    Atlantic, IA 210.1 197.8 −12.3
    Mason City, IL 172.1 179.1 7.0
    North Liberty, IA 173.6 172.6 −1.0
    Union City, TN 113.9 139.6 25.7
    Washington, IN 153.4 182.3 28.9
    Thomasboro, IL 137.1 146.8 9.7
    DK554 Waterman, IL 145.9 157.8 11.9
    Dayton, IA 171.4 173.0 1.6
    Windfall, IN 176.5 171.0 −5.5
    DK580 Waterman, IL 163.4 173.9 10.5
    Dayton, IA 177.9 182.0 4.1
    Windfall, IN 173.4 185.7 12.3
    Atlantic, IA 218.2 191.9 −26.3
    Mason City, IL 190.8 172.7 −18.1
    North Liberty, IA 211.0 199.1 −11.9
    Union City, TN 136.5 150.6 14.1
    Washington, IN 179.6 201.0 21.4
    Thomasboro, IL 152.8 150.5 −2.3
    DK591 Waterman, IL 167.7 171.0 3.3
    Dayton, IA 176.7 176.8 0.1
    Windfall, IN 202.1 180.6 −21.5
    Atlantic, IA 237.0 223.3 −13.7
    Mason City, IL 198.8 183.4 −15.4
    North Liberty, IA 206.6 211.4 4.8
    Union City, TN 134.1 146.6 12.5
    Washington, IN 191.5 200.6 9.1
    Thomasboro, IL 140.5 155.8 15.3
    DK623 Waterman, IL 169.5 163.7 −5.8
    Dayton, IA 173.4 181.5 8.1
    Windfall, IN 146.4 152.2 5.8
    Atlantic, IA 165.1 182.9 17.8
    Mason City, IL 184.7 162.3 −22.4
    North Liberty, IA 196.9 206.4 9.5
    Union City, TN 125.4 146.2 20.8
    Washington, IN 193.7 206.4 12.7
    Thomasboro, IL 121.8 121.9 0.1
  • EXAMPLE VIII Marker Assisted Breeding
  • The identification of maize lines that are bred for increased yield may be readily assisted by using a PAT gene integration event preferably the B16 integration event, as presently disclosed, as well as other integration events involving a gene encoding phosphinothricin acetyltransferase as identified using the methods of the present invention. Techniques for isolating nucleic acids and proteins are well known to those of skill in the art (Sambrook et al., 1989), and may be used in conjunction with the integration events of the present invention to selectively segregate plants that have increased yield. [0227]
  • It is contemplated that PAT gene integration events will be useful as DNA probes for marker assisted breeding. In the process of marker assisted breeding DNA sequences are used to follow desirable agronomic traits (Tanksley et al., 1989) in the process of plant breeding. It is anticipated that a PAT gene integration event probe will be useful for identification of plants with enhanced yield. [0228]
  • Marker assisted breeding using a PAT gene integration event is undertaken as follows. Seed of plants with the desired yield are planted in soil in the greenhouse or in the field. Leaf tissue is harvested from the plant for preparation of DNA at any point in growth at which approximately one gram of leaf tissue can be removed from the plant without compromising the viability of the plant. Genomic DNA is isolated using a procedure modified from Shure et al. (1983). Approximately one gram of leaf tissue from a seedling is lypholyzed overnight in 15 ml polypropylene tubes. Freeze-dried tissue is ground to a powder in the tube using a glass rod. Powdered tissue is mixed thoroughly with 3 ml extraction buffer (7.0 M urea, 0.35 M NaCI, 0.05 M Tris-HCI ph 8.0, 0.01 M EDTA, 1% sarcosine). Tissue/buffer homogenate is extracted with 3 ml phenol/chloroform. The aqueous phase is separated by centrifugation, and precipitated twice using {fraction (1/10)} volume of 4.4 M ammonium acetate pH 5.2, and an equal volume of isopropanol. The precipitate is washed with 75% ethanol and resuspended in 100-500 μl TE (0.01 M Tris-HCI, 0.001 M EDTA, pH 8.0). Genomic DNA is digested with a 3-fold excess of restriction enzymes, electrophoresed through 0.8% agarose (FMC), and transferred (Southern, 1975) to Nytran (Schleicher and Schuell) using 10× SCP (20× SCP: 2 M NaCI, 0.6 M disodium phosphate, 0.02 M disodium EDTA). [0229]
  • One of skill in the art will recognize that many different restriction enzymes will be useful and the choice of restriction enzyme will depend on the DNA sequence of the PAT gene integration event that is used as a probe and the DNA sequence in the maize genome surrounding the PAT gene integration event. One will select a restriction enzyme that produces a DNA fragment following hybridization that is identifiable as that PAT gene integration event. Table 7 lists a number of exemplary restriction enzymes and their target sequences. [0230]
  • It is expected that one or more restriction enzymes will be used to digest genomic DNA either singly or in combinations. Filters are prehybridized in 6× SCP, 10% dextran sulfate, 2% sarcosine, and 500 μg/ml denatured salmon sperm DNA and [0231] 32P-labelled wilt gene probe generated by random priming (Feinberg & Vogelstein, 1983). Hybridized filters are washed in 2× SCP, 1% SDS at 65° for 30 minutes and visualized by autoradiography using Kodak XAR5 film. Those of skill in the art will recognize that there are many different ways to isolate DNA from plant tissues and that there are many different protocols for Southern hybridization that will produce identical results. Those of skill in the art will recognize that a Southern blot can be stripped of radioactive probe following autoradiography and re-probed with a different PAT gene integration event probe. In this manner one identifies each of the various PAT gene integration events that is present in the plant.
    TABLE 7
    RESTRICTION ENZYMES
    Aat II GACGT/C
    Acc I GT/MKAC
    Acc II CG/CG
    Acc III T/CCGGA
    Aci I CCGC(2/2)
    Acy I GR/CGYC
    Afl II C/TTAAG
    Afl III A/CRYGT
    Age I A/CCGGT
    Aha III TTT/AAA
    Alu I AG/CT
    AlwN I CAGNNN/CTG
    Aoc I CC/TNAGG
    Apa I GGGCC/C
    ApaB I GCANNNNN/TGC
    ApaL I G/TGCAC
    Asc I GG/CGCGCC
    Asu I G/GNCC
    Asu II TT/CGAA
    Ava I C/YCGRG
    Ava II G/GWCC
    Ava III ATGCAT
    Avr III C/CTAGG
    Bae I ACNNNNGTAYC
    Bal I TGG/CCA
    BamH I G/GATCC
    Bbv I GCAGC(8/12)
    Bbv II GAAGAC(2/6)
    Bcc I CCATC
    Bcef I ACGGC(12/13)
    Bcg I GCANNNNNNCG(12/10)
    Bcl I T/GATCA
    Bet I W/CCGGW
    Bgl I GCCNNNN/NGGC
    Bgl II A/GATCT
    Bin I GGATC(4/5)
    Bpu10 I CCTNAGC(−5/2)
    Bpu1102 I GC/TNAGC
    Bsp1286 I GACCH/C
    Bsp106 I AT/CGAT
    BspC I CGAT/CG
    BsaA I YAC/GTR
    BsaB I GATNN/NNATC
    BseP I GCGCGC
    Bsg I GTGCAG(16/14)
    Bsi I CTCGTG(5/1)
    BsiY I CCNNNNN/NNGG
    Bsm I GAATGC(1/−1)
    BsmA I GTCTC(1/5)
    Bsp50 I CG/CG
    BspG I CG/CGCTGGAC
    BspH I T/CATGA
    BspM I ACCTGC(4/8)
    BspM II T/CCGGA
    Bsr I ACTGG(1/−1)
    BsrB I GAGCGG(−3/−3)
    BstE II G/GTNACC
    BstN I CC/WGG
    BstX I CCANNNNN/NTGG
    Cac8 I GCN/NGC
    Cau II CC/SGG
    Cfr I Y/GGCCR
    Cfr10 I R/CCGGY
    Cla I AT/CGAT
    CviJ I RG/CY
    CviR I TG/CA
    Dde I C/TNAG
    Dpn I GA/TC
    Dra I TTT/AAA
    Dra II RG/GNCCY
    Dra III CACNNN/GTG
    Drd I GACNNNN/NNGTC
    Drd II GAACCA
    Dsa I C/CRYGG
    Eam1105 I GACNNN/NNGTC
    Eci I TCCGCC
    Eco3 II GGTCTC(1/5)
    Eco47 III AGC/GCT
    Eco52 I C/GGCCG
    Eco57 I CTGAAG(16/14)
    EcoN I CCTNN/NNNAGG
    EcoR I G/AATTC
    EcoR II /CCWGG
    Ecor V GAT/ATC
    Esp I GC/TNAGC
    Esp3 I CGTCTC(1/5)
    Fau I CCCGC(4/6)
    Fin I GTCCC
    Fnu4H I GC/NGC
    FnuD II CG/CG
    Fok I GGATG(9/13)
    Fse I GGCCGG/CC
    Fsi I R/AATTY
    Gdi II YGGCCG (−5/−1)
    Gsu I CTGGAG(16/14)
    Hae I WGG/CCW
    Hae II RGCGC/Y
    Hae III GG/CC
    Hga I GACGC(5/10)
    HgiA I GWGCW/C
    HgaC I G/GYRCC
    HgiE II ACCNNNNNNGGT
    HgiJ II GRGCY/C
    Hha I GCG/C
    Hind II GTY/RAC
    Hind III A/AGCTT
    Hinf I G/ANTC
    Hinl I GR/CGYC
    Hpa I GTT/AAC
    Hpa II C/CGG
    Hph I GGTGA(8/7)
    Kpn I GGTAC/C
    Ksp632 I CTCTTC(1/4)
    Ksp I CCGC/GG
    Mae I C/TAG
    Mae II A/CGT
    Mae III /GTNAC
    Mbo I /GATC
    Mbo II GAAGA(8/7)
    Mcr I CGRY/CG
    Mfe I C/AATTG
    Mlu I A/CGCGT
    Mly I GACTC(5/5)
    Mme I TCCRAC(20/18)
    Mnl I CCTC(7/7)
    Mse I T/TAA
    Msp I C/CGG
    Mst I TGC/GCA
    Mst II CC/TNAGG
    Mwo I GCNNNNN/NNGC
    Nae I GCC/GGC
    Nar I GG/CGCC
    Nci I CC/SGG
    Nco I C/CATGG
    Nde I CA/TATG
    Nhe I G/CTAGC
    Nla III CATG/
    Nla IV GGN/NCC
    Not I GC/GGCCGC
    Nru I TCG/CGA
    Nsi I ATGCA/T
    Nsp I RCATG/Y
    NspB II CMG/CKG
    Pac I TTAAT/TAA
    Pal I GG/CC
    Pfl1108 I TCGTAG
    PflM I CCANNNN/NTGG
    Ple I GAGTC(4/5)
    PmaC I CAC/GTG
    Pme I GTTT/AAAC
    PpuM I RG/GWCCY
    PshA I GACNN/NNGTC
    PspA I C/CCGGG
    Pst I CTGCA/G
    Pvu I CGAT/CG
    Pvu II CAG/CTG
    RleA I CCCACA(12/9)
    Rsa I GT/AC
    Rsr II CG/GWCCG
    Sac I GAGCT/C
    Sac II CCGC/GG
    Sal I G/TCGAC
    Sap I GCTCTTC(1/4)
    Sau3A I /GATC
    Sau96 I G/GNCC
    Sau I CC/TNAGG
    Sca I AGT/ACT
    ScrF I CC/NGG
    Sdu I GDGCH/C
    Sec I C/CNNGG
    SfaN I GATC(5/9)
    Sfc I CTYRAG
    Sfe I C/TYRAG
    Sfi I GGCCNNNN/NGGCC
    SgrA I CR/CCGGYG
    Sma I CCC/GGG
    Sna I GTATAC
    SnaB I TAC/GTA
    Spe I A/CTAGT
    Sph I GCATG/C
    Spl I C/GTACG
    Srf I GCCC/GGGC
    Sse838 I CCTGCA/GG
    Ssp I AAT/ATT
    Stu I AGG/CCT
    Sty I C/CWWGG
    Swa I ATTT/AAAT
    Taq I T/CGA
    Taq II GACCGA(11/9)
    Tfi I GAWTC
    Tsp45 I GTSAC
    TspE I AATT
    Tth111 I GACN/NNGTC
    Tth111 II CAARCA(11/9)
    Vsp I AT/TAAT
    Xba I T/CTGAGA
    Xcm I CCANNNNN/NNNNTGG
    Xho I C/TCGAG
    Xho II R/GATCY
    Xma I C/CCGGG
    Xma III C/GGCCG
    Xmn I GAANN/NNTTC
  • Each lane of the Southern blot represents DNA isolated from one plant. Through the use of a multiplicity of PAT gene integration events as probes on the same genomic DNA blot, the integration event composition of each plant is determined. Correlations are established between the contributions of particular integration events to increasing the yield of the plant. Only those plants that contain the desired combination of integration events are advanced to maturity and used for pollination. DNA probes corresponding to PAT gene integration events are useful markers during the course of plant breeding to identify and combine particular integration events without having to grow the plants and assay the plants for agronomic performance. [0232]
  • All of the compositions and methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the composition, methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims. [0233]
  • REFERENCES
  • The references listed below are incorporated herein by reference to the extent that they supplement, explain, provide a background for, or teach methodology, techniques and/or compositions employed herein. [0234]
  • Adams et al., PCT Publication WO 91/02071 [0235]
  • Armaleo et al., [0236] Current Genetics, 17:97-103, 1990
  • Armstrong et al., [0237] Maize Genetics Coop Newsletter, 65:92-93, 1991
  • Armstrong & Green, [0238] Planta, 164:207-214, 1985
  • Bayer et al., [0239] Helvetica Chimica Acta, 55:224-239, 1972
  • Bradford, [0240] Anal. Biochem., 72:248-254, 1976
  • Casas et al., [0241] Proc. Natl. Acad. Sci USA, 90:11212-11216, 1993
  • Chomet et al., [0242] EMBO J, 6:295-302, 1987
  • Christou et al., [0243] Plant Physiol, 87:671-674, 1988
  • Christou, et al., [0244] Bio/Technology, 9:957-962, 1991
  • Chu et al., [0245] Scientia Sinica, 18:659-668, 1975
  • Clark, [0246] J. of Plant Nutrition, 5:1039, 1982
  • Conger et al., [0247] Plant Cell Rep, 0.6:345-347, 1987
  • De Block et al., [0248] Plant Physiol, 91:694-701, 1989
  • De Block et al., [0249] EMBO J., 6:2513-2518; 1987
  • DE 3642 B29 A. (German Patent Application) [0250]
  • D'Halluin et al., [0251] The Plant Cell, 4:1495-1505, 1992
  • Dekeyser et al., [0252] Plant Physiol, 90:217-223, 1989
  • Demain et al., In: [0253] Biochemistry and Genetic Regulation of Commercially Important Antibiotics, Ed.: Vining, L., Addison-Wesley Publishing Co., 1983
  • European Patent EP 0,242,236 [0254]
  • European Patent EP 0,242,246 [0255]
  • Feinberg & Vogelstein, [0256] Anal Biochem, 132:6-13, 1983
  • Fromm et al., [0257] Nature, 312:791-793, 1986
  • Gordon-Kamm et al., [0258] Plant Cell, 2:603-618, 1990
  • Gordon-Kamm et al., [0259] Plant Cell, 2:603-618, 1990
  • Hallauer et al., In: [0260] Corn and Corn Improvement, Eds: Sprague & Dudley, Agronomy Society of American Publishing, 1988
  • Harlow & Lane, [0261] Antibodies: A laboratory manual, Cold Spring Harbor, 1988
  • Hauptmann et al., [0262] Plant Physiol, 86:602-606, 1988
  • Jefferson, [0263] P1 Mol Biol Repr, 5:387-405, 1987
  • Klein et al., [0264] Nature, 327:70-73, 1987
  • Klein et al., [0265] Plant Physiol, 91:440-444, 1989
  • Koziel et al., [0266] Bio/Technology, 11:194-200, 1993
  • Krzyzek & Laursen, PCT Publication WO 92/12250 [0267]
  • Krzyzek et al., U.S. patent application Ser. No. 07/635,279, filed Dec. 28, 1990 [0268]
  • Laemelli, [0269] Nature, 227:680-685, 1970
  • Lande, & Thompson, [0270] Genetics, 124:743-756, 1990
  • Laursen et al., [0271] Plant Molecular Biology, 24:51-61, 1994
  • Leemans et al., [0272] British Crop Protection Conference—Weeds, 3:867-870, 1987
  • Lorz et al., [0273] Mol Gen Genet, 199:178-182, 1985
  • Lyznik et al., [0274] Plant Mol Biol, 13:151-16, 1989
  • Mizobuchi, & Frohman, [0275] Biotechniques, 15:215-216, 1993
  • Murakami et al., [0276] Mol Gen Genet, 205:42-50, 1986
  • Murashige & Skoog, [0277] Physiol Plant, 15:473-497, 1962
  • Nester et al., [0278] Ann. Rev. Plant Physiol, 35:387-413, 1984
  • Ogawa et al., [0279] Sci. Rep., Meija Seika, 13:42-48, 1973
  • PCT Patent Application, Publication No. WO 87/00141 [0280]
  • PCT Patent Application, Publication No. WO 87/05629, published Sep. 24, 1987, 1987 [0281]
  • Potrykus, [0282] Trends Biotechnol, 7:269-273, 1989
  • Sambrook et al., [0283] Molecular Cloning, A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press, 1989
  • Shillito et al., [0284] Bio/Technol, 7:581-587, 1989
  • Shure et al., [0285] Cell, 35:225-233, 1983
  • Southern, [0286] J Mol Biol, 98:503-517, 1975
  • Spencer et al.; [0287] Theor. Appl. Genet., 79:625-631, 1990
  • Spencer et al., [0288] NATO ASI Series, Vol H 81 Plant Molecular Biology, pp. 559-565, 1994
  • Sprague & Eberhart, In: [0289] Corn and Corn Improvement, 2nd Ed., Eds.: Dudley & Sprague, Iowa State University Press, 1977
  • Tanksley et al., [0290] Bio/Technology, 7:257-264, 1989
  • Thompson et. al., [0291] EMBO J., 6:2519-2523, 1987
  • Thompson et al., [0292] EMBO J, 6:2519-2623, 1987
  • Twell et al., [0293] Plant Physiol, 91:1270-1274, 1989
  • U.S. Pat. No. 4,732,856. [0294]
  • Wan & Lemaux, [0295] Plant Physiol., 104:37-48, 1994
  • U.S. patent application Ser. No. 07/974,379 [0296]
  • U.S. patent application Ser. No. 08/113,561 [0297]
  • U.S. patent application Ser. No. 08/233,067 [0298]
  • U.S. Pat. No. 5,273,894 [0299]
  • U.S. Pat. No. 5,276,268 [0300]
  • Wang et al., [0301] Plant Molecular Biology, 11:433-439, 1988
  • Weeks et al., [0302] Plant Physiol., 102:1077-1084, 1993
  • White et. al., [0303] Nuci. Acids Res., 18:1062, 1990
  • Yang et al., [0304] Plant Cell Rep, 7:421-425, 1988
  • Zhang et al., [0305] Plant Cell Rep, 7:379-384, 1988
  • 1 4 807 base pairs nucleic acid single linear 1 AGATCTGGAG CGACGTCCTG GGGGCCGGTC CGGTGCTGCC CGGGGACGAC TTCTTCTCCC 60 TCGGCGGCAC CTCCATCTCG GCGTTGCGGG TGGTCTCGCG CATCCGCAAG GAACTCGGCG 120 TGCCACTCCG GCTCGCCGTG ATCTTCGAGA CGCCGTCCCT GGAAGCGGTG GCCGAATCCG 180 TACTCCGCGA ACTGAAGGGG ACGTAGTAAA GAGGTGCCCG CCACCCGCTT TCGCAGAACA 240 CCGAAGGAAG ACCACACGTG AGCCCAGAAC GACGCCCGGT CGAGATCCGT CCCGCCACCG 300 CCGCCGACAT GGCGGCGGTC TGCGACATCG TCAATCACTA CATCGAGACG AGCACGGTCA 360 ACTTCCGTAC GGAGCCGCAG ACTCCGCAGG AGTGGATCGA CGACCTGGAG CGCCTCCAGG 420 ACCGCTACCC CTGGCTCGTC GCCGAGGTGG AGGGCGTCGT CGCCGGCATC GCCTACGCCG 480 GCCCCTGGAA GGCCCGCAAC GCCTACGACT GGACCGTCGA GTCGACGGTG TACGTCTCCC 540 ACCGGCACCA GCGGCTCGGA CTGGGCTCCA CCCTCTACAC CCACCTGCTG AAGTCCATGG 600 AGGCCCAGGG CTTCAAGAGC GTGGTCGCCG TCATCGGACT GCCCAACGAC CCGAGCGTGC 660 GCCTGCACGA GGCGCTCGGA TACACCGCGC GCGGGACGCT GCGGGCAGCC GGCTACAAGC 720 ACGGGGGCTG GCACGACGTG GGGTTCTGGC AGCGCGACTT CGAGCTGCCG GCCCCGCCCC 780 GCCCCGTCCG GCCCGTCACA CAGATCT 807 183 amino acids amino acid single linear 2 Met Ser Pro Glu Arg Arg Pro Val Glu Ile Arg Pro Ala Thr Ala Ala 1 5 10 15 Asp Met Ala Ala Val Cys Asp Ile Val Asn His Tyr Ile Glu Thr Ser 20 25 30 Thr Val Asn Phe Arg Thr Glu Pro Gln Thr Pro Gln Glu Trp Ile Asp 35 40 45 Asp Leu Glu Arg Leu Gln Asp Arg Tyr Pro Trp Leu Val Ala Glu Val 50 55 60 Glu Gly Val Val Ala Gly Ile Ala Tyr Ala Gly Pro Trp Lys Ala Arg 65 70 75 80 Asn Ala Tyr Asp Trp Thr Val Glu Ser Thr Val Tyr Val Ser His Arg 85 90 95 His Gln Arg Leu Gly Leu Gly Ser Thr Leu Tyr Thr His Leu Leu Lys 100 105 110 Ser Met Glu Ala Gln Gly Phe Lys Ser Val Val Ala Val Ile Gly Leu 115 120 125 Pro Asn Asp Pro Ser Val Arg Leu His Glu Ala Leu Gly Tyr Thr Ala 130 135 140 Arg Gly Thr Leu Arg Ala Ala Gly Tyr Lys His Gly Gly Trp His Asp 145 150 155 160 Val Gly Phe Trp Gln Arg Asp Phe Glu Leu Pro Ala Pro Pro Arg Pro 165 170 175 Val Arg Pro Val Thr Gln Ile 180 615 base pairs nucleic acid single linear 3 GAATTCGAGC TCGGTACCCG GGGATCTACC ATGAGCCCAG AACGACGCCC GGCCGACATC 60 CGCCGTGCCA CCGAGGCGGA CATGCCGGCG GTCTGCACCA TCGTCAACCA CTACATCGAG 120 ACAAGCACGG TCAACTTCCG TACCGAGCCG CAGGAACCGC AGGAGTGGAC GGACGACCTC 180 GTCCGTCTGC GGGAGCGCTA TCCCTGGCTC GTCGCCGAGG TGGACGGCGA GGTCGCCGGC 240 ATCGCCTACG CGGGCCCCTG GAAGGCACGC AACGCCTACG ACTGGACGGC CGAGTCGACC 300 GTGTACGTCT CCCCCCGCCA CCAGCGGACG GGACTGGGCT CCACGCTCTA CACCCACCTG 360 CTGAAGTCCC TGGAGGCACA GGGCTTCAAG AGCGTGGTCG CTGTCATCGG GCTGCCCAAC 420 GACCCGAGCG TGCGCATGCA CGAGGCGCTC GGATATGCCC CCCGCGGCAT GCTGCGGGCG 480 GCCGGCTTCA AGCACGGGAA CTGGCATGAC GTGGGTTTCT GGCAGCTGGA CTTCAGCCTG 540 CCGGTACCGC CCCGTCCGGT CCTGCCCGTC ACCGAGATCT GATGACCCGG GGGATCCCTG 600 CAGGCATGCA AGCTT 615 183 amino acids amino acid single linear 4 Met Ser Pro Glu Arg Arg Pro Ala Asp Ile Arg Arg Ala Thr Glu Ala 1 5 10 15 Asp Met Pro Ala Val Cys Thr Ile Val Asn His Tyr Ile Glu Thr Ser 20 25 30 Thr Val Asn Phe Arg Thr Glu Pro Gln Glu Pro Gln Glu Trp Thr Asp 35 40 45 Asp Leu Val Arg Leu Arg Glu Arg Tyr Pro Trp Leu Val Ala Glu Val 50 55 60 Asp Gly Glu Val Ala Gly Ile Ala Tyr Ala Gly Pro Trp Lys Ala Arg 65 70 75 80 Asn Ala Tyr Asp Trp Thr Ala Glu Ser Thr Val Tyr Val Ser Pro Arg 85 90 95 His Gln Arg Thr Gly Leu Gly Ser Thr Leu Tyr Thr His Leu Leu Lys 100 105 110 Ser Leu Glu Ala Gln Gly Phe Lys Ser Val Val Ala Val Ile Gly Leu 115 120 125 Pro Asn Asp Pro Ser Val Arg Met His Glu Ala Leu Gly Tyr Ala Pro 130 135 140 Arg Gly Met Leu Arg Ala Ala Gly Phe Lys His Gly Asn Trp His Asp 145 150 155 160 Val Gly Phe Trp Gln Leu Asp Phe Ser Leu Pro Val Pro Pro Arg Pro 165 170 175 Val Leu Pro Val Thr Glu Ile 180

