CA2425112C - Massive parallel method for decoding dna and rna - Google Patents

Massive parallel method for decoding dna and rna Download PDF

Info

Publication number
CA2425112C
CA2425112C CA2425112A CA2425112A CA2425112C CA 2425112 C CA2425112 C CA 2425112C CA 2425112 A CA2425112 A CA 2425112A CA 2425112 A CA2425112 A CA 2425112A CA 2425112 C CA2425112 C CA 2425112C
Authority
CA
Canada
Prior art keywords
group
nucleotide
dna
analogue
mass
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Lifetime
Application number
CA2425112A
Other languages
French (fr)
Other versions
CA2425112A1 (en
Inventor
Jingyue Ju
Zengmin Li
John Robert Edwards
Yasuhiro Itagaki
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Columbia University of New York
Original Assignee
Columbia University of New York
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=26972030&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=CA2425112(C) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Application filed by Columbia University of New York filed Critical Columbia University of New York
Publication of CA2425112A1 publication Critical patent/CA2425112A1/en
Application granted granted Critical
Publication of CA2425112C publication Critical patent/CA2425112C/en
Anticipated expiration legal-status Critical
Expired - Lifetime legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869Methods for sequencing
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07HSUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H19/00Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof
    • C07H19/02Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof sharing nitrogen
    • C07H19/04Heterocyclic radicals containing only nitrogen atoms as ring hetero atom
    • C07H19/06Pyrimidine radicals
    • C07H19/10Pyrimidine radicals with the saccharide radical esterified by phosphoric or polyphosphoric acids
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07HSUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H19/00Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof
    • C07H19/02Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof sharing nitrogen
    • C07H19/04Heterocyclic radicals containing only nitrogen atoms as ring hetero atom
    • C07H19/14Pyrrolo-pyrimidine radicals
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07HSUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/686Polymerase chain reaction [PCR]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869Methods for sequencing
    • C12Q1/6872Methods for sequencing involving mass spectrometry
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869Methods for sequencing
    • C12Q1/6874Methods for sequencing involving nucleic acid arrays, e.g. sequencing by hybridisation
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07BGENERAL METHODS OF ORGANIC CHEMISTRY; APPARATUS THEREFOR
    • C07B2200/00Indexing scheme relating to specific properties of organic compounds
    • C07B2200/11Compounds covalently bound to a solid support
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2525/00Reactions involving modified oligonucleotides, nucleic acids, or nucleotides
    • C12Q2525/10Modifications characterised by
    • C12Q2525/117Modifications characterised by incorporating modified base
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2525/00Reactions involving modified oligonucleotides, nucleic acids, or nucleotides
    • C12Q2525/10Modifications characterised by
    • C12Q2525/186Modifications characterised by incorporating a non-extendable or blocking moiety
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2535/00Reactions characterised by the assay type for determining the identity of a nucleotide base or a sequence of oligonucleotides
    • C12Q2535/101Sanger sequencing method, i.e. oligonucleotide sequencing using primer elongation and dideoxynucleotides as chain terminators
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2535/00Reactions characterised by the assay type for determining the identity of a nucleotide base or a sequence of oligonucleotides
    • C12Q2535/122Massive parallel sequencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2563/00Nucleic acid detection characterized by the use of physical, structural and functional properties
    • C12Q2563/107Nucleic acid detection characterized by the use of physical, structural and functional properties fluorescence
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2565/00Nucleic acid analysis characterised by mode or means of detection
    • C12Q2565/50Detection characterised by immobilisation to a surface
    • C12Q2565/501Detection characterised by immobilisation to a surface being an array of oligonucleotides
    • CCHEMISTRY; METALLURGY
    • C40COMBINATORIAL TECHNOLOGY
    • C40BCOMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B40/00Libraries per se, e.g. arrays, mixtures

Abstract

This invention provides methods for attaching a nucleic acid to a solid surface and for sequencing nucleic acid by detecting the identity of each nucleotide analogue after the nucleotide analogue is incorporated into a growing strand of DNA in a polymerase reaction. The invention also provides nucleotide analogues which comprise unique labels attached to the nucleotide analogue through a cleavable linker, and a cleavable chemical group to cap the -OH group at the 3'-position of the deoxyribose.