Claims (19)

What is claimed is:
1. A method of providing a transformed plant line having an increased yield relative to a starting plant line, comprising introducing into a starting plant line a gene encoding phosphinothricin acetyltransferase (PAT) to produce PAT transformed plants, and selecting therefrom a PAT transformed plant having an increased yield relative to the starting plant line.
2. The method of claim 1, wherein the PAT gene is introduced into the starting plant line by crossing said starting line with a donor plant line that comprises the PAT gene.
3. The method of claim 1, wherein said plant is Zea mays.
4. The method of claim 1, further comprising preparing seed from a plant of the selected transformed line, wherein said seed contains the PAT gene.
5. The method of claim 1, further comprising preparing progeny from a plant of the selected transformed line, wherein said progeny contains the PAT gene.
6. The method of claim 5, further comprising preparing seed from the prepared progeny, wherein said seed contains the PAT gene.
7. The method of claim 5, wherein one of said progeny is bred with a non-transgenic maize plant to prepare a bred plant, wherein said bred plant contains the PAT gene.
8. The method of either of claim 7, further comprising preparing seed from the bred plant, wherein said seed contains the PAT gene.
9. The method of claim 5, wherein one of said progeny is bred with another transgenic maize plant to prepare a bred plant, wherein said bred plant contains the PAT gene.
10. The method of either of claim 9, further comprising preparing seed from the bred plant, wherein said seed contains the PAT gene.
11. The method of claim 1, wherein the plant contains a bar gene.
12. A transformed maize plant prepared by the method of claim 1.
13. The transformed maize plant of claim 12, designated B16.
14. Progeny of the plant of claim 13.
15. Seed of the plant of claim 13.
16. Seed of the plant of claim 14.
17. A method of preparing a PAT gene integration event DNA segment comprising the steps of:
(a) identifying a plant containing a transgenic PAT gene;
(b) preparing a genomic library from said identified plant; and
(c) screening said library to identify a genomic clone comprising the PAT gene and adjacent plant genomic DNA.
18. The method of claim 17, further comprising the steps of:
(a) identifying a plant DNA sequence flanking an integrated PAT gene;
(b) preparing a genomic DNA library from an untransformed plant; and
(c) screening said library to identify a DNA clone comprising the plant DNA sequence into which the PAT gene was integrated.
19. A DNA segment prepared in accordance with claim 17.
US10/171,498 1990-08-09 2002-06-13 Methods and compositions for the increase of yield in plants Abandoned US20030126634A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US10/171,498 US20030126634A1 (en) 1990-08-09 2002-06-13 Methods and compositions for the increase of yield in plants

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US07/565,844 US5550318A (en) 1990-04-17 1990-08-09 Methods and compositions for the production of stably transformed, fertile monocot plants and cells thereof
US08/113,561 US7705215B1 (en) 1990-04-17 1993-08-25 Methods and compositions for the production of stably transformed, fertile monocot plants and cells thereof
US08/233,067 US5489520A (en) 1990-04-17 1994-04-26 Process of producing fertile transgenic zea mays plants and progeny comprising a gene encoding phosphinothricin acetyl transferase
US08/357,497 US6395966B1 (en) 1990-08-09 1994-12-16 Fertile transgenic maize plants containing a gene encoding the pat protein
US6240598A 1998-04-20 1998-04-20
US10/171,498 US20030126634A1 (en) 1990-08-09 2002-06-13 Methods and compositions for the increase of yield in plants

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US6240598A Continuation 1990-08-09 1998-04-20

Publications (1)

Publication Number Publication Date
US20030126634A1 true US20030126634A1 (en) 2003-07-03

Family

ID=27381340

Family Applications (2)

Application Number Title Priority Date Filing Date
US08/357,497 Expired - Lifetime US6395966B1 (en) 1990-08-09 1994-12-16 Fertile transgenic maize plants containing a gene encoding the pat protein
US10/171,498 Abandoned US20030126634A1 (en) 1990-08-09 2002-06-13 Methods and compositions for the increase of yield in plants

Family Applications Before (1)

Application Number Title Priority Date Filing Date
US08/357,497 Expired - Lifetime US6395966B1 (en) 1990-08-09 1994-12-16 Fertile transgenic maize plants containing a gene encoding the pat protein

Country Status (1)

Country Link
US (2) US6395966B1 (en)

Cited By (248)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100190647A1 (en) * 2009-01-29 2010-07-29 Bayer Cropscience Ag Method for improved utilization of the production potential of transgenic plants introduction
US20110039700A1 (en) * 2008-04-28 2011-02-17 Reiner Fischer Method for Improved Utilization of the Production Potential of Transgenic Plants Introduction
WO2011061656A1 (en) * 2009-11-17 2011-05-26 Basf Plant Science Company Gmbh Plants with increased yield
WO2012072696A1 (en) 2010-12-01 2012-06-07 Bayer Cropscience Ag Active ingredient combinations comprising pyridylethylbenzamides and other active ingredients
WO2012072660A1 (en) 2010-12-01 2012-06-07 Bayer Cropscience Ag Use of fluopyram for controlling nematodes in crops and for increasing yield
WO2012072489A1 (en) 2010-11-29 2012-06-07 Bayer Cropscience Ag Alpha,beta-unsaturated imines
US20120167250A1 (en) * 2010-12-22 2012-06-28 E.I. Du Pont De Nemours And Company Viral promoter, truncations thereof, and methods of use
WO2012120105A1 (en) 2011-03-10 2012-09-13 Bayer Cropscience Ag Use of lipochito-oligosaccharide compounds for safeguarding seed safety of treated seeds
WO2012126938A2 (en) 2011-03-23 2012-09-27 Bayer Cropscience Ag Active compound combinations
WO2012136581A1 (en) 2011-04-08 2012-10-11 Bayer Cropscience Ag Fungicide hydroximoyl-tetrazole derivatives
WO2012171914A1 (en) 2011-06-14 2012-12-20 Bayer Intellectual Property Gmbh Use of an enaminocarbonyl compound in combination with a biological control agent
EP2561759A1 (en) 2011-08-26 2013-02-27 Bayer Cropscience AG Fluoroalkyl-substituted 2-amidobenzimidazoles and their effect on plant growth
WO2013026740A2 (en) 2011-08-22 2013-02-28 Bayer Cropscience Nv Methods and means to modify a plant genome
WO2013037717A1 (en) 2011-09-12 2013-03-21 Bayer Intellectual Property Gmbh Fungicidal 4-substituted-3-{phenyl[(heterocyclylmethoxy)imino]methyl}-1,2,4-oxadizol-5(4h)-one derivatives
WO2013037956A1 (en) 2011-09-16 2013-03-21 Bayer Intellectual Property Gmbh Use of 5-phenyl- or 5-benzyl-2 isoxazoline-3 carboxylates for improving plant yield
WO2013037955A1 (en) 2011-09-16 2013-03-21 Bayer Intellectual Property Gmbh Use of acylsulfonamides for improving plant yield
WO2013037958A1 (en) 2011-09-16 2013-03-21 Bayer Intellectual Property Gmbh Use of phenylpyrazolin-3-carboxylates for improving plant yield
WO2013050410A1 (en) 2011-10-04 2013-04-11 Bayer Intellectual Property Gmbh RNAi FOR THE CONTROL OF FUNGI AND OOMYCETES BY INHIBITING SACCHAROPINE DEHYDROGENASE GENE
WO2013075817A1 (en) 2011-11-21 2013-05-30 Bayer Intellectual Property Gmbh Fungicide n-[(trisubstitutedsilyl)methyl]-carboxamide derivatives
WO2013079566A2 (en) 2011-11-30 2013-06-06 Bayer Intellectual Property Gmbh Fungicidal n-bicycloalkyl and n-tricycloalkyl (thio)carboxamide derivatives
WO2013092519A1 (en) 2011-12-19 2013-06-27 Bayer Cropscience Ag Use of anthranilic acid diamide derivatives for pest control in transgenic crops
WO2013098146A1 (en) 2011-12-29 2013-07-04 Bayer Intellectual Property Gmbh Fungicidal 3-[(1,3-thiazol-4-ylmethoxyimino)(phenyl)methyl]-2-substituted-1,2,4-oxadiazol-5(2h)-one derivatives
WO2013098147A1 (en) 2011-12-29 2013-07-04 Bayer Intellectual Property Gmbh Fungicidal 3-[(pyridin-2-ylmethoxyimino)(phenyl)methyl]-2-substituted-1,2,4-oxadiazol-5(2h)-one derivatives
WO2013110594A1 (en) 2012-01-25 2013-08-01 Bayer Intellectual Property Gmbh Active compound combinations containing fluopyram and biological control agent
WO2013110591A1 (en) 2012-01-25 2013-08-01 Bayer Intellectual Property Gmbh Active compounds combination containing fluopyram bacillus and biologically control agent
WO2013127704A1 (en) 2012-02-27 2013-09-06 Bayer Intellectual Property Gmbh Active compound combinations containing a thiazoylisoxazoline and a fungicide
WO2013139949A1 (en) 2012-03-23 2013-09-26 Bayer Intellectual Property Gmbh Compositions comprising a strigolactame compound for enhanced plant growth and yield
WO2013153143A1 (en) 2012-04-12 2013-10-17 Bayer Cropscience Ag N-acyl- 2 - (cyclo) alkylpyrrolidines and piperidines useful as fungicides
WO2013156560A1 (en) 2012-04-20 2013-10-24 Bayer Cropscience Ag N-cycloalkyl-n-[(trisubstitutedsilylphenyl)methylene]-(thio)carboxamide derivatives
WO2013156559A1 (en) 2012-04-20 2013-10-24 Bayer Cropscience Ag N-cycloalkyl-n-[(heterocyclylphenyl)methylene]-(thio)carboxamide derivatives
EP2662370A1 (en) 2012-05-09 2013-11-13 Bayer CropScience AG 5-Halogenopyrazole benzofuranyl carboxamides
EP2662363A1 (en) 2012-05-09 2013-11-13 Bayer CropScience AG 5-Halogenopyrazole biphenylcarboxamides
EP2662361A1 (en) 2012-05-09 2013-11-13 Bayer CropScience AG Pyrazol indanyl carboxamides
EP2662362A1 (en) 2012-05-09 2013-11-13 Bayer CropScience AG Pyrazole indanyl carboxamides
EP2662360A1 (en) 2012-05-09 2013-11-13 Bayer CropScience AG 5-Halogenopyrazole indanyl carboxamides
EP2662364A1 (en) 2012-05-09 2013-11-13 Bayer CropScience AG Pyrazole tetrahydronaphthyl carboxamides
WO2013167545A1 (en) 2012-05-09 2013-11-14 Bayer Cropscience Ag Pyrazole indanyl carboxamides
WO2013167544A1 (en) 2012-05-09 2013-11-14 Bayer Cropscience Ag 5-halogenopyrazole indanyl carboxamides
WO2013174836A1 (en) 2012-05-22 2013-11-28 Bayer Cropscience Ag Active compounds combinations comprising a lipo-chitooligosaccharide derivative and a nematicide, insecticidal or fungicidal compound
WO2014019983A1 (en) 2012-07-31 2014-02-06 Bayer Cropscience Ag Compositions comprising a pesticidal terpene mixture and an insecticide
WO2014043435A1 (en) 2012-09-14 2014-03-20 Bayer Cropscience Lp Hppd variants and methods of use
WO2014055477A2 (en) * 2012-10-03 2014-04-10 Pioneer Hi-Bred International, Inc. Genes controlling photoperiod sensitivity in maize and sorghum and uses thereof
EP2719280A1 (en) 2012-10-11 2014-04-16 Bayer CropScience AG Use of N-phenylethylpyrazole carboxamide derivatives or salts thereof for resistance management of phytopathogenic fungi
WO2014060519A1 (en) 2012-10-19 2014-04-24 Bayer Cropscience Ag Method for enhancing tolerance to abiotic stress in plants using carboxamide or thiocarboxamide derivatives
WO2014060502A1 (en) 2012-10-19 2014-04-24 Bayer Cropscience Ag Active compound combinations comprising carboxamide derivatives
WO2014060518A1 (en) 2012-10-19 2014-04-24 Bayer Cropscience Ag Method of plant growth promotion using carboxamide derivatives
WO2014060520A1 (en) 2012-10-19 2014-04-24 Bayer Cropscience Ag Method for treating plants against fungi resistant to fungicides using carboxamide or thiocarboxamide derivatives
US8722072B2 (en) 2010-01-22 2014-05-13 Bayer Intellectual Property Gmbh Acaricidal and/or insecticidal active ingredient combinations
EP2735231A1 (en) 2012-11-23 2014-05-28 Bayer CropScience AG Active compound combinations
WO2014083031A2 (en) 2012-11-30 2014-06-05 Bayer Cropscience Ag Binary pesticidal and fungicidal mixtures
WO2014083089A1 (en) 2012-11-30 2014-06-05 Bayer Cropscience Ag Ternary fungicidal and pesticidal mixtures
WO2014083033A1 (en) 2012-11-30 2014-06-05 Bayer Cropsience Ag Binary fungicidal or pesticidal mixture
WO2014083088A2 (en) 2012-11-30 2014-06-05 Bayer Cropscience Ag Binary fungicidal mixtures
WO2014082950A1 (en) 2012-11-30 2014-06-05 Bayer Cropscience Ag Ternary fungicidal mixtures
WO2014086747A2 (en) 2012-12-03 2014-06-12 Bayer Cropscience Ag Composition comprising a biological control agent and a fungicide
WO2014086759A2 (en) 2012-12-03 2014-06-12 Bayer Cropscience Ag Composition comprising biological control agents
WO2014086748A2 (en) 2012-12-03 2014-06-12 Bayer Cropscience Ag Composition comprising a biological control agent and a fungicide
WO2014086750A2 (en) 2012-12-03 2014-06-12 Bayer Cropscience Ag Composition comprising a biological control agent and an insecticide
WO2014086758A2 (en) 2012-12-03 2014-06-12 Bayer Cropscience Ag Composition comprising a biological control agent and an insecticide
WO2014086764A2 (en) 2012-12-03 2014-06-12 Bayer Cropscience Ag Composition comprising a biological control agent and a fungicide
WO2014086753A2 (en) 2012-12-03 2014-06-12 Bayer Cropscience Ag Composition comprising biological control agents
WO2014086749A2 (en) 2012-12-03 2014-06-12 Bayer Cropscience Ag Composition comprising a biological control agent and an insecticide
WO2014090765A1 (en) 2012-12-12 2014-06-19 Bayer Cropscience Ag Use of 1-[2-fluoro-4-methyl-5-(2,2,2-trifluoroethylsulfinyl)phenyl]-5-amino-3-trifluoromethyl)-1 h-1,2,4 tfia zole for controlling nematodes in nematode-resistant crops
WO2014095826A1 (en) 2012-12-18 2014-06-26 Bayer Cropscience Ag Binary fungicidal and bactericidal combinations
WO2014095677A1 (en) 2012-12-19 2014-06-26 Bayer Cropscience Ag Difluoromethyl-nicotinic- tetrahydronaphtyl carboxamides
WO2014124361A1 (en) 2013-02-11 2014-08-14 Bayer Cropscience Lp Compositions comprising a streptomyces-based biological control agent and another biological control agent
WO2014124379A1 (en) 2013-02-11 2014-08-14 Bayer Cropscience Lp Compositions comprising a streptomyces-based biological control agent and an insecticide
WO2014124369A1 (en) 2013-02-11 2014-08-14 Bayer Cropscience Lp Compositions comprising a streptomyces-based biological control agent and a fungicide
WO2014138339A2 (en) 2013-03-07 2014-09-12 Athenix Corp. Toxin genes and methods for their use
WO2014170345A2 (en) 2013-04-19 2014-10-23 Bayer Cropscience Ag Method for improved utilization of the production potential of transgenic plants
WO2014170364A1 (en) 2013-04-19 2014-10-23 Bayer Cropscience Ag Binary insecticidal or pesticidal mixture
WO2014177582A1 (en) 2013-04-30 2014-11-06 Bayer Cropscience Ag N-(2-fluoro-2-phenethyl)carboxamides as nematicides and endoparasiticides
WO2014177514A1 (en) 2013-04-30 2014-11-06 Bayer Cropscience Ag Nematicidal n-substituted phenethylcarboxamides
WO2014206953A1 (en) 2013-06-26 2014-12-31 Bayer Cropscience Ag N-cycloalkyl-n-[(bicyclylphenyl)methylene]-(thio)carboxamide derivatives
WO2015082587A1 (en) 2013-12-05 2015-06-11 Bayer Cropscience Ag N-cycloalkyl-n-{[2-(1-substitutedcycloalkyl)phenyl]methylene}-(thio)carboxamide derivatives
WO2015082586A1 (en) 2013-12-05 2015-06-11 Bayer Cropscience Ag N-cycloalkyl-n-{[2-(1-substitutedcycloalkyl)phenyl]methylene}-(thio)carboxamide derivatives
EP2885970A1 (en) 2013-12-21 2015-06-24 Bayer CropScience AG Fungicide compositions comprising compound I, at least one succinate dehydrogenase (SDH) inhibitor and at least one triazole fungicide
WO2015138394A2 (en) 2014-03-11 2015-09-17 Bayer Cropscience Lp Hppd variants and methods of use
WO2015160618A1 (en) 2014-04-16 2015-10-22 Bayer Cropscience Lp Compositions comprising ningnanmycin and a biological control agent
WO2015160620A1 (en) 2014-04-16 2015-10-22 Bayer Cropscience Lp Compositions comprising ningnanmycin and an insecticide
WO2015160619A1 (en) 2014-04-16 2015-10-22 Bayer Cropscience Lp Compositions comprising ningnanmycin and a fungicide
US9206137B2 (en) 2010-11-15 2015-12-08 Bayer Intellectual Property Gmbh N-Aryl pyrazole(thio)carboxamides
US9265252B2 (en) 2011-08-10 2016-02-23 Bayer Intellectual Property Gmbh Active compound combinations comprising specific tetramic acid derivatives
EP2997825A1 (en) 2011-04-22 2016-03-23 Bayer Intellectual Property GmbH Active compound combinations comprising a (thio)carboxamide derivative and a fungicidal compound
WO2016166077A1 (en) 2015-04-13 2016-10-20 Bayer Cropscience Aktiengesellschaft N-cycloalkyl-n-(biheterocyclyethylene)-(thio)carboxamide derivatives
EP3097782A1 (en) 2015-05-29 2016-11-30 Bayer CropScience Aktiengesellschaft Methods for controlling phytopathogenic nematodes by combination of fluopyram and biological control agents
WO2017042259A1 (en) 2015-09-11 2017-03-16 Bayer Cropscience Aktiengesellschaft Hppd variants and methods of use
US9701947B2 (en) 2003-08-21 2017-07-11 Monsanto Technology Llc Fatty acid desaturases from primula
EP3205210A1 (en) 2012-05-30 2017-08-16 Bayer CropScience Aktiengesellschaft Composition comprising a biological control agent and a fungicide selected from inhibitors of the succinate dehydrogenase
EP3243387A2 (en) 2012-05-30 2017-11-15 Bayer CropScience Aktiengesellschaft Compositions comprising a biological control agent and an insecticide
WO2017198450A1 (en) * 2016-05-15 2017-11-23 Bayer Cropscience Nv Method for increasing yield in maize
WO2018019676A1 (en) 2016-07-29 2018-02-01 Bayer Cropscience Aktiengesellschaft Active compound combinations and methods to protect the propagation material of plants
EP3281526A1 (en) 2012-05-30 2018-02-14 Bayer CropScience Aktiengesellschaft Composition comprising a biological control agent and a fungicide
EP3292764A2 (en) 2012-05-30 2018-03-14 Bayer CropScience Aktiengesellschaft Composition comprising a biological control agent and a fungicide selected from inhibitors of the respiratory chain at complex iii
EP3300603A2 (en) 2012-05-30 2018-04-04 Bayer CropScience Aktiengesellschaft Composition comprising a biological control agent and a fungicide
EP3318128A2 (en) 2012-05-30 2018-05-09 Bayer CropScience Aktiengesellschaft Composition comprising a biological control agent and a fungicide
WO2018098214A1 (en) 2016-11-23 2018-05-31 Bayer Cropscience Lp Axmi669 and axmi991 toxin genes and methods for their use
WO2018136611A1 (en) 2017-01-18 2018-07-26 Bayer Cropscience Lp Use of bp005 for the control of plant pathogens
WO2018136604A1 (en) 2017-01-18 2018-07-26 Bayer Cropscience Lp Bp005 toxin gene and methods for its use
EP3360418A1 (en) 2012-05-30 2018-08-15 Bayer CropScience Aktiengesellschaft Composition comprising a biological control agent and a fungicide
EP3363289A2 (en) 2012-05-30 2018-08-22 Bayer CropScience Aktiengesellschaft Compositions comprising a biological control agent and an insecticide
WO2018165091A1 (en) 2017-03-07 2018-09-13 Bayer Cropscience Lp Hppd variants and methods of use
WO2018195256A1 (en) 2017-04-21 2018-10-25 Bayer Cropscience Lp Method of improving crop safety
WO2018219797A1 (en) 2017-06-02 2018-12-06 Basf Se Substituted oxadiazoles for combating phytopathogenic fungi
WO2019020283A1 (en) 2017-07-27 2019-01-31 Basf Se Use of herbicidal compositions based on l-glufosinate in tolerant field crops
WO2019068811A1 (en) 2017-10-06 2019-04-11 Bayer Aktiengesellschaft Compositions comprising fluopyram and tioxazafen
WO2019083808A1 (en) 2017-10-24 2019-05-02 Basf Se Improvement of herbicide tolerance to hppd inhibitors by down-regulation of putative 4-hydroxyphenylpyruvate reductases in soybean
WO2019083810A1 (en) 2017-10-24 2019-05-02 Basf Se Improvement of herbicide tolerance to 4-hydroxyphenylpyruvate dioxygenase (hppd) inhibitors by down-regulation of hppd expression in soybean
WO2019101511A1 (en) 2017-11-23 2019-05-31 Basf Se Substituted trifluoromethyloxadiazoles for combating phytopathogenic fungi
WO2019121143A1 (en) 2017-12-20 2019-06-27 Basf Se Substituted cyclopropyl derivatives
WO2019137995A1 (en) 2018-01-11 2019-07-18 Basf Se Novel pyridazine compounds for controlling invertebrate pests
WO2019219464A1 (en) 2018-05-15 2019-11-21 Basf Se Substituted trifluoromethyloxadiazoles for combating phytopathogenic fungi
WO2019224092A1 (en) 2018-05-22 2019-11-28 Basf Se Pesticidally active c15-derivatives of ginkgolides
WO2019233863A1 (en) 2018-06-04 2019-12-12 Bayer Aktiengesellschaft Herbicidally active bicyclic benzoylpyrazoles
EP3628158A1 (en) 2018-09-28 2020-04-01 Basf Se Pesticidal mixture comprising a mesoionic compound and a biopesticide
EP3643705A1 (en) 2018-10-24 2020-04-29 Basf Se Pesticidal compounds
WO2020083662A1 (en) 2018-10-23 2020-04-30 Basf Se Tricyclic pesticidal compounds
EP3670501A1 (en) 2018-12-17 2020-06-24 Basf Se Substituted [1,2,4]triazole compounds as fungicides
WO2020144308A1 (en) 2019-01-11 2020-07-16 Basf Se Crystalline forms of 1-(1,2-dimethylpropyl)-n-ethyl-5-methyl-n-pyridazin-4-yl-pyrazole-4-carboxamide
EP3696177A1 (en) 2019-02-12 2020-08-19 Basf Se Heterocyclic compounds for the control of invertebrate pests
EP3701796A1 (en) 2019-08-08 2020-09-02 Bayer AG Active compound combinations
EP3708565A1 (en) 2020-03-04 2020-09-16 Bayer AG Pyrimidinyloxyphenylamidines and the use thereof as fungicides
WO2020231751A1 (en) 2019-05-10 2020-11-19 Bayer Cropscience Lp Active compound combinations
WO2020239517A1 (en) 2019-05-29 2020-12-03 Basf Se Mesoionic imidazolium compounds and derivatives for combating animal pests
WO2020244968A1 (en) 2019-06-06 2020-12-10 Basf Se Fungicidal n-(pyrid-3-yl)carboxamides
WO2020244970A1 (en) 2019-06-06 2020-12-10 Basf Se New carbocyclic pyridine carboxamides
WO2020244969A1 (en) 2019-06-06 2020-12-10 Basf Se Pyridine derivatives and their use as fungicides
EP3769623A1 (en) 2019-07-22 2021-01-27 Basf Se Mesoionic imidazolium compounds and derivatives for combating animal pests
WO2021013720A1 (en) 2019-07-23 2021-01-28 Bayer Aktiengesellschaft Novel heteroaryl-triazole compounds as pesticides
WO2021013719A1 (en) 2019-07-23 2021-01-28 Bayer Aktiengesellschaft Novel heteroaryl-triazole compounds as pesticides
WO2021013721A1 (en) 2019-07-22 2021-01-28 Bayer Aktiengesellschaft 5-amino substituted pyrazoles and triazoles as pest control agents
WO2021013561A1 (en) 2019-07-19 2021-01-28 Basf Se Pesticidal pyrazole and triazole derivatives
WO2021022069A1 (en) 2019-08-01 2021-02-04 Bayer Cropscience Lp Method of improving cold stress tolerance and crop safety
WO2021058659A1 (en) 2019-09-26 2021-04-01 Bayer Aktiengesellschaft Rnai-mediated pest control
WO2021064075A1 (en) 2019-10-02 2021-04-08 Bayer Aktiengesellschaft Active compound combinations comprising fatty acids
WO2021063736A1 (en) 2019-10-02 2021-04-08 Basf Se Bicyclic pyridine derivatives
WO2021063735A1 (en) 2019-10-02 2021-04-08 Basf Se New bicyclic pyridine derivatives
WO2021069569A1 (en) 2019-10-09 2021-04-15 Bayer Aktiengesellschaft Novel heteroaryl-triazole compounds as pesticides
WO2021069567A1 (en) 2019-10-09 2021-04-15 Bayer Aktiengesellschaft Novel heteroaryl-triazole compounds as pesticides
WO2021089673A1 (en) 2019-11-07 2021-05-14 Bayer Aktiengesellschaft Substituted sulfonyl amides for controlling animal pests
WO2021097162A1 (en) 2019-11-13 2021-05-20 Bayer Cropscience Lp Beneficial combinations with paenibacillus
WO2021099271A1 (en) 2019-11-18 2021-05-27 Bayer Aktiengesellschaft Active compound combinations comprising fatty acids
WO2021099303A1 (en) 2019-11-18 2021-05-27 Bayer Aktiengesellschaft Novel heteroaryl-triazole compounds as pesticides
WO2021105091A1 (en) 2019-11-25 2021-06-03 Bayer Aktiengesellschaft Novel heteroaryl-triazole compounds as pesticides
US11034983B2 (en) 2004-04-16 2021-06-15 Monsanto Technology Llc Expression of fatty acid desaturases in corn
WO2021155084A1 (en) 2020-01-31 2021-08-05 Pairwise Plants Services, Inc. Suppression of shade avoidance response in plants
WO2021165195A1 (en) 2020-02-18 2021-08-26 Bayer Aktiengesellschaft Heteroaryl-triazole compounds as pesticides
WO2021211926A1 (en) 2020-04-16 2021-10-21 Pairwise Plants Services, Inc. Methods for controlling meristem size for crop improvement
WO2021209490A1 (en) 2020-04-16 2021-10-21 Bayer Aktiengesellschaft Cyclaminephenylaminoquinolines as fungicides
WO2021213978A1 (en) 2020-04-21 2021-10-28 Bayer Aktiengesellschaft 2-(het)aryl-substituted condensed heterocyclic derivatives as pest control agents
EP3903584A1 (en) 2020-04-28 2021-11-03 Basf Se Use of strobilurin type compounds for combating phytopathogenic fungi containing an amino acid substitution f129l in the mitochondrial cytochrome b protein conferring resistance to qo inhibitors iv
EP3903581A1 (en) 2020-04-28 2021-11-03 Basf Se Use of strobilurin type compounds for combating phytopathogenic fungi containing an amino acid substitution f129l in the mitochondrial cytochrome b protein conferring resistance to qo inhibitors i
EP3903583A1 (en) 2020-04-28 2021-11-03 Basf Se Use of strobilurin type compounds for combating phytopathogenic fungi containing an amino acid substitution f129l in the mitochondrial cytochrome b protein conferring resistance to qo inhibitors iii
EP3903582A1 (en) 2020-04-28 2021-11-03 Basf Se Use of strobilurin type compounds for combating phytopathogenic fungi containing an amino acid substitution f129l in the mitochondrial cytochrome b protein conferring resistance to qo inhibitors ii
WO2021219513A1 (en) 2020-04-28 2021-11-04 Basf Se Pesticidal compounds
WO2021224220A1 (en) 2020-05-06 2021-11-11 Bayer Aktiengesellschaft Pyridine (thio)amides as fungicidal compounds
WO2021224323A1 (en) 2020-05-06 2021-11-11 Bayer Aktiengesellschaft Novel heteroaryl-triazole compounds as pesticides
WO2021228734A1 (en) 2020-05-12 2021-11-18 Bayer Aktiengesellschaft Triazine and pyrimidine (thio)amides as fungicidal compounds
WO2021233861A1 (en) 2020-05-19 2021-11-25 Bayer Aktiengesellschaft Azabicyclic(thio)amides as fungicidal compounds
EP3915971A1 (en) 2020-12-16 2021-12-01 Bayer Aktiengesellschaft Phenyl-s(o)n-phenylamidines and the use thereof as fungicides
WO2021245087A1 (en) 2020-06-04 2021-12-09 Bayer Aktiengesellschaft Heterocyclyl pyrimidines and triazines as novel fungicides
WO2021247477A1 (en) 2020-06-02 2021-12-09 Pairwise Plants Services, Inc. Methods for controlling meristem size for crop improvement
WO2021249800A1 (en) 2020-06-10 2021-12-16 Basf Se Substituted [1,2,4]triazole compounds as fungicides
WO2021249995A1 (en) 2020-06-10 2021-12-16 Bayer Aktiengesellschaft Azabicyclyl-substituted heterocycles as fungicides
WO2021255089A1 (en) 2020-06-19 2021-12-23 Bayer Aktiengesellschaft 1,3,4-oxadiazole pyrimidines and 1,3,4-oxadiazole pyridines as fungicides
WO2021255071A1 (en) 2020-06-18 2021-12-23 Bayer Aktiengesellschaft 3-(pyridazin-4-yl)-5,6-dihydro-4h-1,2,4-oxadiazine derivatives as fungicides for crop protection
WO2021255118A1 (en) 2020-06-18 2021-12-23 Bayer Aktiengesellschaft Composition for use in agriculture
WO2021255170A1 (en) 2020-06-19 2021-12-23 Bayer Aktiengesellschaft 1,3,4-oxadiazole pyrimidines as fungicides
WO2021257775A1 (en) 2020-06-17 2021-12-23 Pairwise Plants Services, Inc. Methods for controlling meristem size for crop improvement
WO2021255169A1 (en) 2020-06-19 2021-12-23 Bayer Aktiengesellschaft 1,3,4-oxadiazole pyrimidines as fungicides
EP3929189A1 (en) 2020-06-25 2021-12-29 Bayer Animal Health GmbH Novel heteroaryl-substituted pyrazine derivatives as pesticides
WO2022002818A1 (en) 2020-07-02 2022-01-06 Bayer Aktiengesellschaft Heterocyclene derivatives as pest control agents
EP3939961A1 (en) 2020-07-16 2022-01-19 Basf Se Strobilurin type compounds and their use for combating phytopathogenic fungi
WO2022017836A1 (en) 2020-07-20 2022-01-27 BASF Agro B.V. Fungicidal compositions comprising (r)-2-[4-(4-chlorophenoxy)-2-(trifluoromethyl)phenyl]-1- (1,2,4-triazol-1-yl)propan-2-ol
EP3945089A1 (en) 2020-07-31 2022-02-02 Basf Se Use of strobilurin type compounds for combating phytopathogenic fungi containing an amino acid substitution f129l in the mitochondrial cytochrome b protein conferring resistance to qo inhibitors v
WO2022033991A1 (en) 2020-08-13 2022-02-17 Bayer Aktiengesellschaft 5-amino substituted triazoles as pest control agents
WO2022053453A1 (en) 2020-09-09 2022-03-17 Bayer Aktiengesellschaft Azole carboxamide as pest control agents
EP3970494A1 (en) 2020-09-21 2022-03-23 Basf Se Use of strobilurin type compounds for combating phytopathogenic fungi containing an amino acid substitution f129l in the mitochondrial cytochrome b protein conferring resistance to qo inhibitors viii
WO2022058327A1 (en) 2020-09-15 2022-03-24 Bayer Aktiengesellschaft Substituted ureas and derivatives as new antifungal agents
EP3974414A1 (en) 2020-09-25 2022-03-30 Bayer AG 5-amino substituted pyrazoles and triazoles as pesticides
WO2022090071A1 (en) 2020-11-02 2022-05-05 Basf Se Use of mefenpyr-diethyl for controlling phytopathogenic fungi
WO2022089969A1 (en) 2020-10-27 2022-05-05 BASF Agro B.V. Compositions comprising mefentrifluconazole
WO2022090069A1 (en) 2020-11-02 2022-05-05 Basf Se Compositions comprising mefenpyr-diethyl
WO2022129196A1 (en) 2020-12-18 2022-06-23 Bayer Aktiengesellschaft Heterobicycle substituted 1,2,4-oxadiazoles as fungicides
WO2022129190A1 (en) 2020-12-18 2022-06-23 Bayer Aktiengesellschaft (hetero)aryl substituted 1,2,4-oxadiazoles as fungicides
WO2022129200A1 (en) 2020-12-18 2022-06-23 Bayer Aktiengesellschaft Use of dhodh inhibitor for controlling resistant phytopathogenic fungi in crops
WO2022129188A1 (en) 2020-12-18 2022-06-23 Bayer Aktiengesellschaft 1,2,4-oxadiazol-3-yl pyrimidines as fungicides
EP4036083A1 (en) 2021-02-02 2022-08-03 Bayer Aktiengesellschaft 5-oxy substituted heterocycles as pesticides
EP4043444A1 (en) 2021-02-11 2022-08-17 Basf Se Substituted isoxazoline derivatives
WO2022173885A1 (en) 2021-02-11 2022-08-18 Pairwise Plants Services, Inc. Methods and compositions for modifying cytokinin oxidase levels in plants
WO2022182834A1 (en) 2021-02-25 2022-09-01 Pairwise Plants Services, Inc. Methods and compositions for modifying root architecture in plants
WO2022207496A1 (en) 2021-03-30 2022-10-06 Bayer Aktiengesellschaft 3-(hetero)aryl-5-chlorodifluoromethyl-1,2,4-oxadiazole as fungicide
WO2022207494A1 (en) 2021-03-30 2022-10-06 Bayer Aktiengesellschaft 3-(hetero)aryl-5-chlorodifluoromethyl-1,2,4-oxadiazole as fungicide
WO2022233777A1 (en) 2021-05-06 2022-11-10 Bayer Aktiengesellschaft Alkylamide substituted, annulated imidazoles and use thereof as insecticides
WO2022238391A1 (en) 2021-05-12 2022-11-17 Bayer Aktiengesellschaft 2-(het)aryl-substituted condensed heterocycle derivatives as pest control agents
EP4091451A1 (en) 2021-05-17 2022-11-23 BASF Agro B.V. Compositions comprising mefentrifluconazole
WO2022243111A1 (en) 2021-05-18 2022-11-24 Basf Se New substituted pyridines as fungicides
WO2022243107A1 (en) 2021-05-18 2022-11-24 Basf Se New substituted pyridines as fungicides
WO2022243109A1 (en) 2021-05-18 2022-11-24 Basf Se New substituted quinolines as fungicides
WO2022266271A1 (en) 2021-06-17 2022-12-22 Pairwise Plants Services, Inc. Modification of growth regulating factor family transcription factors in soybean
WO2022271892A1 (en) 2021-06-24 2022-12-29 Pairwise Plants Services, Inc. Modification of hect e3 ubiquitin ligase genes to improve yield traits
WO2023278651A1 (en) 2021-07-01 2023-01-05 Pairwise Plants Services, Inc. Methods and compositions for enhancing root system development
EP4119547A1 (en) 2021-07-12 2023-01-18 Basf Se Triazole compounds for the control of invertebrate pests
WO2023011958A1 (en) 2021-08-02 2023-02-09 Basf Se (3-pirydyl)-quinazoline
WO2023017120A1 (en) 2021-08-13 2023-02-16 Bayer Aktiengesellschaft Active compound combinations and fungicide compositions comprising those
WO2023019188A1 (en) 2021-08-12 2023-02-16 Pairwise Plants Services, Inc. Modification of brassinosteroid receptor genes to improve yield traits
WO2023023496A1 (en) 2021-08-17 2023-02-23 Pairwise Plants Services, Inc. Methods and compositions for modifying cytokinin receptor histidine kinase genes in plants
EP4140986A1 (en) 2021-08-23 2023-03-01 Basf Se Pyrazine compounds for the control of invertebrate pests
EP4140995A1 (en) 2021-08-27 2023-03-01 Basf Se Pyrazine compounds for the control of invertebrate pests
WO2023025682A1 (en) 2021-08-25 2023-03-02 Bayer Aktiengesellschaft Novel pyrazinyl-triazole compounds as pesticides
EP4144739A1 (en) 2021-09-02 2023-03-08 Bayer Aktiengesellschaft Anellated pyrazoles as parasiticides
WO2023034731A1 (en) 2021-08-30 2023-03-09 Pairwise Plants Services, Inc. Modification of ubiquitin binding peptidase genes in plants for yield trait improvement
WO2023034891A1 (en) 2021-09-02 2023-03-09 Pairwise Plants Services, Inc. Methods and compositions for improving plant architecture and yield traits
EP4151631A1 (en) 2021-09-20 2023-03-22 Basf Se Heterocyclic compounds for the control of invertebrate pests
WO2023049720A1 (en) 2021-09-21 2023-03-30 Pairwise Plants Services, Inc. Methods and compositions for reducing pod shatter in canola
WO2023060028A1 (en) 2021-10-04 2023-04-13 Pairwise Plants Services, Inc. Methods for improving floret fertility and seed yield
WO2023060152A2 (en) 2021-10-07 2023-04-13 Pairwise Plants Services, Inc. Methods for improving floret fertility and seed yield
WO2023072671A1 (en) 2021-10-28 2023-05-04 Basf Se Use of strobilurin type compounds for combating phytopathogenic fungi containing an amino acid substitution f129l in the mitochondrial cytochrome b protein conferring resistance to qo inhibitors ix
WO2023078915A1 (en) 2021-11-03 2023-05-11 Bayer Aktiengesellschaft Bis(hetero)aryl thioether (thio)amides as fungicidal compounds
WO2023099445A1 (en) 2021-11-30 2023-06-08 Bayer Aktiengesellschaft Bis(hetero)aryl thioether oxadiazines as fungicidal compounds
EP4194453A1 (en) 2021-12-08 2023-06-14 Basf Se Pyrazine compounds for the control of invertebrate pests
WO2023108035A1 (en) 2021-12-09 2023-06-15 Pairwise Plants Services, Inc. Methods for improving floret fertility and seed yield
EP4198033A1 (en) 2021-12-14 2023-06-21 Basf Se Heterocyclic compounds for the control of invertebrate pests
WO2023147526A1 (en) 2022-01-31 2023-08-03 Pairwise Plants Services, Inc. Suppression of shade avoidance response in plants
WO2023148028A1 (en) 2022-02-01 2023-08-10 Globachem Nv Methods and compositions for controlling pests
WO2023148030A1 (en) 2022-02-01 2023-08-10 Globachem Nv Methods and compositions for controlling pests in corn
WO2023156402A1 (en) 2022-02-17 2023-08-24 Basf Se Pesticidally active thiosemicarbazone compounds
WO2023168217A1 (en) 2022-03-02 2023-09-07 Pairwise Plants Services, Inc. Modification of brassinosteroid receptor genes to improve yield traits
WO2023192838A1 (en) 2022-03-31 2023-10-05 Pairwise Plants Services, Inc. Early flowering rosaceae plants with improved characteristics
WO2023196886A1 (en) 2022-04-07 2023-10-12 Pairwise Plants Services, Inc. Methods and compositions for improving resistance to fusarium head blight
WO2023205714A1 (en) 2022-04-21 2023-10-26 Pairwise Plants Services, Inc. Methods and compositions for improving yield traits
WO2023215809A1 (en) 2022-05-05 2023-11-09 Pairwise Plants Services, Inc. Methods and compositions for modifying root architecture and/or improving plant yield traits
WO2023213626A1 (en) 2022-05-03 2023-11-09 Bayer Aktiengesellschaft Use of (5s)-3-[3-(3-chloro-2-fluorophenoxy)-6-methylpyridazin-4-yl]-5-(2-chloro-4-methylbenzyl)-5,6-dihydro-4h-1,2,4-oxadiazine for controlling unwanted microorganisms
WO2023215704A1 (en) 2022-05-02 2023-11-09 Pairwise Plants Services, Inc. Methods and compositions for enhancing yield and disease resistance
WO2023213670A1 (en) 2022-05-03 2023-11-09 Bayer Aktiengesellschaft Crystalline forms of (5s)-3-[3-(3-chloro-2-fluorophenoxy)-6-methylpyridazin-4-yl]-5-(2-chloro-4-methylbenzyl)-5,6-dihydro-4h-1,2,4-oxadiazine
EP4295688A1 (en) 2022-09-28 2023-12-27 Bayer Aktiengesellschaft Active compound combination
WO2024006792A1 (en) 2022-06-29 2024-01-04 Pairwise Plants Services, Inc. Methods and compositions for controlling meristem size for crop improvement
WO2024006791A1 (en) 2022-06-29 2024-01-04 Pairwise Plants Services, Inc. Methods and compositions for controlling meristem size for crop improvement
WO2024006679A1 (en) 2022-06-27 2024-01-04 Pairwise Plants Services, Inc. Methods and compositions for modifying shade avoidance in plants
WO2024028243A1 (en) 2022-08-02 2024-02-08 Basf Se Pyrazolo pesticidal compounds
WO2024030984A1 (en) 2022-08-04 2024-02-08 Pairwise Plants Services, Inc. Methods and compositions for improving yield traits
WO2024036240A1 (en) 2022-08-11 2024-02-15 Pairwise Plants Services, Inc. Methods and compositions for controlling meristem size for crop improvement
WO2024054880A1 (en) 2022-09-08 2024-03-14 Pairwise Plants Services, Inc. Methods and compositions for improving yield characteristics in plants
EP4342885A1 (en) 2022-09-20 2024-03-27 Basf Se N-(3-(aminomethyl)-phenyl)-5-(4-phenyl)-5-(trifluoromethyl)-4,5-dihydroisoxazol-3-amine derivatives and similar compounds as pesticides
WO2024068517A1 (en) 2022-09-28 2024-04-04 Bayer Aktiengesellschaft 3-(hetero)aryl-5-chlorodifluoromethyl-1,2,4-oxadiazole as fungicide
WO2024068518A1 (en) 2022-09-28 2024-04-04 Bayer Aktiengesellschaft 3-heteroaryl-5-chlorodifluoromethyl-1,2,4-oxadiazole as fungicide
WO2024068520A1 (en) 2022-09-28 2024-04-04 Bayer Aktiengesellschaft 3-(hetero)aryl-5-chlorodifluoromethyl-1,2,4-oxadiazole as fungicide
WO2024068519A1 (en) 2022-09-28 2024-04-04 Bayer Aktiengesellschaft 3-(hetero)aryl-5-chlorodifluoromethyl-1,2,4-oxadiazole as fungicide