Description

MASSIVE PARALLEL METHOD FOR DECODING DNA AND RNA

Background Of The Invention Throughout this application, various publications are referenced in parentheses by author and year. Full citations for these references may be found at the end of the specification immediately preceding the claims.

The ability to sequence deoxyribonucleic acid (DNA) accurately and rapidly is revolutionizing biology and medicine. The confluence of the massive Human Genome Project is driving an exponential growth in the development of high throughput genetic analysis technologies. This rapid technological development involving chemistry, engineering, biology, and computer science makes it possible to move from studying single genes at a time to analyzing and comparing entire genomes.
-2-With the completion of the first entire human genome sequence map, many areas in the genome that are highly polymorphic in both exons and introns will be known.
The pharmacogenomics challenge is to comprehensively identify the genes and functional polymorphisms associated with the variability in drug response (Roses, 2000) . Resequencing of polymorphic areas in the genome that are linked to disease development will contribute greatly to the understanding of diseases, such as cancer, and therapeutic development. Thus, high-throughput accurate methods for resequencing the highly variable intron/exon regions of the genome are needed in order to explore the full potential of the complete human genome sequence map. The current state-of-the-art technology for high throughput DNA sequencing, such as used for the Human Genome Project (Pennisi 2000), is capillary array DNA sequencers using laser induced fluorescence detection (Smith et al., 1986; Ju et al.
1995, 1996; Kheterpal et al. 1996; Salas-Solano et al.
1998). Improvements in the polymerase that lead to uniform termination efficiency and the introduction of thermostable polymerases have also significantly improved the quality of sequencing data (Tabor and Richardson, 1987, 1995) Although capillary array DNA sequencing technology to some extent addresses the throughput and read length requirements of large scale DNA sequencing projects, the throughput and accuracy required for mutation studies needs to be improved for a wide variety of applications ranging from disease gene discovery to forensic identification. For example, electrophoresis based DNA sequencing methods have difficulty detecting
3 PCT/US01/31243 heterozygotes unambiguously and are not 100% accurate in regions rich in nucleotides comprising guanine or cytosine due to compressions (Bowling et al. 1991;
Yamakawa et al. 1997). In addition, the first few bases after the priming site are often masked by the high fluorescence signal from excess dye-labeled primers or dye-labeled terminators, and are therefore difficult to identify. Therefore, the requirement of electrophoresis for DNA sequencing is still the bottleneck for high-throughput DNA sequencing and mutation detection projects.

The concept of sequencing DNA by synthesis without using electrophoresis was first revealed in 1988 (Hyman, 1988) and involves detecting the identity of each nucleotide as it is incorporated into the growing strand of DNA in a polymerase reaction. Such a scheme coupled with the chip format and laser-induced fluorescent detection has the potential to markedly increase the throughput of DNA
sequencing projects. Consequently, several groups have investigated such a system with an aim to construct an ultra high-throughput DNA sequencing procedure (Cheeseman 1994, Metzker et al. 1994). Thus far, no complete success of using such a system to unambiguously sequence DNA has been reported. The pyrosequencing approach that employs four natural nucleotides (comprising a base of adenine (A), cytosine (C), guanine (G), or thymine (T)) and several other enzymes for sequencing DNA by synthesis is now widely used for mutation detection (Ronaghi 1998) In this approach, the detection is based on the pyrophosphate (PPi) released during the DNA polymerase reaction, the
-4-quantitative conversion of pyrophosphate to adenosine triphosphate (ATP) by sulfurylase, and the subsequent production of visible light by firefly luciferase. This procedure can only sequence up to 30 base pairs (bps) of nucleotide sequences, and each of the 4 nucleotides needs to be added separately and detected separately.
Long stretches of the same bases cannot be identified unambiguously with the pyrosequencing method.

More recent work in the literature exploring DNA
sequencing by a synthesis method is mostly focused on designing and synthesizing a photocleavable chemical moiety that is linked to a fluorescent dye to cap the 3'-OH group of deoxynucleoside triphosphates (dNTPs) (Welch et al. 1999). Limited success for the incorporation of the 3'-modified nucleotide by DNA
polymerase is reported. The reason is that the 3'-position on the deoxyribose is very close to the amino acid residues in the active site of the polymerase, and the polymerase is therefore sensitive to modification in this area of the deoxyribose ring. On the other hand, it is known that modified DNA polymerases (Thermo Sequenase and Taq FS polymerase) are able to recognize nucleotides with extensive modifications with bulky groups such as energy transfer dyes at the 5-position of the pyrimidines (T and C) and at the 7-position of purines (G and A) (Rosenblum et al. 1997, Zhu et al.
1994). The ternary complexes of rat DNA polymerase, a DNA template-primer, and dideoxycytidine triphosphate (ddCTP) have been determined (Pelletier et al. 1994) which supports this fact. As shown in Figure 1, the 3-D
structure indicates that the surrounding area of the 3'-
-5-position of the deoxyribose ring in ddCTP is very crowded, while there is ample space for modification on the 5-position the cytidine base.