Families Citing this family (157)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7705215B1 (en) 1990-04-17 2010-04-27 Dekalb Genetics Corporation Methods and compositions for the production of stably transformed, fertile monocot plants and cells thereof
US6395966B1 (en) * 1990-08-09 2002-05-28 Dekalb Genetics Corp. Fertile transgenic maize plants containing a gene encoding the pat protein
US20040259145A1 (en) * 1999-03-11 2004-12-23 Marion Wood Compositions and methods for the modification of gene expression
CN101993907B (en) 2002-01-08 2018-12-28 迈克尔·R·拉尔布 Expressing CIVPS or the genetically modified plants of intein modified proteins and preparation method thereof
WO2005112597A2 (en) * 2004-05-19 2005-12-01 Agrivida, Inc. Transgenic plants expressing intein modified proteins and associated processes for bio-pharmaceutical production
CA2875402C (en) 2004-12-21 2021-09-28 Monsanto Technology Llc Transgenic plants with enhanced agronomic traits
ES2388548T3 (en) * 2005-04-08 2012-10-16 Bayer Cropscience Nv Elite event A2704-12 and methods and cases to identify this event in biological samples
EP2484769A3 (en) * 2005-12-21 2012-09-19 Monsanto Technology LLC Transgenic plants with enhanced agronomic traits
ES2526867T3 (en) 2008-11-20 2015-01-16 Novozymes Inc. Polypeptide having amylolytic enhancer activity and polynucleotides encoding it
US20110296557A1 (en) 2008-12-12 2011-12-01 Novozymes, Inc. Polypeptides Having Lipase Activity And Polynucleotides Encoding Same
US9493759B2 (en) 2008-12-12 2016-11-15 Novozymes, Inc. Polypeptides having aspartic endopeptidase activity and polynucleotides encoding same
US20110269206A1 (en) 2008-12-15 2011-11-03 Novozymes, Inc Polypeptides Having Catalase Activity And Polynucleotides Encoding Same
EP2379716A1 (en) 2008-12-16 2011-10-26 Novozymes Inc. Polypeptides having alpha-mannosidase activity and polynucleotides encoding same
US8633030B2 (en) 2008-12-16 2014-01-21 Novozymes, Inc. Polypeptides having carboxypeptidase activity and polynucleotides encoding same
US8604277B2 (en) 2009-01-28 2013-12-10 Novozymes, Inc. Polypeptides having beta-glucosidase activity and polynucleotides encoding same
WO2010088463A2 (en) 2009-01-30 2010-08-05 Novozymes, Inc. Polypeptides having expansin activity and polynucleotides encoding same
ES2534078T3 (en) 2009-06-02 2015-04-17 Novozymes Inc. Polypeptides with cellobiohydrolase activity and polynucleotides encoding them
CA2767169A1 (en) 2009-07-07 2011-01-13 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2011014458A1 (en) 2009-07-28 2011-02-03 Novozymes, Inc. Polypeptides having phytase activity and polynucleotides encoding same
WO2011035027A2 (en) 2009-09-17 2011-03-24 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
CN102712916B (en) 2009-09-18 2015-11-25 诺维信股份有限公司 There are the polypeptide of beta-glucosidase activity and the polynucleotide of this polypeptide of coding
WO2011050037A1 (en) 2009-10-23 2011-04-28 Novozymes, Inc. Cellobiohydrolase variants and polynucleotides encoding same
US20120260371A1 (en) 2009-10-29 2012-10-11 Novozymes A/S Polypeptides Having Cellobiohydrolase Activity and Polynucleotides Encoding Same
US9464333B2 (en) 2009-11-06 2016-10-11 Agrivida, Inc. Intein-modified enzymes, their production and industrial applications
US10407742B2 (en) 2009-11-06 2019-09-10 Agrivida, Inc. Intein-modified enzymes, their production and industrial applications
CN102639697B (en) 2009-11-06 2015-03-25 诺维信股份有限公司 Polypeptides having xylanase activity and polynucleotides encoding same
EP2496693B1 (en) 2009-11-06 2017-10-25 Novozymes, Inc. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
US8420387B2 (en) 2009-11-06 2013-04-16 Agrivida, Inc. Intein-modified enzymes, their production and industrial applications
CN102884183B (en) 2010-01-04 2015-09-16 诺维信公司 Be tending towards the stabilization of the α-amylase of calcium depletion and acid pH
CA2791353A1 (en) 2010-03-03 2011-09-09 Novozymes, Inc. Xylanase variants and polynucleotides encoding same
US8828701B2 (en) 2010-03-31 2014-09-09 Novozymes, Inc. Cellobiohydrolase variants and polynucleotides encoding same
MX338068B (en) 2010-04-14 2016-04-01 Novozymes As Polypeptides having glucoamylase activity and polynucleotides encoding same.
US8835604B2 (en) 2010-06-12 2014-09-16 Adenium Biotech Aos Antimicrobial peptide variants and polynucleotides encoding same
DK2769985T3 (en) 2010-06-21 2018-01-29 Novozymes Inc Polypeptides from Aspergillus aculeatus with C4 dicarboxylic acid transporter activity and polynucleotides encoding the same
US9598700B2 (en) 2010-06-25 2017-03-21 Agrivida, Inc. Methods and compositions for processing biomass with elevated levels of starch
US10443068B2 (en) 2010-06-25 2019-10-15 Agrivida, Inc. Plants with engineered endogenous genes
DK2588604T3 (en) 2010-06-30 2016-09-26 Novozymes Inc Polypeptides having beta-glucosidase activity and polynucleotides encoding them
EP2611901B1 (en) 2010-08-30 2016-05-11 Novozymes A/S Polypeptides having beta-glucosidase activity, beta-xylosidase activity, or beta-glucosidase and beta-xylosidase activity and polynucleotides encoding same
EP2611914A1 (en) 2010-08-30 2013-07-10 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012030811A1 (en) 2010-08-30 2012-03-08 Novozymes A/S Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2012030849A1 (en) 2010-08-30 2012-03-08 Novozymes A/S Polypeptides having xylanase activity and polynucleotides encoding same
US9267126B2 (en) 2010-08-30 2016-02-23 Novozymes, Inc. Polypeptides having endoglucanase activity and polynucleotides encoding same
US20130212746A1 (en) 2010-08-30 2013-08-15 Novoyzmes A/S Polypeptides Having Hemicellulolytic Activity And Polynucleotides Encoding Same
ES2599613T3 (en) 2010-09-30 2017-02-02 Novozymes, Inc. Variants of polypeptides that have cellulolytic enhancement activity and polynucleotides encoding them
CN103282489B (en) 2010-09-30 2016-12-14 诺维信股份有限公司 There is polypeptide variants and the coded polynucleotide thereof of cellulolytic enhancing activity
CA2809916A1 (en) 2010-10-01 2012-04-05 Novozymes A/S Polypeptides having endopeptidase activity and polynucleotides encoding same
MX2013002586A (en) 2010-10-01 2013-03-21 Novozymes Inc Beta-glucosidase variants and polynucleotides encoding same.
US8728804B2 (en) 2010-10-29 2014-05-20 Novozymes A/S Polypeptides having succinyl-CoA: acetoacetate transferase activity and polynucleotides encoding same
US9212354B2 (en) 2010-11-04 2015-12-15 Novozymes Inc. Polypeptides having cellobiohydrolase activitiy and polynucleotides encoding same
MX356647B (en) 2010-11-12 2018-06-07 Novozymes As Polypeptides having phospholipase c activity and polynucleotides encoding same.
US9139823B2 (en) 2010-11-12 2015-09-22 Novozymes, Inc. Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2012068509A1 (en) 2010-11-18 2012-05-24 Novozymes, Inc. Chimeric polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012103288A1 (en) 2011-01-26 2012-08-02 Novozymes A/S Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
US9506048B2 (en) 2011-01-26 2016-11-29 Novozymes, Inc. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
MX337942B (en) 2011-01-26 2016-03-29 Novozymes As Polypeptides having endoglucanase activity and polynucleotides encoding same.
MX2013007720A (en) 2011-01-26 2013-08-09 Novozymes As Polypeptides having cellobiohydrolase activity and polynucleotides encoding same.
WO2012103293A1 (en) 2011-01-26 2012-08-02 Novozymes A/S Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
EP2678352B1 (en) 2011-02-23 2017-12-06 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
CN106244622B (en) 2011-03-07 2020-06-12 谷万达公司 Expression cassette and expression vector for expressing multiple proteins in engineering plant, method for preparing engineering plant and method for producing soluble sugar
US9409958B2 (en) 2011-03-10 2016-08-09 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2012135719A1 (en) 2011-03-31 2012-10-04 Novozymes, Inc. Cellulose binding domain variants and polynucleotides encoding same
US9926547B2 (en) 2011-04-28 2018-03-27 Novozymes, Inc. Polypeptides having endoglucanase activity and polynucleotides encoding same
EA201490216A1 (en) 2011-07-06 2014-07-30 Новозимс А/С ALPHA-AMILASE VARIANTS AND THEIR POLYNUCLEOTIDE CODE
EP2732033A1 (en) 2011-07-15 2014-05-21 Novozymes A/S Lipase variants and polynucleotides encoding same
BR112014002405A2 (en) 2011-08-04 2017-04-04 Novozymes As isolated polypeptide and polynucleotide, composition, nucleic acid construct or expression vector, recombinant host cell, transgenic plant, part of the plant or plant cell, methods for making a polypeptide and a protein, and processes for degrading a cellulosic material, to produce a fermentation product, and to ferment a cellulosic material
BR112014002401B1 (en) 2011-08-04 2021-08-03 Novozymes A/S FILAMENTAL FUNGUS TRANSGENIC HOST CELL, METHODS FOR PRODUCING A POLYPEPTIDE AND A PROTEIN, AND, NUCLEIC ACID CONSTRUCT OR AN EXPRESSION VECTOR
WO2013021059A1 (en) 2011-08-10 2013-02-14 Novozymes A/S Polypeptides having peroxygenase activity and polynucleotides encoding same
WO2013021062A1 (en) 2011-08-10 2013-02-14 Novozymes A/S Polypeptides having peroxygenase activity and polynucleotides encoding same
WO2013021065A1 (en) 2011-08-10 2013-02-14 Novozymes A/S Polypeptides having peroxygenase activity and polynucleotides encoding same
WO2013021064A1 (en) 2011-08-10 2013-02-14 Novozymes A/S Polypeptides having peroxygenase activity and polynucleotides encoding same
CN103827297B (en) 2011-08-10 2018-06-22 诺维信公司 Polypeptide with peroxidase activity and the polynucleotides for encoding the polypeptide
US9506044B2 (en) 2011-08-10 2016-11-29 Novozymes A/S Polypeptides having peroxygenase activity and polynucleotides encoding same
CN103732740B (en) 2011-08-10 2018-07-31 诺维信公司 Polypeptide with peroxidase activity and the polynucleotides for encoding the polypeptide
WO2013024021A1 (en) 2011-08-15 2013-02-21 Novozymes A/S Polypeptides having cellulase activity and polynucleotides encoding same
US20140295027A1 (en) 2011-08-19 2014-10-02 Novozymes A/S Polypeptides Having Protease Activity
CA2846690A1 (en) 2011-08-26 2013-03-07 Novozymes A/S Polypeptides having glucoamylase activity and polynucleotides encoding same
WO2013043910A1 (en) 2011-09-20 2013-03-28 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
ES2628190T3 (en) 2011-09-22 2017-08-02 Novozymes A/S Polypeptides with protease activity and polynucleotides encoding them
US8728788B1 (en) 2011-09-30 2014-05-20 Novozymes A/S Dehydrogenase variants and polynucleotides encoding same
CN103930438A (en) 2011-09-30 2014-07-16 诺维信股份有限公司 Chimeric polypeptides having beta-glucosidase activity and polynucleotides encoding same
EP2773656B1 (en) 2011-10-31 2019-06-19 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
BR112014011902A2 (en) 2011-11-18 2017-05-16 Novozymes As isolated polypeptide and polynucleotide, recombinant host cell, methods for making a polypeptide, and for producing a parent cell mutant, processes for making a protein, for degrading or converting a cellulosic material or xylan-containing material, for producing a fermentation product, and to ferment a cellulosic material or xylan-containing material, and, integral broth formulation or cell culture composition
EP2802651B1 (en) 2011-11-21 2017-03-08 Novozymes, Inc. Gh61 polypeptide variants and polynucleotides encoding same
DK2782998T3 (en) 2011-11-22 2018-04-16 Novozymes Inc POLYPEPTIDES WITH BETA-XYLOSIDASE ACTIVITY AND POLYNUCLEOTIDES CODING THEM
CN107090445A (en) 2011-11-25 2017-08-25 诺维信公司 The polynucleotides of polypeptide and coding said polypeptide with lysozyme activity
EP2785732B1 (en) 2011-12-01 2017-04-12 Novozymes, Inc. Polypeptides having beta-xylosidase activity and polynucleotides encoding same
WO2013079533A1 (en) 2011-12-02 2013-06-06 Novozymes A/S Polypeptides having peroxygenase activity and polynucleotides encoding same
US9169469B2 (en) 2011-12-02 2015-10-27 Novozymes A/S Polypeptides having peroxygenase activity and polynucleotides encoding same
EP3272862A1 (en) 2011-12-16 2018-01-24 Novozymes, Inc. Polypeptides having laccase activity and polynucleotides encoding same
EP2794870A4 (en) 2011-12-19 2015-06-17 Novozymes Inc Polypeptides having catalase activity and polynucleotides encoding same
CA2878019A1 (en) 2011-12-20 2013-06-27 Novozymes, Inc. Cellobiohydrolase variants and polynucleotides encoding same
CN104024408B (en) 2011-12-28 2019-04-19 诺维信公司 Polypeptide with proteinase activity
EP2807254B1 (en) 2012-01-26 2017-08-02 Novozymes A/S Use of polypeptides having protease activity in animal feed and detergents
ES2794644T3 (en) 2012-02-03 2020-11-18 Novozymes As Lipase variants and polynucleotides that encode them
WO2013123871A1 (en) 2012-02-20 2013-08-29 Novozymes A/S Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2013149858A1 (en) 2012-04-02 2013-10-10 Novozymes A/S Lipase variants and polynucleotides encoding same
CN104245929A (en) 2012-04-23 2014-12-24 诺维信公司 Polypeptides having alpha-glucuronidase activity and polynucleotides encoding same
US9394556B2 (en) 2012-04-23 2016-07-19 Novozymes A/S Polypeptides having glucuronyl esterase activity and polynucleotides encoding same
CN113234695A (en) 2012-04-27 2021-08-10 诺维信股份有限公司 GH61 polypeptide variants and polynucleotides encoding same
WO2013178808A2 (en) 2012-05-31 2013-12-05 Novozymes A/S Polypeptides having organophosphorous hydrolase activity
MX364390B (en) 2012-06-20 2019-04-25 Novozymes As Use of polypeptides having protease activity in animal feed and detergents.
CN104471048B (en) 2012-07-12 2018-11-16 诺维信公司 Polypeptide with lipase active and the polynucleotides for encoding it
CN104540394A (en) 2012-08-17 2015-04-22 诺维信公司 Thermostable asparaginase variants and polynucleotides encoding same
CN104884615B (en) 2012-09-05 2019-07-12 诺维信公司 Polypeptide with proteinase activity
EP2903412B1 (en) 2012-10-08 2019-09-11 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
US9371394B2 (en) * 2012-10-10 2016-06-21 Dow Agrosciences Llc Monoclonal antibodies and detection methods for phosphinothricin-N-acetyl-transferase enzyme
EP2906688B1 (en) 2012-10-12 2018-08-29 Novozymes A/S Polypeptides having peroxygenase activity
US9499801B2 (en) 2012-10-12 2016-11-22 Novozymes A/S Polypeptides having peroxygenase activity
CN104718286B (en) 2012-10-12 2018-10-30 诺维信公司 With the active polypeptide of peroxygenases
WO2014056916A2 (en) 2012-10-12 2014-04-17 Novozymes A/S Polypeptides having peroxygenase activity
WO2014056920A2 (en) 2012-10-12 2014-04-17 Novozymes A/S Polypeptides having peroxygenase activity
WO2014056917A2 (en) 2012-10-12 2014-04-17 Novozymes A/S Polypeptides having peroxygenase activity
WO2014056919A2 (en) 2012-10-12 2014-04-17 Novozymes A/S Polypeptides having peroxygenase activity
US20150275194A1 (en) 2012-10-24 2015-10-01 Novozymes A/S Polypeptides Having Cellulolytic Enhancing Activity And Polynucleotides Encoding Same
WO2014093835A1 (en) 2012-12-14 2014-06-19 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
US9765317B2 (en) 2012-12-17 2017-09-19 Novozymes A/S Alpha-amylases and polynucleotides encoding same
WO2014099798A1 (en) 2012-12-19 2014-06-26 Novozymes A/S Polypeptides having cellulolytic enhancinc activity and polynucleotides encoding same
ES2655032T3 (en) 2012-12-21 2018-02-16 Novozymes A/S Polypeptides that possess protease activity and polynucleotides that encode them
EP2938628A4 (en) 2012-12-24 2016-10-19 Novozymes As Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2014122161A2 (en) 2013-02-06 2014-08-14 Novozymes A/S Polypeptides having protease activity
CN105164254B (en) 2013-03-08 2019-06-28 诺维信公司 Cellobiohydrolase variant and the polynucleotides for encoding them
MX360759B (en) 2013-03-21 2018-11-15 Novozymes As Polypeptides with lipase activity and polynucleotides encoding same.
WO2014170218A1 (en) 2013-04-18 2014-10-23 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
CN105209612A (en) 2013-05-14 2015-12-30 诺维信公司 Detergent compositions
EP3019603A1 (en) 2013-07-09 2016-05-18 Novozymes A/S Polypeptides with lipase activity and polynucleotides encoding same
WO2015022429A1 (en) 2013-08-15 2015-02-19 Novozymes A/S Polypeptides having beta-1,3-galactanase activity and polynucleotides encoding same
EP3074509B1 (en) 2013-11-29 2019-03-06 Novozymes A/S Peroxygenase variants
CA2950273C (en) 2014-05-30 2022-06-21 Novozymes A/S Variants of gh family 11 xylanase and polynucleotides encoding same
US11390898B2 (en) 2014-09-05 2022-07-19 Novozymes A/S Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
MX2017007103A (en) 2014-12-05 2017-08-24 Novozymes As Lipase variants and polynucleotides encoding same.
WO2016138167A2 (en) 2015-02-24 2016-09-01 Novozymes A/S Cellobiohydrolase variants and polynucleotides encoding same
CN116676293A (en) 2015-05-27 2023-09-01 国投生物科技投资有限公司 Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
US20180216089A1 (en) 2015-07-24 2018-08-02 Novozymes, Inc. Polypeptides Having Beta-Xylosidase Activity And Polynucleotides Encoding Same
WO2017070219A1 (en) 2015-10-20 2017-04-27 Novozymes A/S Lytic polysaccharide monooxygenase (lpmo) variants and polynucleotides encoding same
JP2019504625A (en) 2016-01-29 2019-02-21 ノボザイムス アクティーゼルスカブ β-glucanase variant and polynucleotide encoding the same
WO2017140807A1 (en) 2016-02-16 2017-08-24 Monaghan Mushrooms Group Fungal polypeptides having lysozyme activity
CN109415712A (en) 2016-03-02 2019-03-01 诺维信公司 Cellobiohydrolase variant and the polynucleotides for encoding them
DK3433358T3 (en) 2016-03-24 2022-09-26 Novozymes As Cellobiohydrolase variants and polynucleotides encoding them
WO2017205535A1 (en) 2016-05-27 2017-11-30 Novozymes, Inc. Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2018026868A1 (en) 2016-08-01 2018-02-08 Novozymes, Inc. Polypeptides having endoglucanase activity and polynucleotides encoding same
EP3550958A4 (en) * 2016-12-08 2020-10-07 Syngenta Participations AG Methods for improving transformation frequency
EP3676388A1 (en) 2017-08-31 2020-07-08 Novozymes A/S Polypeptides having d-psicose 3-epimerase activity and polynucleotides encoding same
US11332725B2 (en) 2017-09-27 2022-05-17 Novozymes A/S Lipase variants and microcapsule compositions comprising such lipase variants
US11725197B2 (en) 2017-12-04 2023-08-15 Novozymes A/S Lipase variants and polynucleotides encoding same
CN112272701A (en) 2018-04-19 2021-01-26 诺维信公司 Stabilized cellulase variants
EP3781680A1 (en) 2018-04-19 2021-02-24 Novozymes A/S Stabilized cellulase variants
EP3894551A1 (en) 2018-12-12 2021-10-20 Novozymes A/S Polypeptides having xylanase activity and polynucleotides encoding same
EP3908654A1 (en) 2019-01-11 2021-11-17 River Stone Biotech ApS Recombinant host cells with improved production of l-dopa, dopamine, (s)-norcoclaurine or derivatives thereof
WO2020239784A1 (en) 2019-05-27 2020-12-03 Octarine Bio Ivs Genetically modified host cells producing glycosylated cannabinoids.
WO2021163011A2 (en) 2020-02-10 2021-08-19 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
BR112023002578A2 (en) 2020-08-13 2023-03-14 Novozymes As PHYTASE VARIANTS AND POLYNUCLEOTIDES ENCODING THEM
BR112023008326A2 (en) 2020-10-29 2023-12-12 Novozymes As LIPASE VARIANTS AND COMPOSITIONS COMPRISING SUCH LIPASE VARIANTS
AU2022270929A1 (en) 2021-05-07 2023-10-19 River Stone Biotech Aps Glycosylated opioids
WO2023288294A1 (en) 2021-07-16 2023-01-19 Novozymes A/S Compositions and methods for improving the rainfastness of proteins on plant surfaces
WO2023152220A1 (en) 2022-02-10 2023-08-17 Novozymes A/S Improved expression of recombinant proteins
WO2023225459A2 (en) 2022-05-14 2023-11-23 Novozymes A/S Compositions and methods for preventing, treating, supressing and/or eliminating phytopathogenic infestations and infections
EP4273249A2 (en) 2023-07-07 2023-11-08 Novozymes A/S Improved expression of recombinant proteins

Citations (87)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4370160A (en) * 1978-06-27 1983-01-25 Dow Corning Corporation Process for preparing silicone microparticles
US4399216A (en) * 1980-02-25 1983-08-16 The Trustees Of Columbia University Processes for inserting DNA into eucaryotic cells and for producing proteinaceous materials
US4520113A (en) * 1984-04-23 1985-05-28 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Serological detection of antibodies to HTLV-III in sera of patients with AIDS and pre-AIDS conditions
US4535060A (en) * 1983-01-05 1985-08-13 Calgene, Inc. Inhibition resistant 5-enolpyruvyl-3-phosphoshikimate synthetase, production and use
US4536475A (en) * 1982-10-05 1985-08-20 Phytogen Plant vector
US4581847A (en) * 1984-09-04 1986-04-15 Molecular Genetics Research And Development Tryptophan overproducer mutants of cereal crops
US4634665A (en) * 1980-02-25 1987-01-06 The Trustees Of Columbia University In The City Of New York Processes for inserting DNA into eucaryotic cells and for producing proteinaceous materials
US4642411A (en) * 1984-09-04 1987-02-10 Molecular Genetics Research And Development Limited Partnership Tryptophan overproducer mutants of cereal crops
US4665030A (en) * 1984-09-07 1987-05-12 Sungene Technologies Corporation Process for regenerating corn
US4666844A (en) * 1984-09-07 1987-05-19 Sungene Technologies Corporation Process for regenerating cereals
US4683202A (en) * 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4708818A (en) * 1983-09-15 1987-11-24 Institut Pasteur Human immunodeficiency viruses associated with Acquired Immune Deficiency Syndrome (AIDS), a diagnostic method for AIDS and pre-AIDS, and a kit therefor
US4727028A (en) * 1981-06-22 1988-02-23 Eli Lilly And Company Recombinant DNA cloning vectors and the eukaryotic and prokaryotic transformants thereof
US4743548A (en) * 1984-09-25 1988-05-10 Calgene, Inc. Plant cell microinjection technique
US4761373A (en) * 1984-03-06 1988-08-02 Molecular Genetics, Inc. Herbicide resistance in plants
US4806483A (en) * 1986-08-18 1989-02-21 Sungene Technologies Corporation Process for regenerating corn
US4940835A (en) * 1985-10-29 1990-07-10 Monsanto Company Glyphosate-resistant plants
US4945050A (en) * 1984-11-13 1990-07-31 Cornell Research Foundation, Inc. Method for transporting substances into living cells and tissues and apparatus therefor
US4956282A (en) * 1985-07-29 1990-09-11 Calgene, Inc. Mammalian peptide expression in plant cells
US4971908A (en) * 1987-05-26 1990-11-20 Monsanto Company Glyphosate-tolerant 5-enolpyruvyl-3-phosphoshikimate synthase
US5001060A (en) * 1987-02-06 1991-03-19 Lubrizol Enterprises, Inc. Plant anaerobic regulatory element
US5004863A (en) * 1986-12-03 1991-04-02 Agracetus Genetic engineering of cotton plants and lines
US5013658A (en) * 1988-05-13 1991-05-07 Dna Plant Technology Corporation Transposon tagging of genes in transformed plants
US5015580A (en) * 1987-07-29 1991-05-14 Agracetus Particle-mediated transformation of soybean plants and lines
US5034322A (en) * 1983-01-17 1991-07-23 Monsanto Company Chimeric genes suitable for expression in plant cells
US5036006A (en) * 1984-11-13 1991-07-30 Cornell Research Foundation, Inc. Method for transporting substances into living cells and tissues and apparatus therefor
US5049500A (en) * 1987-01-13 1991-09-17 E. I. Du Pont De Nemours Pollen-mediated gene transformation in plants
US5082767A (en) * 1989-02-27 1992-01-21 Hatfield G Wesley Codon pair utilization
US5094945A (en) * 1983-01-05 1992-03-10 Calgene, Inc. Inhibition resistant 5-enolpyruvyl-3-phosphoshikimate synthase, production and use
US5097093A (en) * 1989-08-30 1992-03-17 Pioneer Hi-Bred International, Inc. Inbred corn line PHJ33
US5110732A (en) * 1989-03-14 1992-05-05 The Rockefeller University Selective gene expression in plants
US5134074A (en) * 1986-06-20 1992-07-28 Dekalb Plant Genetics Embryogenic callus and cell suspensions of corn inbred B73
US5145777A (en) * 1984-10-01 1992-09-08 The General Hospital Corporation Plant cells resistant to herbicidal glutamine synthetase inhibitors
US5177010A (en) * 1986-06-30 1993-01-05 University Of Toledo Process for transforming corn and the products thereof
US5187073A (en) * 1986-06-30 1993-02-16 The University Of Toledo Process for transforming gramineae and the products thereof
US5187267A (en) * 1990-06-19 1993-02-16 Calgene, Inc. Plant proteins, promoters, coding sequences and use
US5188958A (en) * 1986-05-29 1993-02-23 Calgene, Inc. Transformation and foreign gene expression in brassica species
US5188642A (en) * 1985-08-07 1993-02-23 Monsanto Company Glyphosate-resistant plants
US5196342A (en) * 1987-04-16 1993-03-23 Prutech R&D Partnership Ii Bacillus thuringiensis P-2 toxin gene
US5215912A (en) * 1986-08-29 1993-06-01 Lubrizol Genetics, Inc. Monocot seed storage proteins in dicots
US5231020A (en) * 1989-03-30 1993-07-27 Dna Plant Technology Corporation Genetic engineering of novel plant phenotypes
US5240841A (en) * 1985-03-21 1993-08-31 Duke University E. coli resistance to Qβ virus infection
US5250515A (en) * 1988-04-11 1993-10-05 Monsanto Company Method for improving the efficacy of insect toxins
US5254799A (en) * 1985-01-18 1993-10-19 Plant Genetic Systems N.V. Transformation vectors allowing expression of Bacillus thuringiensis endotoxins in plants
US5276268A (en) * 1986-08-23 1994-01-04 Hoechst Aktiengesellschaft Phosphinothricin-resistance gene, and its use
US5278325A (en) * 1986-04-23 1994-01-11 Strop Hans R Vegetable oil extraction process
US5290924A (en) * 1987-02-06 1994-03-01 Last David I Recombinant promoter for gene expression in monocotyledonous plants
US5302523A (en) * 1989-06-21 1994-04-12 Zeneca Limited Transformation of plant cells
US5310667A (en) * 1989-07-17 1994-05-10 Monsanto Company Glyphosate-tolerant 5-enolpyruvyl-3-phosphoshikimate synthases
US5350689A (en) * 1987-05-20 1994-09-27 Ciba-Geigy Corporation Zea mays plants and transgenic Zea mays plants regenerated from protoplasts or protoplast-derived cells
US5352605A (en) * 1983-01-17 1994-10-04 Monsanto Company Chimeric genes for transforming plant cells using viral promoters
US5380831A (en) * 1986-04-04 1995-01-10 Mycogen Plant Science, Inc. Synthetic insecticidal crystal protein gene
US5384253A (en) * 1990-12-28 1995-01-24 Dekalb Genetics Corporation Genetic transformation of maize cells by electroporation of cells pretreated with pectin degrading enzymes
US5405765A (en) * 1991-08-23 1995-04-11 University Of Florida Method for the production of transgenic wheat plants
US5422254A (en) * 1992-02-14 1995-06-06 Oy Alko Ab Method to increase the trehalose content of organisms by transforming them with the structural genes for the short and long chains of yeast trehalose synthase
US5436389A (en) * 1991-02-21 1995-07-25 Dekalb Genetics Corp. Hybrid genetic complement and corn plant DK570
US5436393A (en) * 1988-12-21 1995-07-25 Institut fur Genbiologische Potato tuber specific transcriptional regulation
US5451513A (en) * 1990-05-01 1995-09-19 The State University of New Jersey Rutgers Method for stably transforming plastids of multicellular plants
US5484956A (en) * 1990-01-22 1996-01-16 Dekalb Genetics Corporation Fertile transgenic Zea mays plant comprising heterologous DNA encoding Bacillus thuringiensis endotoxin
US5489520A (en) * 1990-04-17 1996-02-06 Dekalb Genetics Corporation Process of producing fertile transgenic zea mays plants and progeny comprising a gene encoding phosphinothricin acetyl transferase
US5491288A (en) * 1991-03-05 1996-02-13 Rhone Poulenc Agrochimie Chimeric gene comprising the arabidopsis histone H4 promoter for the transformation of plants
US5495071A (en) * 1987-04-29 1996-02-27 Monsanto Company Insect resistant tomato and potato plants
US5500365A (en) * 1989-02-24 1996-03-19 Monsanto Company Synthetic plant genes
US5508468A (en) * 1990-01-22 1996-04-16 Dekalb Genetics Corporation Fertile transgenic corn plants
US5516668A (en) * 1992-03-24 1996-05-14 Japan Tobacco Inc. Method for decreasing seed storage proteins and for transforming plants
US5545545A (en) * 1993-04-27 1996-08-13 Regents Of The University Of Minnesota Lysine-insensitive maize dihydrodipicolinic acid synthase
US5559223A (en) * 1991-08-09 1996-09-24 E. I. Dupont De Nemours And Company Synthetic storage proteins with defined structure containing programmable levels of essential amino acids for improvement of the nutritional value of plants
US5561236A (en) * 1986-03-11 1996-10-01 Plant Genetic Systems Genetically engineered plant cells and plants exhibiting resistance to glutamine synthetase inhibitors, DNA fragments and recombinants for use in the production of said cells and plants
US5563324A (en) * 1991-05-09 1996-10-08 The Arizona Board Of Regents On Behalf Of The University Of Arizona Transgenic plants with altered polyol content
US5565347A (en) * 1986-06-10 1996-10-15 Calgene, Inc. Transformation and foreign gene expression with plant species
US5567600A (en) * 1983-09-26 1996-10-22 Mycogen Plant Sciences, Inc. Synthetic insecticidal crystal protein gene
US5591616A (en) * 1992-07-07 1997-01-07 Japan Tobacco, Inc. Method for transforming monocotyledons
US5593963A (en) * 1990-09-21 1997-01-14 Mogen International Expression of phytase in plants
US5596131A (en) * 1988-03-08 1997-01-21 Ciba-Geigy Corporation Regeneration of graminaceous plants of the subfamily pooideae from protoplasts
US5623067A (en) * 1987-10-20 1997-04-22 Plant Genetic Systems, N.V. Seed-specific promoter region
US5625136A (en) * 1991-10-04 1997-04-29 Ciba-Geigy Corporation Synthetic DNA sequence having enhanced insecticidal activity in maize
US5641876A (en) * 1990-01-05 1997-06-24 Cornell Research Foundation, Inc. Rice actin gene and promoter
US5641664A (en) * 1990-11-23 1997-06-24 Plant Genetic Systems, N.V. Process for transforming monocotyledonous plants
US5677474A (en) * 1988-07-29 1997-10-14 Washington University Producing commercially valuable polypeptides with genetically transformed endosperm tissue
US5743477A (en) * 1992-08-27 1998-04-28 Dowelanco Insecticidal proteins and method for plant protection
US5773691A (en) * 1992-03-19 1998-06-30 E. I. Du Pont De Nemours And Company Chimeric genes and methods for increasing the lysine and threonine content of the seeds of plants
US5780709A (en) * 1993-08-25 1998-07-14 Dekalb Genetics Corporation Transgenic maize with increased mannitol content
US5886244A (en) * 1988-06-10 1999-03-23 Pioneer Hi-Bred International, Inc. Stable transformation of plant cells
US6013863A (en) * 1990-01-22 2000-01-11 Dekalb Genetics Corporation Fertile transgenic corn plants
US6022846A (en) * 1990-09-21 2000-02-08 Mogen International And Gist-Brocades N.V. Expression of phytase in plants
US6025545A (en) * 1990-01-22 2000-02-15 Dekalb Genetics Corporation Methods and compositions for the production of stably transformed, fertile monocot plants and cells thereof
US6395966B1 (en) * 1990-08-09 2002-05-28 Dekalb Genetics Corp. Fertile transgenic maize plants containing a gene encoding the pat protein

Family Cites Families (65)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4583320A (en) 1982-10-12 1986-04-22 Plant Genetics, Inc. Delivery system for meristematic tissue
EP0131623B2 (en) 1983-01-17 1999-07-28 Monsanto Company Chimeric genes suitable for expression in plant cells
NL8300698A (en) 1983-02-24 1984-09-17 Univ Leiden METHOD FOR BUILDING FOREIGN DNA INTO THE NAME OF DIABIC LOBAL PLANTS; AGROBACTERIUM TUMEFACIENS BACTERIA AND METHOD FOR PRODUCTION THEREOF; PLANTS AND PLANT CELLS WITH CHANGED GENETIC PROPERTIES; PROCESS FOR PREPARING CHEMICAL AND / OR PHARMACEUTICAL PRODUCTS.
US4559301A (en) 1983-03-03 1985-12-17 Eli Lilly And Company Process for preparing macrocin derivatives
US6943282B1 (en) 1983-09-26 2005-09-13 Mycogen Plant Science, Inc. Insect resistant plants
AU567155B2 (en) 1983-04-15 1987-11-12 Damon Biotech Inc. Capsules for releasing core material at constant rate
BR8404834A (en) 1983-09-26 1985-08-13 Agrigenetics Res Ass METHOD TO GENETICALLY MODIFY A PLANT CELL
EP0154204B1 (en) 1984-03-06 1994-01-12 Mgi Pharma, Inc. Herbicide resistance in plants
EP0160390A3 (en) 1984-04-16 1987-04-08 Sandoz Ltd. Embryogenic callus and cell suspension of inbred corn
ATE73845T1 (en) 1984-05-11 1992-04-15 Ciba Geigy Ag TRANSFORMATION OF PLANT HERITAGE.
EP0189707B1 (en) 1984-12-28 1993-08-25 Plant Genetic Systems N.V. Recombinant dna which can be introduced into plant cells
BR8600161A (en) 1985-01-18 1986-09-23 Plant Genetic Systems Nv CHEMICAL GENE, HYBRID, INTERMEDIATE PLASMIDIO VECTORS, PROCESS TO CONTROL INSECTS IN AGRICULTURE OR HORTICULTURE, INSECTICIDE COMPOSITION, PROCESS TO TRANSFORM PLANT CELLS TO EXPRESS A PLANTINIDE TOXIN, PRODUCED BY CULTURES, UNITED BY BACILLA
US5580716A (en) 1985-03-21 1996-12-03 Stephen A. Johnston Parasite-derived resistance
JPS61265086A (en) 1985-05-21 1986-11-22 Mitsui Toatsu Chem Inc Method of cultivating protoplast
US4935340A (en) 1985-06-07 1990-06-19 Eli Lilly And Company Method of isolating antibiotic biosynthetic genes
US4886878A (en) 1985-06-12 1989-12-12 Lubrizol Genetics, Inc. Modified zein genes containing lysine
US4885357A (en) 1985-06-12 1989-12-05 Lubrizol Genetics Inc. Modified zein proteins containing lysine
JPS63123325A (en) 1986-08-14 1988-05-27 マックス−プランク−ゲゼルシャフト・ツア・フェルデルング・デア・ヴィッセンシャフテン・エ−・ファウ Transgenic monocot,its seed and preparation of plant
US5273894A (en) 1986-08-23 1993-12-28 Hoechst Aktiengesellschaft Phosphinothricin-resistance gene, and its use
US5003045A (en) 1986-08-29 1991-03-26 Lubrizol Genetics, Inc. Modified 7S legume seed storage proteins
AU596460B2 (en) 1986-10-01 1990-05-03 Plant Cell Research Institute, Inc., The Methods for controlled regeneration of cucumis sp. plants in vitro from explant tissue
EP0267159A3 (en) 1986-11-07 1990-05-02 Ciba-Geigy Ag Process for the genetic modification of monocotyledonous plants
US5268463A (en) 1986-11-11 1993-12-07 Jefferson Richard A Plant promoter α-glucuronidase gene construct
EP0269601B2 (en) 1986-11-20 2000-07-12 Monsanto Company Insect-resistant tomato plants
IL84459A (en) 1986-12-05 1993-07-08 Agracetus Apparatus and method for the injection of carrier particles carrying genetic material into living cells
JPS63192383A (en) 1986-12-08 1988-08-09 サンジェン・テクノロジーズ・コーポレイション Method for increasing free pool lisine content in corn
EP0275069A3 (en) 1987-01-13 1990-04-25 DNA PLANT TECHNOLOGY CORPORATION (under the laws of the state of Delaware) Pollen-mediated gene transformation in plants
CH670655A5 (en) 1987-01-29 1989-06-30 Inst Botan Im N G Kholodnogo A
US4753035A (en) 1987-02-04 1988-06-28 Dow Corning Corporation Crosslinked silicone coatings for botanical seeds
JPH0822224B2 (en) 1987-02-09 1996-03-06 三井石油化学工業株式会社 Plant tissue culture method
US5371003A (en) 1987-05-05 1994-12-06 Sandoz Ltd. Electrotransformation process
IL86245A (en) 1987-05-05 1995-01-24 Sandoz Ag Method for transforming plant material and plants obtained thereby
DE3716309A1 (en) 1987-05-15 1988-11-24 Hoechst Ag RESISTANCE TO PHOSPHINOTHRICIN
EP0292435B1 (en) * 1987-05-20 1995-07-26 Ciba-Geigy Ag Zea mays plants and transgenic zea mays plants regenerated from protoplasts or protoplast-derived cells
NL8701450A (en) 1987-06-22 1989-01-16 Solvay METHOD FOR TRANSFORMING CELLS.
EP0331855B1 (en) 1988-02-29 1995-03-08 E.I. DU PONT DE NEMOURS &amp; COMPANY, INC. Apparatus for delivering substances into cells and tissues in a non-lethal manner
EP0331083A3 (en) 1988-03-02 1990-11-28 Schweizerische Eidgenossenschaft Eidgenössische Technische Hochschule (Eth) Method for the production of transgenic plants
GB8806643D0 (en) 1988-03-21 1988-04-20 Ici Plc Genetic manipulation
NZ228320A (en) 1988-03-29 1991-06-25 Du Pont Nucleic acid promoter fragments of the promoter region homologous to the em gene of wheat, dna constructs therefrom and plants thereof
GB8810120D0 (en) 1988-04-28 1988-06-02 Plant Genetic Systems Nv Transgenic nuclear male sterile plants
WO1989012102A1 (en) * 1988-06-01 1989-12-14 The Texas A&M University System Method for transforming plants via the shoot apex
NL8801444A (en) 1988-06-06 1990-01-02 Solvay Genetic transformation of eukaryotic cells - esp. plant cells, by treating dried cells with DNA soln.
US5258300A (en) 1988-06-09 1993-11-02 Molecular Genetics Research And Development Limited Partnership Method of inducing lysine overproduction in plants
EP0348348B1 (en) 1988-06-20 2000-08-09 Novartis AG Process for controlling plant pests with the help of non-plant-derived proteinase-inhibitors
GB8818706D0 (en) 1988-08-05 1988-09-07 Ici Plc Dna constructs & plants incorporating them
EP0359617A3 (en) 1988-09-02 1990-04-04 Plant Genetic Systems, N.V. Stress-tolerant plants
NZ230375A (en) 1988-09-09 1991-07-26 Lubrizol Genetics Inc Synthetic gene encoding b. thuringiensis insecticidal protein
EP0360750A3 (en) 1988-09-22 1991-01-02 Ciba-Geigy Ag Novel herbicide tolerant plants
US5693507A (en) 1988-09-26 1997-12-02 Auburn University Genetic engineering of plant chloroplasts
US5589615A (en) 1988-10-14 1996-12-31 Plant Genetic Systems N.V. Process for the production of transgenic plants with increased nutritional value via the expression of modified 2S storage albumins
US5232779A (en) 1989-04-17 1993-08-03 Ecco Gleittechnik Gmbh Reinforcement fibers and/or process fibers based on plant fibers, method for their production, and their use
EP0400246A1 (en) 1989-05-31 1990-12-05 Plant Genetic Systems, N.V. Prevention of Bt resistance development
CZ289014B6 (en) 1989-09-27 2001-10-17 Dsm N. V. Purified and isolated DNA sequence encoding fungal phytase, construct for expression, vectors and transformed host cells as well as phytase preparation process
US5322783A (en) 1989-10-17 1994-06-21 Pioneer Hi-Bred International, Inc. Soybean transformation by microparticle bombardment
EP0434616B1 (en) 1989-12-19 1995-11-15 Ciba-Geigy Ag Method and appliance for the genetic transformation of cells
US6777589B1 (en) 1990-01-22 2004-08-17 Dekalb Genetics Corporation Methods and compositions for the production of stably transformed, fertile monocot plants and cells thereof
EP0442175A1 (en) 1990-02-13 1991-08-21 Pioneer Hi-Bred International, Inc. Plants with increased tissue culture and regeneration potential
ATE225853T1 (en) 1990-04-12 2002-10-15 Syngenta Participations Ag TISSUE-SPECIFIC PROMOTORS
DE4013099A1 (en) 1990-04-25 1991-10-31 Hoechst Ag Transforming immature somatic plant, esp. maize, embryos - by treating, in dry state, with nucleic acid soln., esp. for introducing resistance to phosphinothricin
DK0459643T3 (en) 1990-05-18 2001-01-02 Commw Scient Ind Res Org Recombinant promoter for gene expression in monocotyledonous plants
ES2213740T3 (en) 1990-06-23 2004-09-01 Bayer Cropscience Gmbh FERTILE PLANTS OF TRANSGENIZED CORN WITH AN AJENO GEN AND AS A PROCEDURE FOR THEIR PRODUCTION.
AU643563B2 (en) 1990-11-01 1993-11-18 Sapporo Breweries Limited Method for preparing transformed plant
US5367110A (en) 1990-11-13 1994-11-22 Yeda Research And Development Co. Ltd. Transgenic plants overproducing threonine and lysine
EP0589110A1 (en) 1992-08-19 1994-03-30 Plant Genetic Systems N.V. Control of ostrinia
EP0620281A3 (en) 1993-03-31 1995-05-03 Mitsubishi Corp Oilseed crops producing valuable seeds having altered amino acid composition and fatty acid composition.