The approach disclosed in the present application is to make nucleotide analogues by linking a unique label such as a fluorescent dye or a mass tag through a cleavable linker to the nucleotide base or an analogue of the nucleotide base, such as to the 5-position of the pyrimidines (T and C) and to the 7-position of the purines (G and A), to use a small cleavable chemical moiety to cap the 3'-OH group of the deoxyribose to make it nonreactive, and to incorporate the nucleotide analogues into the growing DNA strand as terminators.
Detection of the unique label will yield the sequence identity of the nucleotide. Upon removing the label and the 3'-OH capping group, the polymerase reaction will proceed to incorporate the next nucleotide analogue and detect the next base.

It is also desirable to use a photocleavable group to cap the 3'-OH group. However, a photocleavable group is generally bulky and thus the DNA polymerase will have difficulty to incorporate the nucleotide analogues containing a photocleavable moiety capping the 3'-OH
group. If small chemical moieties that can be easily cleaved chemically with high yield can be used to cap the 3'-OH group, such nucleotide analogues should also be recognized as substrates for DNA polymerase. It has been reported that 3'-O-methoxy-deoxynucleotides are good substrates for several polymerases (Axelrod et al.
1978). 3'-O-allyl-dATP was also shown to be
-6-incorporated by Ventr(exo-) DNA polymerase in the growing strand of DNA (Metzker et al. 1994) . However, the procedure to chemically cleave the methoxy group is stringent and requires anhydrous conditions. Thus, it is not practical to use a methoxy group to cap the 3'-OH
group for sequencing DNA by synthesis. An ester group was also explored to cap the 3'-OH group of the nucleotide, but it was shown to be cleaved by the nucleophiles in the active site in DNA polymerase (Canard et al. 1995). Chemical groups with electrophiles such as ketone groups are not suitable for protecting the 3'-OH of the nucleotide in enzymatic reactions due to the existence of strong nucleophiles in the polymerase. It is known that MOM (-CH2OCH3) and allyl (-CH2CH=CH2) groups can be used to cap an -OH
group, and can be cleaved chemically with high yield (Ireland et al. 1986; Kamal et al. 1999) The approach disclosed in the present application is to incorporate nucleotide analogues, which are labeled with cleavable, unique labels such as fluorescent dyes or mass tags and where the 3'-OH is capped with a cleavable chemical moiety such as either a MOM group (-CH2OCH3) or an allyl group (-CH2CH=CH2), into the growing strand DNA as terminators. The optimized nucleotide set (3'-RO-A-LABELl, 3'-RO-C LABEL2, 3'-RO-G-LABEL3, 3'-RO-T-LABEL4, where R denotes the chemical group used to cap the 3'-OH) can then be used for DNA sequencing by the synthesis approach.

There are many advantages of using mass spectrometry (MS) to detect small and stable molecules. For example, the mass resolution can be as good as one dalton. Thus, compared to gel electrophoresis sequencing systems and
-7-the laser induced fluorescence detection approach which have overlapping fluorescence emission spectra, leading to heterozygote detection difficulty, the MS approach disclosed in this application produces very high resolution of sequencing data by detecting the cleaved small mass tags instead of the long DNA fragment. This method also produces extremely fast separation in the time scale of microseconds. The high resolution allows accurate digital mutation and heterozygote detection.

Another advantage of sequencing- with mass spectrometry by detecting the small mass tags is that the compressions associated with gel based systems are completely eliminated.

In order to maintain a continuous hybridized primer extension product with the template DNA, a primer that contains a stable loop to form an entity capable of self-priming in a polymerase reaction can be ligated to the 3' end of each single stranded DNA template that is immobilized on a solid surface such as a chip. This approach will solve the problem of washing off the growing extension products in each cycle.