Patent Citations (102)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4370160A (en) * 1978-06-27 1983-01-25 Dow Corning Corporation Process for preparing silicone microparticles
US4634665A (en) * 1980-02-25 1987-01-06 The Trustees Of Columbia University In The City Of New York Processes for inserting DNA into eucaryotic cells and for producing proteinaceous materials
US4399216A (en) * 1980-02-25 1983-08-16 The Trustees Of Columbia University Processes for inserting DNA into eucaryotic cells and for producing proteinaceous materials
US4727028A (en) * 1981-06-22 1988-02-23 Eli Lilly And Company Recombinant DNA cloning vectors and the eukaryotic and prokaryotic transformants thereof
US4536475A (en) * 1982-10-05 1985-08-20 Phytogen Plant vector
US5094945A (en) * 1983-01-05 1992-03-10 Calgene, Inc. Inhibition resistant 5-enolpyruvyl-3-phosphoshikimate synthase, production and use
US4535060A (en) * 1983-01-05 1985-08-13 Calgene, Inc. Inhibition resistant 5-enolpyruvyl-3-phosphoshikimate synthetase, production and use
US5034322A (en) * 1983-01-17 1991-07-23 Monsanto Company Chimeric genes suitable for expression in plant cells
US5352605A (en) * 1983-01-17 1994-10-04 Monsanto Company Chimeric genes for transforming plant cells using viral promoters
US4708818A (en) * 1983-09-15 1987-11-24 Institut Pasteur Human immunodeficiency viruses associated with Acquired Immune Deficiency Syndrome (AIDS), a diagnostic method for AIDS and pre-AIDS, and a kit therefor
US5567600A (en) * 1983-09-26 1996-10-22 Mycogen Plant Sciences, Inc. Synthetic insecticidal crystal protein gene
US5567862A (en) * 1983-09-26 1996-10-22 Mycogen Plant Sciences, Inc. Synthetic insecticidal crystal protein gene
US4761373A (en) * 1984-03-06 1988-08-02 Molecular Genetics, Inc. Herbicide resistance in plants
US4520113A (en) * 1984-04-23 1985-05-28 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Serological detection of antibodies to HTLV-III in sera of patients with AIDS and pre-AIDS conditions
US4581847A (en) * 1984-09-04 1986-04-15 Molecular Genetics Research And Development Tryptophan overproducer mutants of cereal crops
US4642411A (en) * 1984-09-04 1987-02-10 Molecular Genetics Research And Development Limited Partnership Tryptophan overproducer mutants of cereal crops
US4665030A (en) * 1984-09-07 1987-05-12 Sungene Technologies Corporation Process for regenerating corn
US4666844A (en) * 1984-09-07 1987-05-19 Sungene Technologies Corporation Process for regenerating cereals
US4743548A (en) * 1984-09-25 1988-05-10 Calgene, Inc. Plant cell microinjection technique
US5145777A (en) * 1984-10-01 1992-09-08 The General Hospital Corporation Plant cells resistant to herbicidal glutamine synthetase inhibitors
US5036006A (en) * 1984-11-13 1991-07-30 Cornell Research Foundation, Inc. Method for transporting substances into living cells and tissues and apparatus therefor
US4945050A (en) * 1984-11-13 1990-07-31 Cornell Research Foundation, Inc. Method for transporting substances into living cells and tissues and apparatus therefor
US5254799A (en) * 1985-01-18 1993-10-19 Plant Genetic Systems N.V. Transformation vectors allowing expression of Bacillus thuringiensis endotoxins in plants
US5240841A (en) * 1985-03-21 1993-08-31 Duke University E. coli resistance to Qβ virus infection
US4683202A (en) * 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4683202B1 (en) * 1985-03-28 1990-11-27 Cetus Corp
US4956282A (en) * 1985-07-29 1990-09-11 Calgene, Inc. Mammalian peptide expression in plant cells
US5188642A (en) * 1985-08-07 1993-02-23 Monsanto Company Glyphosate-resistant plants
US4940835A (en) * 1985-10-29 1990-07-10 Monsanto Company Glyphosate-resistant plants
US5561236A (en) * 1986-03-11 1996-10-01 Plant Genetic Systems Genetically engineered plant cells and plants exhibiting resistance to glutamine synthetase inhibitors, DNA fragments and recombinants for use in the production of said cells and plants
US5380831A (en) * 1986-04-04 1995-01-10 Mycogen Plant Science, Inc. Synthetic insecticidal crystal protein gene
US5278325A (en) * 1986-04-23 1994-01-11 Strop Hans R Vegetable oil extraction process
US5188958A (en) * 1986-05-29 1993-02-23 Calgene, Inc. Transformation and foreign gene expression in brassica species
US5565347A (en) * 1986-06-10 1996-10-15 Calgene, Inc. Transformation and foreign gene expression with plant species
US5134074A (en) * 1986-06-20 1992-07-28 Dekalb Plant Genetics Embryogenic callus and cell suspensions of corn inbred B73
US5177010A (en) * 1986-06-30 1993-01-05 University Of Toledo Process for transforming corn and the products thereof
US5187073A (en) * 1986-06-30 1993-02-16 The University Of Toledo Process for transforming gramineae and the products thereof
US6020539A (en) * 1986-06-30 2000-02-01 Goldman; Stephen L. Process for transforming Gramineae and the products thereof
US4806483A (en) * 1986-08-18 1989-02-21 Sungene Technologies Corporation Process for regenerating corn
US5276268A (en) * 1986-08-23 1994-01-04 Hoechst Aktiengesellschaft Phosphinothricin-resistance gene, and its use
US5215912A (en) * 1986-08-29 1993-06-01 Lubrizol Genetics, Inc. Monocot seed storage proteins in dicots
US5004863B2 (en) * 1986-12-03 2000-10-17 Agracetus Genetic engineering of cotton plants and lines
US5004863A (en) * 1986-12-03 1991-04-02 Agracetus Genetic engineering of cotton plants and lines
US5004863B1 (en) * 1986-12-03 1992-12-08 Agracetus
US5049500A (en) * 1987-01-13 1991-09-17 E. I. Du Pont De Nemours Pollen-mediated gene transformation in plants
US5001060A (en) * 1987-02-06 1991-03-19 Lubrizol Enterprises, Inc. Plant anaerobic regulatory element
US5290924A (en) * 1987-02-06 1994-03-01 Last David I Recombinant promoter for gene expression in monocotyledonous plants
US5196342A (en) * 1987-04-16 1993-03-23 Prutech R&D Partnership Ii Bacillus thuringiensis P-2 toxin gene
US5495071A (en) * 1987-04-29 1996-02-27 Monsanto Company Insect resistant tomato and potato plants
US5350689A (en) * 1987-05-20 1994-09-27 Ciba-Geigy Corporation Zea mays plants and transgenic Zea mays plants regenerated from protoplasts or protoplast-derived cells
US5595733A (en) * 1987-05-20 1997-01-21 Ciba-Geigy Corporation Methods for protecting ZEA mays plants against pest damage
US4971908A (en) * 1987-05-26 1990-11-20 Monsanto Company Glyphosate-tolerant 5-enolpyruvyl-3-phosphoshikimate synthase
US5015580A (en) * 1987-07-29 1991-05-14 Agracetus Particle-mediated transformation of soybean plants and lines
US5623067A (en) * 1987-10-20 1997-04-22 Plant Genetic Systems, N.V. Seed-specific promoter region
US5596131A (en) * 1988-03-08 1997-01-21 Ciba-Geigy Corporation Regeneration of graminaceous plants of the subfamily pooideae from protoplasts
US5250515A (en) * 1988-04-11 1993-10-05 Monsanto Company Method for improving the efficacy of insect toxins
US5013658A (en) * 1988-05-13 1991-05-07 Dna Plant Technology Corporation Transposon tagging of genes in transformed plants
US5886244A (en) * 1988-06-10 1999-03-23 Pioneer Hi-Bred International, Inc. Stable transformation of plant cells
US6258999B1 (en) * 1988-06-10 2001-07-10 Pioneer Hi-Bred International, Inc. Stable transformation of plant cells
US5677474A (en) * 1988-07-29 1997-10-14 Washington University Producing commercially valuable polypeptides with genetically transformed endosperm tissue
US5436393A (en) * 1988-12-21 1995-07-25 Institut fur Genbiologische Potato tuber specific transcriptional regulation
US5500365A (en) * 1989-02-24 1996-03-19 Monsanto Company Synthetic plant genes
US5082767A (en) * 1989-02-27 1992-01-21 Hatfield G Wesley Codon pair utilization
US5110732A (en) * 1989-03-14 1992-05-05 The Rockefeller University Selective gene expression in plants
US5231020A (en) * 1989-03-30 1993-07-27 Dna Plant Technology Corporation Genetic engineering of novel plant phenotypes
US5302523A (en) * 1989-06-21 1994-04-12 Zeneca Limited Transformation of plant cells
US5310667A (en) * 1989-07-17 1994-05-10 Monsanto Company Glyphosate-tolerant 5-enolpyruvyl-3-phosphoshikimate synthases
US5097093A (en) * 1989-08-30 1992-03-17 Pioneer Hi-Bred International, Inc. Inbred corn line PHJ33
US5641876A (en) * 1990-01-05 1997-06-24 Cornell Research Foundation, Inc. Rice actin gene and promoter
US5508468A (en) * 1990-01-22 1996-04-16 Dekalb Genetics Corporation Fertile transgenic corn plants
US6025545A (en) * 1990-01-22 2000-02-15 Dekalb Genetics Corporation Methods and compositions for the production of stably transformed, fertile monocot plants and cells thereof
US5554798A (en) * 1990-01-22 1996-09-10 Dekalb Genetics Corporation Fertile glyphosate-resistant transgenic corn plants
US6013863A (en) * 1990-01-22 2000-01-11 Dekalb Genetics Corporation Fertile transgenic corn plants
US5538880A (en) * 1990-01-22 1996-07-23 Dekalb Genetics Corporation Method for preparing fertile transgenic corn plants
US5780708A (en) * 1990-01-22 1998-07-14 Dekalb Genetics Corporation Fertile transgenic corn plants
US5538877A (en) * 1990-01-22 1996-07-23 Dekalb Genetics Corporation Method for preparing fertile transgenic corn plants
US5484956A (en) * 1990-01-22 1996-01-16 Dekalb Genetics Corporation Fertile transgenic Zea mays plant comprising heterologous DNA encoding Bacillus thuringiensis endotoxin
US5919675A (en) * 1990-04-17 1999-07-06 Dekalb Genetics Corporation Methods and compositions for the production of stably transformed, fertile monocot plants and cells thereof
US5874265A (en) * 1990-04-17 1999-02-23 Dekalb Genetics Corporation Methods and compositions for the production of stably transformed fertile monocot plants and cells thereof
US5969213A (en) * 1990-04-17 1999-10-19 Dekalb Genetics Corporation Methods and compositions for the production of stably transformed fertile monocot plants and cells thereof
US5550318A (en) * 1990-04-17 1996-08-27 Dekalb Genetics Corporation Methods and compositions for the production of stably transformed, fertile monocot plants and cells thereof
US5489520A (en) * 1990-04-17 1996-02-06 Dekalb Genetics Corporation Process of producing fertile transgenic zea mays plants and progeny comprising a gene encoding phosphinothricin acetyl transferase
US5451513A (en) * 1990-05-01 1995-09-19 The State University of New Jersey Rutgers Method for stably transforming plastids of multicellular plants
US5187267A (en) * 1990-06-19 1993-02-16 Calgene, Inc. Plant proteins, promoters, coding sequences and use
US6395966B1 (en) * 1990-08-09 2002-05-28 Dekalb Genetics Corp. Fertile transgenic maize plants containing a gene encoding the pat protein
US6022846A (en) * 1990-09-21 2000-02-08 Mogen International And Gist-Brocades N.V. Expression of phytase in plants
US5593963A (en) * 1990-09-21 1997-01-14 Mogen International Expression of phytase in plants
US5641664A (en) * 1990-11-23 1997-06-24 Plant Genetic Systems, N.V. Process for transforming monocotyledonous plants
US5384253A (en) * 1990-12-28 1995-01-24 Dekalb Genetics Corporation Genetic transformation of maize cells by electroporation of cells pretreated with pectin degrading enzymes
US5436389A (en) * 1991-02-21 1995-07-25 Dekalb Genetics Corp. Hybrid genetic complement and corn plant DK570
US5491288A (en) * 1991-03-05 1996-02-13 Rhone Poulenc Agrochimie Chimeric gene comprising the arabidopsis histone H4 promoter for the transformation of plants
US5563324A (en) * 1991-05-09 1996-10-08 The Arizona Board Of Regents On Behalf Of The University Of Arizona Transgenic plants with altered polyol content
US5559223A (en) * 1991-08-09 1996-09-24 E. I. Dupont De Nemours And Company Synthetic storage proteins with defined structure containing programmable levels of essential amino acids for improvement of the nutritional value of plants
US5405765A (en) * 1991-08-23 1995-04-11 University Of Florida Method for the production of transgenic wheat plants
US5625136A (en) * 1991-10-04 1997-04-29 Ciba-Geigy Corporation Synthetic DNA sequence having enhanced insecticidal activity in maize
US5422254A (en) * 1992-02-14 1995-06-06 Oy Alko Ab Method to increase the trehalose content of organisms by transforming them with the structural genes for the short and long chains of yeast trehalose synthase
US5773691A (en) * 1992-03-19 1998-06-30 E. I. Du Pont De Nemours And Company Chimeric genes and methods for increasing the lysine and threonine content of the seeds of plants
US5516668A (en) * 1992-03-24 1996-05-14 Japan Tobacco Inc. Method for decreasing seed storage proteins and for transforming plants
US5591616A (en) * 1992-07-07 1997-01-07 Japan Tobacco, Inc. Method for transforming monocotyledons
US5743477A (en) * 1992-08-27 1998-04-28 Dowelanco Insecticidal proteins and method for plant protection
US5545545A (en) * 1993-04-27 1996-08-13 Regents Of The University Of Minnesota Lysine-insensitive maize dihydrodipicolinic acid synthase
US5780709A (en) * 1993-08-25 1998-07-14 Dekalb Genetics Corporation Transgenic maize with increased mannitol content

Cited By (282)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9701947B2 (en) 2003-08-21 2017-07-11 Monsanto Technology Llc Fatty acid desaturases from primula
US10174297B2 (en) 2003-08-21 2019-01-08 Monsanto Technology Llc Fatty acid desaturases from primula
US11041148B2 (en) 2003-08-21 2021-06-22 Monsanto Technology Llc Fatty acid desaturases from primula
US11034983B2 (en) 2004-04-16 2021-06-15 Monsanto Technology Llc Expression of fatty acid desaturases in corn
US20110039700A1 (en) * 2008-04-28 2011-02-17 Reiner Fischer Method for Improved Utilization of the Production Potential of Transgenic Plants Introduction
US20100190647A1 (en) * 2009-01-29 2010-07-29 Bayer Cropscience Ag Method for improved utilization of the production potential of transgenic plants introduction
WO2011061656A1 (en) * 2009-11-17 2011-05-26 Basf Plant Science Company Gmbh Plants with increased yield
CN102770543A (en) * 2009-11-17 2012-11-07 巴斯夫植物科学有限公司 Plants with increased yield
US8722072B2 (en) 2010-01-22 2014-05-13 Bayer Intellectual Property Gmbh Acaricidal and/or insecticidal active ingredient combinations
US9206137B2 (en) 2010-11-15 2015-12-08 Bayer Intellectual Property Gmbh N-Aryl pyrazole(thio)carboxamides
WO2012072489A1 (en) 2010-11-29 2012-06-07 Bayer Cropscience Ag Alpha,beta-unsaturated imines
US9055743B2 (en) 2010-11-29 2015-06-16 Bayer Intellectual Property Gmbh Alpha, beta-unsaturated imines
WO2012072660A1 (en) 2010-12-01 2012-06-07 Bayer Cropscience Ag Use of fluopyram for controlling nematodes in crops and for increasing yield
EP3103334A1 (en) 2010-12-01 2016-12-14 Bayer Intellectual Property GmbH Agent combinations comprising pyridylethyl benzamides and other agents
EP3103339A1 (en) 2010-12-01 2016-12-14 Bayer Intellectual Property GmbH Agent combinations comprising pyridylethyl benzamides and other agents
EP3103338A1 (en) 2010-12-01 2016-12-14 Bayer Intellectual Property GmbH Agent combinations comprising pyridylethyl benzamides and other agents
EP3103340A1 (en) 2010-12-01 2016-12-14 Bayer Intellectual Property GmbH Agent combinations comprising pyridylethyl benzamides and other agents
WO2012072696A1 (en) 2010-12-01 2012-06-07 Bayer Cropscience Ag Active ingredient combinations comprising pyridylethylbenzamides and other active ingredients
EP3092900A1 (en) 2010-12-01 2016-11-16 Bayer Intellectual Property GmbH Active ingredient combinations comprising pyridylethylbenzamides and other active ingredients
US20120167250A1 (en) * 2010-12-22 2012-06-28 E.I. Du Pont De Nemours And Company Viral promoter, truncations thereof, and methods of use
US8895716B2 (en) * 2010-12-22 2014-11-25 Pioneer Hi-Bred International, Inc. Viral promoter, truncations thereof, and methods of use
WO2012120105A1 (en) 2011-03-10 2012-09-13 Bayer Cropscience Ag Use of lipochito-oligosaccharide compounds for safeguarding seed safety of treated seeds
EP3292761A1 (en) 2011-03-23 2018-03-14 Bayer Intellectual Property GmbH Active compound combinations
EP3292760A1 (en) 2011-03-23 2018-03-14 Bayer Intellectual Property GmbH Active compound combinations
EP3295797A1 (en) 2011-03-23 2018-03-21 Bayer Intellectual Property GmbH Active compound combinations
WO2012126938A2 (en) 2011-03-23 2012-09-27 Bayer Cropscience Ag Active compound combinations
WO2012136581A1 (en) 2011-04-08 2012-10-11 Bayer Cropscience Ag Fungicide hydroximoyl-tetrazole derivatives
EP2997825A1 (en) 2011-04-22 2016-03-23 Bayer Intellectual Property GmbH Active compound combinations comprising a (thio)carboxamide derivative and a fungicidal compound
US9241493B2 (en) 2011-06-14 2016-01-26 Bayer Intellectual Property Gmbh Use of an enaminocarbonyl compound in combination with a biological control agent
WO2012171914A1 (en) 2011-06-14 2012-12-20 Bayer Intellectual Property Gmbh Use of an enaminocarbonyl compound in combination with a biological control agent
US9265252B2 (en) 2011-08-10 2016-02-23 Bayer Intellectual Property Gmbh Active compound combinations comprising specific tetramic acid derivatives
US9670496B2 (en) 2011-08-22 2017-06-06 Bayer Cropscience N.V. Methods and means to modify a plant genome
WO2013026740A2 (en) 2011-08-22 2013-02-28 Bayer Cropscience Nv Methods and means to modify a plant genome
US10538774B2 (en) 2011-08-22 2020-01-21 Basf Agricultural Solutions Seed, Us Llc Methods and means to modify a plant genome
EP2561759A1 (en) 2011-08-26 2013-02-27 Bayer Cropscience AG Fluoroalkyl-substituted 2-amidobenzimidazoles and their effect on plant growth
WO2013037717A1 (en) 2011-09-12 2013-03-21 Bayer Intellectual Property Gmbh Fungicidal 4-substituted-3-{phenyl[(heterocyclylmethoxy)imino]methyl}-1,2,4-oxadizol-5(4h)-one derivatives
WO2013037956A1 (en) 2011-09-16 2013-03-21 Bayer Intellectual Property Gmbh Use of 5-phenyl- or 5-benzyl-2 isoxazoline-3 carboxylates for improving plant yield
WO2013037955A1 (en) 2011-09-16 2013-03-21 Bayer Intellectual Property Gmbh Use of acylsulfonamides for improving plant yield
WO2013037958A1 (en) 2011-09-16 2013-03-21 Bayer Intellectual Property Gmbh Use of phenylpyrazolin-3-carboxylates for improving plant yield
WO2013050410A1 (en) 2011-10-04 2013-04-11 Bayer Intellectual Property Gmbh RNAi FOR THE CONTROL OF FUNGI AND OOMYCETES BY INHIBITING SACCHAROPINE DEHYDROGENASE GENE
WO2013075817A1 (en) 2011-11-21 2013-05-30 Bayer Intellectual Property Gmbh Fungicide n-[(trisubstitutedsilyl)methyl]-carboxamide derivatives
WO2013079566A2 (en) 2011-11-30 2013-06-06 Bayer Intellectual Property Gmbh Fungicidal n-bicycloalkyl and n-tricycloalkyl (thio)carboxamide derivatives
WO2013092519A1 (en) 2011-12-19 2013-06-27 Bayer Cropscience Ag Use of anthranilic acid diamide derivatives for pest control in transgenic crops
WO2013098146A1 (en) 2011-12-29 2013-07-04 Bayer Intellectual Property Gmbh Fungicidal 3-[(1,3-thiazol-4-ylmethoxyimino)(phenyl)methyl]-2-substituted-1,2,4-oxadiazol-5(2h)-one derivatives
WO2013098147A1 (en) 2011-12-29 2013-07-04 Bayer Intellectual Property Gmbh Fungicidal 3-[(pyridin-2-ylmethoxyimino)(phenyl)methyl]-2-substituted-1,2,4-oxadiazol-5(2h)-one derivatives
WO2013110594A1 (en) 2012-01-25 2013-08-01 Bayer Intellectual Property Gmbh Active compound combinations containing fluopyram and biological control agent
WO2013110591A1 (en) 2012-01-25 2013-08-01 Bayer Intellectual Property Gmbh Active compounds combination containing fluopyram bacillus and biologically control agent
WO2013127704A1 (en) 2012-02-27 2013-09-06 Bayer Intellectual Property Gmbh Active compound combinations containing a thiazoylisoxazoline and a fungicide
WO2013139949A1 (en) 2012-03-23 2013-09-26 Bayer Intellectual Property Gmbh Compositions comprising a strigolactame compound for enhanced plant growth and yield
WO2013153143A1 (en) 2012-04-12 2013-10-17 Bayer Cropscience Ag N-acyl- 2 - (cyclo) alkylpyrrolidines and piperidines useful as fungicides
WO2013156560A1 (en) 2012-04-20 2013-10-24 Bayer Cropscience Ag N-cycloalkyl-n-[(trisubstitutedsilylphenyl)methylene]-(thio)carboxamide derivatives
WO2013156559A1 (en) 2012-04-20 2013-10-24 Bayer Cropscience Ag N-cycloalkyl-n-[(heterocyclylphenyl)methylene]-(thio)carboxamide derivatives
WO2013167545A1 (en) 2012-05-09 2013-11-14 Bayer Cropscience Ag Pyrazole indanyl carboxamides
EP2662370A1 (en) 2012-05-09 2013-11-13 Bayer CropScience AG 5-Halogenopyrazole benzofuranyl carboxamides
EP2662363A1 (en) 2012-05-09 2013-11-13 Bayer CropScience AG 5-Halogenopyrazole biphenylcarboxamides
EP2662361A1 (en) 2012-05-09 2013-11-13 Bayer CropScience AG Pyrazol indanyl carboxamides
EP2662362A1 (en) 2012-05-09 2013-11-13 Bayer CropScience AG Pyrazole indanyl carboxamides
EP2662360A1 (en) 2012-05-09 2013-11-13 Bayer CropScience AG 5-Halogenopyrazole indanyl carboxamides
EP2662364A1 (en) 2012-05-09 2013-11-13 Bayer CropScience AG Pyrazole tetrahydronaphthyl carboxamides
WO2013167544A1 (en) 2012-05-09 2013-11-14 Bayer Cropscience Ag 5-halogenopyrazole indanyl carboxamides
WO2013174836A1 (en) 2012-05-22 2013-11-28 Bayer Cropscience Ag Active compounds combinations comprising a lipo-chitooligosaccharide derivative and a nematicide, insecticidal or fungicidal compound
EP3243387A2 (en) 2012-05-30 2017-11-15 Bayer CropScience Aktiengesellschaft Compositions comprising a biological control agent and an insecticide
EP3318128A2 (en) 2012-05-30 2018-05-09 Bayer CropScience Aktiengesellschaft Composition comprising a biological control agent and a fungicide
EP3205210A1 (en) 2012-05-30 2017-08-16 Bayer CropScience Aktiengesellschaft Composition comprising a biological control agent and a fungicide selected from inhibitors of the succinate dehydrogenase
EP3281526A1 (en) 2012-05-30 2018-02-14 Bayer CropScience Aktiengesellschaft Composition comprising a biological control agent and a fungicide
EP3292764A2 (en) 2012-05-30 2018-03-14 Bayer CropScience Aktiengesellschaft Composition comprising a biological control agent and a fungicide selected from inhibitors of the respiratory chain at complex iii
EP3300603A2 (en) 2012-05-30 2018-04-04 Bayer CropScience Aktiengesellschaft Composition comprising a biological control agent and a fungicide
EP3360418A1 (en) 2012-05-30 2018-08-15 Bayer CropScience Aktiengesellschaft Composition comprising a biological control agent and a fungicide
EP3488700A1 (en) 2012-05-30 2019-05-29 Bayer CropScience Aktiengesellschaft Composition comprising a biological control agent and a fungicide
EP3363289A2 (en) 2012-05-30 2018-08-22 Bayer CropScience Aktiengesellschaft Compositions comprising a biological control agent and an insecticide
EP3409120A1 (en) 2012-05-30 2018-12-05 Bayer CropScience Aktiengesellschaft Composition comprising a biological control agent and a fungicide
EP3424322A1 (en) 2012-07-31 2019-01-09 Bayer CropScience Aktiengesellschaft Compositions comprising a pesticidal terpene mixture and an insecticide
WO2014019983A1 (en) 2012-07-31 2014-02-06 Bayer Cropscience Ag Compositions comprising a pesticidal terpene mixture and an insecticide
EP3683307A2 (en) 2012-09-14 2020-07-22 BASF Agricultural Solutions Seed US LLC Hppd variants and methods of use
EP3173477A1 (en) 2012-09-14 2017-05-31 Bayer Cropscience LP Hppd variants and methods of use
WO2014043435A1 (en) 2012-09-14 2014-03-20 Bayer Cropscience Lp Hppd variants and methods of use
CN104869808A (en) * 2012-10-03 2015-08-26 先锋国际良种公司 Genes controlling photoperiod sensitivity in maize and sorghum and uses thereof
WO2014055477A3 (en) * 2012-10-03 2014-06-26 Pioneer Hi-Bred International, Inc. Genes controlling photoperiod sensitivity in maize and sorghum and uses thereof
WO2014055477A2 (en) * 2012-10-03 2014-04-10 Pioneer Hi-Bred International, Inc. Genes controlling photoperiod sensitivity in maize and sorghum and uses thereof
EP2719280A1 (en) 2012-10-11 2014-04-16 Bayer CropScience AG Use of N-phenylethylpyrazole carboxamide derivatives or salts thereof for resistance management of phytopathogenic fungi
WO2014056956A1 (en) 2012-10-11 2014-04-17 Bayer Cropscience Ag Use of n-phenylethylpyrazole carboxamide derivatives or salts thereof for resistance management of phytopathogenic fungi
WO2014060518A1 (en) 2012-10-19 2014-04-24 Bayer Cropscience Ag Method of plant growth promotion using carboxamide derivatives
WO2014060502A1 (en) 2012-10-19 2014-04-24 Bayer Cropscience Ag Active compound combinations comprising carboxamide derivatives
WO2014060520A1 (en) 2012-10-19 2014-04-24 Bayer Cropscience Ag Method for treating plants against fungi resistant to fungicides using carboxamide or thiocarboxamide derivatives
WO2014060519A1 (en) 2012-10-19 2014-04-24 Bayer Cropscience Ag Method for enhancing tolerance to abiotic stress in plants using carboxamide or thiocarboxamide derivatives
EP2735231A1 (en) 2012-11-23 2014-05-28 Bayer CropScience AG Active compound combinations
WO2014079789A1 (en) 2012-11-23 2014-05-30 Bayer Cropscience Ag Active compound combinations
WO2014083031A2 (en) 2012-11-30 2014-06-05 Bayer Cropscience Ag Binary pesticidal and fungicidal mixtures
WO2014083089A1 (en) 2012-11-30 2014-06-05 Bayer Cropscience Ag Ternary fungicidal and pesticidal mixtures
WO2014083033A1 (en) 2012-11-30 2014-06-05 Bayer Cropsience Ag Binary fungicidal or pesticidal mixture
WO2014083088A2 (en) 2012-11-30 2014-06-05 Bayer Cropscience Ag Binary fungicidal mixtures
WO2014082950A1 (en) 2012-11-30 2014-06-05 Bayer Cropscience Ag Ternary fungicidal mixtures
WO2014086750A2 (en) 2012-12-03 2014-06-12 Bayer Cropscience Ag Composition comprising a biological control agent and an insecticide
WO2014086747A2 (en) 2012-12-03 2014-06-12 Bayer Cropscience Ag Composition comprising a biological control agent and a fungicide
WO2014086748A2 (en) 2012-12-03 2014-06-12 Bayer Cropscience Ag Composition comprising a biological control agent and a fungicide
WO2014086749A2 (en) 2012-12-03 2014-06-12 Bayer Cropscience Ag Composition comprising a biological control agent and an insecticide
WO2014086758A2 (en) 2012-12-03 2014-06-12 Bayer Cropscience Ag Composition comprising a biological control agent and an insecticide
WO2014086753A2 (en) 2012-12-03 2014-06-12 Bayer Cropscience Ag Composition comprising biological control agents
EP3318129A1 (en) 2012-12-03 2018-05-09 Bayer CropScience Aktiengesellschaft Method for pest control by applying a combination of paecilomyces lilacinus and fluopyram
WO2014086764A2 (en) 2012-12-03 2014-06-12 Bayer Cropscience Ag Composition comprising a biological control agent and a fungicide
WO2014086759A2 (en) 2012-12-03 2014-06-12 Bayer Cropscience Ag Composition comprising biological control agents
WO2014090765A1 (en) 2012-12-12 2014-06-19 Bayer Cropscience Ag Use of 1-[2-fluoro-4-methyl-5-(2,2,2-trifluoroethylsulfinyl)phenyl]-5-amino-3-trifluoromethyl)-1 h-1,2,4 tfia zole for controlling nematodes in nematode-resistant crops
WO2014095826A1 (en) 2012-12-18 2014-06-26 Bayer Cropscience Ag Binary fungicidal and bactericidal combinations
WO2014095677A1 (en) 2012-12-19 2014-06-26 Bayer Cropscience Ag Difluoromethyl-nicotinic- tetrahydronaphtyl carboxamides
WO2014124375A1 (en) 2013-02-11 2014-08-14 Bayer Cropscience Lp Compositions comprising gougerotin and a biological control agent
WO2014124361A1 (en) 2013-02-11 2014-08-14 Bayer Cropscience Lp Compositions comprising a streptomyces-based biological control agent and another biological control agent
WO2014124368A1 (en) 2013-02-11 2014-08-14 Bayer Cropscience Lp Compositions comprising gougerotin and a fungicide
WO2014124379A1 (en) 2013-02-11 2014-08-14 Bayer Cropscience Lp Compositions comprising a streptomyces-based biological control agent and an insecticide
WO2014124373A1 (en) 2013-02-11 2014-08-14 Bayer Cropscience Lp Compositions comprising gougerotin and an insecticide
WO2014124369A1 (en) 2013-02-11 2014-08-14 Bayer Cropscience Lp Compositions comprising a streptomyces-based biological control agent and a fungicide
WO2014138339A2 (en) 2013-03-07 2014-09-12 Athenix Corp. Toxin genes and methods for their use
EP3626828A2 (en) 2013-03-07 2020-03-25 BASF Agricultural Solutions Seed US LLC Toxin genes and methods for their use
WO2014170364A1 (en) 2013-04-19 2014-10-23 Bayer Cropscience Ag Binary insecticidal or pesticidal mixture
WO2014170345A2 (en) 2013-04-19 2014-10-23 Bayer Cropscience Ag Method for improved utilization of the production potential of transgenic plants
WO2014177514A1 (en) 2013-04-30 2014-11-06 Bayer Cropscience Ag Nematicidal n-substituted phenethylcarboxamides
WO2014177582A1 (en) 2013-04-30 2014-11-06 Bayer Cropscience Ag N-(2-fluoro-2-phenethyl)carboxamides as nematicides and endoparasiticides
WO2014206953A1 (en) 2013-06-26 2014-12-31 Bayer Cropscience Ag N-cycloalkyl-n-[(bicyclylphenyl)methylene]-(thio)carboxamide derivatives
WO2015082587A1 (en) 2013-12-05 2015-06-11 Bayer Cropscience Ag N-cycloalkyl-n-{[2-(1-substitutedcycloalkyl)phenyl]methylene}-(thio)carboxamide derivatives
WO2015082586A1 (en) 2013-12-05 2015-06-11 Bayer Cropscience Ag N-cycloalkyl-n-{[2-(1-substitutedcycloalkyl)phenyl]methylene}-(thio)carboxamide derivatives
EP2885970A1 (en) 2013-12-21 2015-06-24 Bayer CropScience AG Fungicide compositions comprising compound I, at least one succinate dehydrogenase (SDH) inhibitor and at least one triazole fungicide
WO2015138394A2 (en) 2014-03-11 2015-09-17 Bayer Cropscience Lp Hppd variants and methods of use
WO2015160618A1 (en) 2014-04-16 2015-10-22 Bayer Cropscience Lp Compositions comprising ningnanmycin and a biological control agent
WO2015160619A1 (en) 2014-04-16 2015-10-22 Bayer Cropscience Lp Compositions comprising ningnanmycin and a fungicide
WO2015160620A1 (en) 2014-04-16 2015-10-22 Bayer Cropscience Lp Compositions comprising ningnanmycin and an insecticide
WO2016166077A1 (en) 2015-04-13 2016-10-20 Bayer Cropscience Aktiengesellschaft N-cycloalkyl-n-(biheterocyclyethylene)-(thio)carboxamide derivatives
WO2016193073A1 (en) 2015-05-29 2016-12-08 Bayer Cropscience Aktiengesellschaft Methods for controlling phytopathogenic nematodes by combination of fluopyram and biological control agents
EP3097782A1 (en) 2015-05-29 2016-11-30 Bayer CropScience Aktiengesellschaft Methods for controlling phytopathogenic nematodes by combination of fluopyram and biological control agents
WO2017042259A1 (en) 2015-09-11 2017-03-16 Bayer Cropscience Aktiengesellschaft Hppd variants and methods of use
WO2017198450A1 (en) * 2016-05-15 2017-11-23 Bayer Cropscience Nv Method for increasing yield in maize
WO2018019676A1 (en) 2016-07-29 2018-02-01 Bayer Cropscience Aktiengesellschaft Active compound combinations and methods to protect the propagation material of plants
WO2018098214A1 (en) 2016-11-23 2018-05-31 Bayer Cropscience Lp Axmi669 and axmi991 toxin genes and methods for their use
WO2018136604A1 (en) 2017-01-18 2018-07-26 Bayer Cropscience Lp Bp005 toxin gene and methods for its use
WO2018136611A1 (en) 2017-01-18 2018-07-26 Bayer Cropscience Lp Use of bp005 for the control of plant pathogens
WO2018165091A1 (en) 2017-03-07 2018-09-13 Bayer Cropscience Lp Hppd variants and methods of use
WO2018195256A1 (en) 2017-04-21 2018-10-25 Bayer Cropscience Lp Method of improving crop safety
WO2018219797A1 (en) 2017-06-02 2018-12-06 Basf Se Substituted oxadiazoles for combating phytopathogenic fungi
WO2019020283A1 (en) 2017-07-27 2019-01-31 Basf Se Use of herbicidal compositions based on l-glufosinate in tolerant field crops
WO2019068811A1 (en) 2017-10-06 2019-04-11 Bayer Aktiengesellschaft Compositions comprising fluopyram and tioxazafen
WO2019083810A1 (en) 2017-10-24 2019-05-02 Basf Se Improvement of herbicide tolerance to 4-hydroxyphenylpyruvate dioxygenase (hppd) inhibitors by down-regulation of hppd expression in soybean
WO2019083808A1 (en) 2017-10-24 2019-05-02 Basf Se Improvement of herbicide tolerance to hppd inhibitors by down-regulation of putative 4-hydroxyphenylpyruvate reductases in soybean
WO2019101511A1 (en) 2017-11-23 2019-05-31 Basf Se Substituted trifluoromethyloxadiazoles for combating phytopathogenic fungi
WO2019121143A1 (en) 2017-12-20 2019-06-27 Basf Se Substituted cyclopropyl derivatives
WO2019137995A1 (en) 2018-01-11 2019-07-18 Basf Se Novel pyridazine compounds for controlling invertebrate pests
WO2019219464A1 (en) 2018-05-15 2019-11-21 Basf Se Substituted trifluoromethyloxadiazoles for combating phytopathogenic fungi
WO2019224092A1 (en) 2018-05-22 2019-11-28 Basf Se Pesticidally active c15-derivatives of ginkgolides
WO2019233863A1 (en) 2018-06-04 2019-12-12 Bayer Aktiengesellschaft Herbicidally active bicyclic benzoylpyrazoles
EP3628158A1 (en) 2018-09-28 2020-04-01 Basf Se Pesticidal mixture comprising a mesoionic compound and a biopesticide
WO2020064480A1 (en) 2018-09-28 2020-04-02 Basf Se Pesticidal mixture comprising a mesoionic compound and a biopesticide
WO2020083662A1 (en) 2018-10-23 2020-04-30 Basf Se Tricyclic pesticidal compounds
EP3643705A1 (en) 2018-10-24 2020-04-29 Basf Se Pesticidal compounds
WO2020083733A1 (en) 2018-10-24 2020-04-30 Basf Se Pesticidal compounds
EP3670501A1 (en) 2018-12-17 2020-06-24 Basf Se Substituted [1,2,4]triazole compounds as fungicides
WO2020144308A1 (en) 2019-01-11 2020-07-16 Basf Se Crystalline forms of 1-(1,2-dimethylpropyl)-n-ethyl-5-methyl-n-pyridazin-4-yl-pyrazole-4-carboxamide
EP3696177A1 (en) 2019-02-12 2020-08-19 Basf Se Heterocyclic compounds for the control of invertebrate pests
WO2020231751A1 (en) 2019-05-10 2020-11-19 Bayer Cropscience Lp Active compound combinations
WO2020239517A1 (en) 2019-05-29 2020-12-03 Basf Se Mesoionic imidazolium compounds and derivatives for combating animal pests
WO2020244969A1 (en) 2019-06-06 2020-12-10 Basf Se Pyridine derivatives and their use as fungicides
WO2020244970A1 (en) 2019-06-06 2020-12-10 Basf Se New carbocyclic pyridine carboxamides
WO2020244968A1 (en) 2019-06-06 2020-12-10 Basf Se Fungicidal n-(pyrid-3-yl)carboxamides
WO2021013561A1 (en) 2019-07-19 2021-01-28 Basf Se Pesticidal pyrazole and triazole derivatives
EP3769623A1 (en) 2019-07-22 2021-01-27 Basf Se Mesoionic imidazolium compounds and derivatives for combating animal pests
WO2021013721A1 (en) 2019-07-22 2021-01-28 Bayer Aktiengesellschaft 5-amino substituted pyrazoles and triazoles as pest control agents
WO2021013719A1 (en) 2019-07-23 2021-01-28 Bayer Aktiengesellschaft Novel heteroaryl-triazole compounds as pesticides
WO2021013720A1 (en) 2019-07-23 2021-01-28 Bayer Aktiengesellschaft Novel heteroaryl-triazole compounds as pesticides
WO2021022069A1 (en) 2019-08-01 2021-02-04 Bayer Cropscience Lp Method of improving cold stress tolerance and crop safety
EP3701796A1 (en) 2019-08-08 2020-09-02 Bayer AG Active compound combinations
WO2021058659A1 (en) 2019-09-26 2021-04-01 Bayer Aktiengesellschaft Rnai-mediated pest control
WO2021064075A1 (en) 2019-10-02 2021-04-08 Bayer Aktiengesellschaft Active compound combinations comprising fatty acids
WO2021063736A1 (en) 2019-10-02 2021-04-08 Basf Se Bicyclic pyridine derivatives
WO2021063735A1 (en) 2019-10-02 2021-04-08 Basf Se New bicyclic pyridine derivatives
WO2021069567A1 (en) 2019-10-09 2021-04-15 Bayer Aktiengesellschaft Novel heteroaryl-triazole compounds as pesticides
WO2021069569A1 (en) 2019-10-09 2021-04-15 Bayer Aktiengesellschaft Novel heteroaryl-triazole compounds as pesticides
WO2021089673A1 (en) 2019-11-07 2021-05-14 Bayer Aktiengesellschaft Substituted sulfonyl amides for controlling animal pests
WO2021097162A1 (en) 2019-11-13 2021-05-20 Bayer Cropscience Lp Beneficial combinations with paenibacillus
WO2021099271A1 (en) 2019-11-18 2021-05-27 Bayer Aktiengesellschaft Active compound combinations comprising fatty acids
WO2021099303A1 (en) 2019-11-18 2021-05-27 Bayer Aktiengesellschaft Novel heteroaryl-triazole compounds as pesticides
WO2021105091A1 (en) 2019-11-25 2021-06-03 Bayer Aktiengesellschaft Novel heteroaryl-triazole compounds as pesticides
WO2021155084A1 (en) 2020-01-31 2021-08-05 Pairwise Plants Services, Inc. Suppression of shade avoidance response in plants
WO2021165195A1 (en) 2020-02-18 2021-08-26 Bayer Aktiengesellschaft Heteroaryl-triazole compounds as pesticides
EP3708565A1 (en) 2020-03-04 2020-09-16 Bayer AG Pyrimidinyloxyphenylamidines and the use thereof as fungicides
WO2021211926A1 (en) 2020-04-16 2021-10-21 Pairwise Plants Services, Inc. Methods for controlling meristem size for crop improvement
WO2021209490A1 (en) 2020-04-16 2021-10-21 Bayer Aktiengesellschaft Cyclaminephenylaminoquinolines as fungicides
WO2021213978A1 (en) 2020-04-21 2021-10-28 Bayer Aktiengesellschaft 2-(het)aryl-substituted condensed heterocyclic derivatives as pest control agents
EP3903584A1 (en) 2020-04-28 2021-11-03 Basf Se Use of strobilurin type compounds for combating phytopathogenic fungi containing an amino acid substitution f129l in the mitochondrial cytochrome b protein conferring resistance to qo inhibitors iv
EP3903581A1 (en) 2020-04-28 2021-11-03 Basf Se Use of strobilurin type compounds for combating phytopathogenic fungi containing an amino acid substitution f129l in the mitochondrial cytochrome b protein conferring resistance to qo inhibitors i
EP3903583A1 (en) 2020-04-28 2021-11-03 Basf Se Use of strobilurin type compounds for combating phytopathogenic fungi containing an amino acid substitution f129l in the mitochondrial cytochrome b protein conferring resistance to qo inhibitors iii
EP3903582A1 (en) 2020-04-28 2021-11-03 Basf Se Use of strobilurin type compounds for combating phytopathogenic fungi containing an amino acid substitution f129l in the mitochondrial cytochrome b protein conferring resistance to qo inhibitors ii
WO2021219513A1 (en) 2020-04-28 2021-11-04 Basf Se Pesticidal compounds
WO2021224220A1 (en) 2020-05-06 2021-11-11 Bayer Aktiengesellschaft Pyridine (thio)amides as fungicidal compounds
WO2021224323A1 (en) 2020-05-06 2021-11-11 Bayer Aktiengesellschaft Novel heteroaryl-triazole compounds as pesticides
WO2021228734A1 (en) 2020-05-12 2021-11-18 Bayer Aktiengesellschaft Triazine and pyrimidine (thio)amides as fungicidal compounds
WO2021233861A1 (en) 2020-05-19 2021-11-25 Bayer Aktiengesellschaft Azabicyclic(thio)amides as fungicidal compounds
WO2021247477A1 (en) 2020-06-02 2021-12-09 Pairwise Plants Services, Inc. Methods for controlling meristem size for crop improvement
WO2021245087A1 (en) 2020-06-04 2021-12-09 Bayer Aktiengesellschaft Heterocyclyl pyrimidines and triazines as novel fungicides
WO2021249800A1 (en) 2020-06-10 2021-12-16 Basf Se Substituted [1,2,4]triazole compounds as fungicides
WO2021249995A1 (en) 2020-06-10 2021-12-16 Bayer Aktiengesellschaft Azabicyclyl-substituted heterocycles as fungicides
WO2021257775A1 (en) 2020-06-17 2021-12-23 Pairwise Plants Services, Inc. Methods for controlling meristem size for crop improvement
WO2021255118A1 (en) 2020-06-18 2021-12-23 Bayer Aktiengesellschaft Composition for use in agriculture
WO2021255071A1 (en) 2020-06-18 2021-12-23 Bayer Aktiengesellschaft 3-(pyridazin-4-yl)-5,6-dihydro-4h-1,2,4-oxadiazine derivatives as fungicides for crop protection
WO2021255089A1 (en) 2020-06-19 2021-12-23 Bayer Aktiengesellschaft 1,3,4-oxadiazole pyrimidines and 1,3,4-oxadiazole pyridines as fungicides
WO2021255170A1 (en) 2020-06-19 2021-12-23 Bayer Aktiengesellschaft 1,3,4-oxadiazole pyrimidines as fungicides
WO2021255169A1 (en) 2020-06-19 2021-12-23 Bayer Aktiengesellschaft 1,3,4-oxadiazole pyrimidines as fungicides
EP3929189A1 (en) 2020-06-25 2021-12-29 Bayer Animal Health GmbH Novel heteroaryl-substituted pyrazine derivatives as pesticides
WO2021259997A1 (en) 2020-06-25 2021-12-30 Bayer Animal Health Gmbh Novel heteroaryl-substituted pyrazine derivatives as pesticides
WO2022002818A1 (en) 2020-07-02 2022-01-06 Bayer Aktiengesellschaft Heterocyclene derivatives as pest control agents
EP3939961A1 (en) 2020-07-16 2022-01-19 Basf Se Strobilurin type compounds and their use for combating phytopathogenic fungi
WO2022017836A1 (en) 2020-07-20 2022-01-27 BASF Agro B.V. Fungicidal compositions comprising (r)-2-[4-(4-chlorophenoxy)-2-(trifluoromethyl)phenyl]-1- (1,2,4-triazol-1-yl)propan-2-ol
EP3945089A1 (en) 2020-07-31 2022-02-02 Basf Se Use of strobilurin type compounds for combating phytopathogenic fungi containing an amino acid substitution f129l in the mitochondrial cytochrome b protein conferring resistance to qo inhibitors v
WO2022033991A1 (en) 2020-08-13 2022-02-17 Bayer Aktiengesellschaft 5-amino substituted triazoles as pest control agents
WO2022053453A1 (en) 2020-09-09 2022-03-17 Bayer Aktiengesellschaft Azole carboxamide as pest control agents
WO2022058327A1 (en) 2020-09-15 2022-03-24 Bayer Aktiengesellschaft Substituted ureas and derivatives as new antifungal agents
EP3970494A1 (en) 2020-09-21 2022-03-23 Basf Se Use of strobilurin type compounds for combating phytopathogenic fungi containing an amino acid substitution f129l in the mitochondrial cytochrome b protein conferring resistance to qo inhibitors viii
EP3974414A1 (en) 2020-09-25 2022-03-30 Bayer AG 5-amino substituted pyrazoles and triazoles as pesticides
WO2022089969A1 (en) 2020-10-27 2022-05-05 BASF Agro B.V. Compositions comprising mefentrifluconazole
WO2022090071A1 (en) 2020-11-02 2022-05-05 Basf Se Use of mefenpyr-diethyl for controlling phytopathogenic fungi
WO2022090069A1 (en) 2020-11-02 2022-05-05 Basf Se Compositions comprising mefenpyr-diethyl
EP3915971A1 (en) 2020-12-16 2021-12-01 Bayer Aktiengesellschaft Phenyl-s(o)n-phenylamidines and the use thereof as fungicides
WO2022129196A1 (en) 2020-12-18 2022-06-23 Bayer Aktiengesellschaft Heterobicycle substituted 1,2,4-oxadiazoles as fungicides
WO2022129190A1 (en) 2020-12-18 2022-06-23 Bayer Aktiengesellschaft (hetero)aryl substituted 1,2,4-oxadiazoles as fungicides
WO2022129200A1 (en) 2020-12-18 2022-06-23 Bayer Aktiengesellschaft Use of dhodh inhibitor for controlling resistant phytopathogenic fungi in crops
WO2022129188A1 (en) 2020-12-18 2022-06-23 Bayer Aktiengesellschaft 1,2,4-oxadiazol-3-yl pyrimidines as fungicides
EP4036083A1 (en) 2021-02-02 2022-08-03 Bayer Aktiengesellschaft 5-oxy substituted heterocycles as pesticides
EP4043444A1 (en) 2021-02-11 2022-08-17 Basf Se Substituted isoxazoline derivatives
WO2022173885A1 (en) 2021-02-11 2022-08-18 Pairwise Plants Services, Inc. Methods and compositions for modifying cytokinin oxidase levels in plants
WO2022182834A1 (en) 2021-02-25 2022-09-01 Pairwise Plants Services, Inc. Methods and compositions for modifying root architecture in plants
WO2022207496A1 (en) 2021-03-30 2022-10-06 Bayer Aktiengesellschaft 3-(hetero)aryl-5-chlorodifluoromethyl-1,2,4-oxadiazole as fungicide
WO2022207494A1 (en) 2021-03-30 2022-10-06 Bayer Aktiengesellschaft 3-(hetero)aryl-5-chlorodifluoromethyl-1,2,4-oxadiazole as fungicide
WO2022233777A1 (en) 2021-05-06 2022-11-10 Bayer Aktiengesellschaft Alkylamide substituted, annulated imidazoles and use thereof as insecticides
WO2022238391A1 (en) 2021-05-12 2022-11-17 Bayer Aktiengesellschaft 2-(het)aryl-substituted condensed heterocycle derivatives as pest control agents
EP4091451A1 (en) 2021-05-17 2022-11-23 BASF Agro B.V. Compositions comprising mefentrifluconazole
WO2022243107A1 (en) 2021-05-18 2022-11-24 Basf Se New substituted pyridines as fungicides
WO2022243109A1 (en) 2021-05-18 2022-11-24 Basf Se New substituted quinolines as fungicides
WO2022243111A1 (en) 2021-05-18 2022-11-24 Basf Se New substituted pyridines as fungicides
WO2022266271A1 (en) 2021-06-17 2022-12-22 Pairwise Plants Services, Inc. Modification of growth regulating factor family transcription factors in soybean
WO2022271892A1 (en) 2021-06-24 2022-12-29 Pairwise Plants Services, Inc. Modification of hect e3 ubiquitin ligase genes to improve yield traits
WO2023278651A1 (en) 2021-07-01 2023-01-05 Pairwise Plants Services, Inc. Methods and compositions for enhancing root system development
EP4119547A1 (en) 2021-07-12 2023-01-18 Basf Se Triazole compounds for the control of invertebrate pests
WO2023011958A1 (en) 2021-08-02 2023-02-09 Basf Se (3-pirydyl)-quinazoline
WO2023019188A1 (en) 2021-08-12 2023-02-16 Pairwise Plants Services, Inc. Modification of brassinosteroid receptor genes to improve yield traits
WO2023017120A1 (en) 2021-08-13 2023-02-16 Bayer Aktiengesellschaft Active compound combinations and fungicide compositions comprising those
WO2023023496A1 (en) 2021-08-17 2023-02-23 Pairwise Plants Services, Inc. Methods and compositions for modifying cytokinin receptor histidine kinase genes in plants
EP4140986A1 (en) 2021-08-23 2023-03-01 Basf Se Pyrazine compounds for the control of invertebrate pests
WO2023025682A1 (en) 2021-08-25 2023-03-02 Bayer Aktiengesellschaft Novel pyrazinyl-triazole compounds as pesticides
EP4140995A1 (en) 2021-08-27 2023-03-01 Basf Se Pyrazine compounds for the control of invertebrate pests
WO2023034731A1 (en) 2021-08-30 2023-03-09 Pairwise Plants Services, Inc. Modification of ubiquitin binding peptidase genes in plants for yield trait improvement
EP4144739A1 (en) 2021-09-02 2023-03-08 Bayer Aktiengesellschaft Anellated pyrazoles as parasiticides
WO2023034891A1 (en) 2021-09-02 2023-03-09 Pairwise Plants Services, Inc. Methods and compositions for improving plant architecture and yield traits
EP4151631A1 (en) 2021-09-20 2023-03-22 Basf Se Heterocyclic compounds for the control of invertebrate pests
WO2023049720A1 (en) 2021-09-21 2023-03-30 Pairwise Plants Services, Inc. Methods and compositions for reducing pod shatter in canola
WO2023060028A1 (en) 2021-10-04 2023-04-13 Pairwise Plants Services, Inc. Methods for improving floret fertility and seed yield
WO2023060152A2 (en) 2021-10-07 2023-04-13 Pairwise Plants Services, Inc. Methods for improving floret fertility and seed yield
WO2023072671A1 (en) 2021-10-28 2023-05-04 Basf Se Use of strobilurin type compounds for combating phytopathogenic fungi containing an amino acid substitution f129l in the mitochondrial cytochrome b protein conferring resistance to qo inhibitors ix
WO2023078915A1 (en) 2021-11-03 2023-05-11 Bayer Aktiengesellschaft Bis(hetero)aryl thioether (thio)amides as fungicidal compounds
WO2023099445A1 (en) 2021-11-30 2023-06-08 Bayer Aktiengesellschaft Bis(hetero)aryl thioether oxadiazines as fungicidal compounds
EP4194453A1 (en) 2021-12-08 2023-06-14 Basf Se Pyrazine compounds for the control of invertebrate pests
WO2023108035A1 (en) 2021-12-09 2023-06-15 Pairwise Plants Services, Inc. Methods for improving floret fertility and seed yield
EP4198033A1 (en) 2021-12-14 2023-06-21 Basf Se Heterocyclic compounds for the control of invertebrate pests
WO2023147526A1 (en) 2022-01-31 2023-08-03 Pairwise Plants Services, Inc. Suppression of shade avoidance response in plants
WO2023148028A1 (en) 2022-02-01 2023-08-10 Globachem Nv Methods and compositions for controlling pests
WO2023148030A1 (en) 2022-02-01 2023-08-10 Globachem Nv Methods and compositions for controlling pests in corn
WO2023156402A1 (en) 2022-02-17 2023-08-24 Basf Se Pesticidally active thiosemicarbazone compounds
WO2023168217A1 (en) 2022-03-02 2023-09-07 Pairwise Plants Services, Inc. Modification of brassinosteroid receptor genes to improve yield traits
WO2023192838A1 (en) 2022-03-31 2023-10-05 Pairwise Plants Services, Inc. Early flowering rosaceae plants with improved characteristics
WO2023196886A1 (en) 2022-04-07 2023-10-12 Pairwise Plants Services, Inc. Methods and compositions for improving resistance to fusarium head blight
WO2023205714A1 (en) 2022-04-21 2023-10-26 Pairwise Plants Services, Inc. Methods and compositions for improving yield traits
WO2023215704A1 (en) 2022-05-02 2023-11-09 Pairwise Plants Services, Inc. Methods and compositions for enhancing yield and disease resistance
WO2023213626A1 (en) 2022-05-03 2023-11-09 Bayer Aktiengesellschaft Use of (5s)-3-[3-(3-chloro-2-fluorophenoxy)-6-methylpyridazin-4-yl]-5-(2-chloro-4-methylbenzyl)-5,6-dihydro-4h-1,2,4-oxadiazine for controlling unwanted microorganisms
WO2023213670A1 (en) 2022-05-03 2023-11-09 Bayer Aktiengesellschaft Crystalline forms of (5s)-3-[3-(3-chloro-2-fluorophenoxy)-6-methylpyridazin-4-yl]-5-(2-chloro-4-methylbenzyl)-5,6-dihydro-4h-1,2,4-oxadiazine
WO2023215809A1 (en) 2022-05-05 2023-11-09 Pairwise Plants Services, Inc. Methods and compositions for modifying root architecture and/or improving plant yield traits
WO2024006679A1 (en) 2022-06-27 2024-01-04 Pairwise Plants Services, Inc. Methods and compositions for modifying shade avoidance in plants
WO2024006792A1 (en) 2022-06-29 2024-01-04 Pairwise Plants Services, Inc. Methods and compositions for controlling meristem size for crop improvement
WO2024006791A1 (en) 2022-06-29 2024-01-04 Pairwise Plants Services, Inc. Methods and compositions for controlling meristem size for crop improvement
WO2024028243A1 (en) 2022-08-02 2024-02-08 Basf Se Pyrazolo pesticidal compounds
WO2024030984A1 (en) 2022-08-04 2024-02-08 Pairwise Plants Services, Inc. Methods and compositions for improving yield traits
WO2024036240A1 (en) 2022-08-11 2024-02-15 Pairwise Plants Services, Inc. Methods and compositions for controlling meristem size for crop improvement
WO2024054880A1 (en) 2022-09-08 2024-03-14 Pairwise Plants Services, Inc. Methods and compositions for improving yield characteristics in plants
EP4342885A1 (en) 2022-09-20 2024-03-27 Basf Se N-(3-(aminomethyl)-phenyl)-5-(4-phenyl)-5-(trifluoromethyl)-4,5-dihydroisoxazol-3-amine derivatives and similar compounds as pesticides
EP4295688A1 (en) 2022-09-28 2023-12-27 Bayer Aktiengesellschaft Active compound combination
WO2024068517A1 (en) 2022-09-28 2024-04-04 Bayer Aktiengesellschaft 3-(hetero)aryl-5-chlorodifluoromethyl-1,2,4-oxadiazole as fungicide
WO2024068518A1 (en) 2022-09-28 2024-04-04 Bayer Aktiengesellschaft 3-heteroaryl-5-chlorodifluoromethyl-1,2,4-oxadiazole as fungicide
WO2024068520A1 (en) 2022-09-28 2024-04-04 Bayer Aktiengesellschaft 3-(hetero)aryl-5-chlorodifluoromethyl-1,2,4-oxadiazole as fungicide
WO2024068519A1 (en) 2022-09-28 2024-04-04 Bayer Aktiengesellschaft 3-(hetero)aryl-5-chlorodifluoromethyl-1,2,4-oxadiazole as fungicide

Also Published As

Publication number Publication date
US6395966B1 (en) 2002-05-28

Similar Documents

Publication Publication Date Title
US6395966B1 (en) Fertile transgenic maize plants containing a gene encoding the pat protein
US6777589B1 (en) Methods and compositions for the production of stably transformed, fertile monocot plants and cells thereof
US5969213A (en) Methods and compositions for the production of stably transformed fertile monocot plants and cells thereof
US6399861B1 (en) Methods and compositions for the production of stably transformed, fertile monocot plants and cells thereof
US5981840A (en) Methods for agrobacterium-mediated transformation
US7615685B2 (en) Methods of producing human or animal food from stably transformed, fertile maize plants
US5605011A (en) Nucleic acid fragment encoding herbicide resistant plant acetolactate synthase
AU613596B2 (en) Improved process for transforming plant protoplasts
EP0257993B1 (en) Nucleic acid fragment encoding herbicide resistant plant acetolactate synthase
EP0814166A2 (en) Methods and compositions for the production of stably transformed fertile monocot plants and cells thereof
WO1995006128A9 (en) Fertile, transgenic maize plants and methods for their production
WO1998045456A1 (en) 2-deoxyglucose-6-phosphate (2-dog-6-p) phosphatase dna sequences as selection markers in plants
EP0688160A1 (en) Enhanced regeneration system for cereals
WO2004053055A2 (en) Transgenic maize with enhanced phenotype
US6803499B1 (en) Methods and compositions for the production of stably transformed, fertile monocot plants and cells thereof
DE60038748T2 (en) Mycotoxin-resistant transgenic plant and method of making and using the same
JP2000516812A (en) Peptides with inhibitory activity against phytopathogenic fungi
AU780664B2 (en) Brassica transformation via microprojectile bombardment
US20060294619A1 (en) Method for plant transformation based on thje pollination-fecundation pathway and the products thereof
CA2259209A1 (en) Plant plastid division genes
WO1998000436A9 (en) Plant plastid division genes
CA2064761C (en) Methods and compositions for the production of stably transformed fertile monocot plants and cells thereof
US8148603B2 (en) Transgenic ficus, method for producing same and use thereof
WO2006125678A2 (en) Reversible male-sterile plants
PUGLIESI et al. II. 7 Transgenic Sunflower (Helianthus annuus)

Legal Events

Date Code Title Description
STCB Information on status: application discontinuation

Free format text: ABANDONED -- AFTER EXAMINER'S ANSWER OR BOARD OF APPEALS DECISION