Saxon and Bertozzi (2000) developed an elegant and highly specific coupling chemistry linking a specific group that contains a phosphine moiety to an azido group on the surface of a biological cell. In the present application, this coupling chemistry is adopted to create a solid surface which is coated with a covalently linked phosphine moiety, and to generate polymerase chain reaction (PCR) products that contain an azido group at the 5' end for specific coupling of the DNA
-8-template with the solid surface. One example of a solid surface is glass channels which have an inner wall with an uneven or porous surface to increase the surface area. Another example is a chip.

The present application discloses a novel and advantageous system for DNA sequencing by the synthesis approach which employs a stable DNA template, which is able to self prime for the polymerase reaction, covalently linked to a solid surface such as a chip, and 4 unique nucleotides analogues (3-RO-A-LABEL1, 3'-RO-C-LABEL2i 3'-RO-G-LABEL3, 3-RO-T-LABEL4) = The success of this novel system will allow the development of an ultra high-throughput and high fidelity DNA sequencing system for polymorphism, pharmacogenetics applications and for ,,hole genome sequencing. This fast and accurate DNA
resequencing system is needed in such fields as detection of single nucleotide polymorphisms (SNPs) (Chee et al. 1996), serial analysis of gene expression (SAGE) (Velculescu et al. 1995), identification in forensics, and genetic disease association studies.
-9-Summary Of The Invention This invention is directed to a method for sequencing a nucleic acid by detecting the identity of a nucleotide analogue after the nucleotide analogue is incorporated into a growing strand of DNA in a polymerase reaction, which comprises the following steps:

(i) attaching a 5' end of the nucleic acid to a solid surface;

(ii) attaching a primer to the nucleic acid attached to the solid surface;

(iii) adding a polymerase and one or more different nucleotide analogues to the nucleic acid to thereby incorporate a nucleotide analogue into the growing strand of DNA, wherein the incorporated nucleotide analogue terminates the polymerase reaction and wherein each different nucleotide analogue comprises (a) a base selected from the group consisting of adenine, guanine, cytosine, thymine, and uracil, and their analogues; (b) a unique label attached through a cleavable linker to the base or to an analogue of the base; (c) a deoxyribose; and (d) a cleavable chemical group to cap an -OH group at a 3'-position of the deoxyribose;

(iv) washing the solid surface to remove unincorporated nucleotide analogues;
-10-(v) detecting the unique label attached to the nucleotide analogue that has been incorporated into the growing strand of DNA, so as to thereby identify the incorporated nucleotide analogue;

(vi) adding one or more chemical compounds to permanently cap any unreacted -OH group on the primer attached to the nucleic acid or on a primer extension strand formed by adding one or more nucleotides or nucleotide analogues to the primer;

(vii) cleaving the cleavable linker between the nucleotide analogue that was incorporated into the growing strand of DNA and the unique label;

(viii) cleaving the cleavable chemical group capping the -OH group at the 3'-position of the deoxyribose to uncap the -OH group, and washing the solid surface to remove cleaved compounds; and (ix) repeating steps (iii) through (viii) so as to detect the identity of a newly incorporated nucleotide analogue into the growing strand of DNA;
-11-wherein if the unique label is a dye, the order of steps (v) through (vii) is: (v), (vi), and (vii);
and wherein if the unique label is a mass tag, the order of steps (v) through (vii) is: (vi), (vii), and (v).

The invention provides a method of attaching a nucleic acid to a solid surface which comprises:

(i) coating the solid surface with a phosphine moiety, (ii) attaching an azido group to a 5' end of the nucleic acid, and (iii) immobilizing the 5' end of the nucleic acid to the solid surface through interaction between the phosphine moiety on the solid surface and the azido group on the 5' end of the nucleic acid.

The invention provides a nucleotide analogue which comprises:

(a) a base selected from the group consisting of adenine or an analogue of adenine, cytosine or an analogue of cytosine, guanine or an analogue of guanine, thymine or an analogue of thymine, and uracil or an analogue of uracil;
-12-(b) a unique label attached through a cleavable linker to the base or to an analogue of the base;

(c) a deoxyribose; and (d) a cleavable chemical group to cap an -OH group at a 3'-position of the deoxyribose.

The invention provides a parallel mass spectrometry system, which comprises a plurality of atmospheric pressure chemical ionization mass spectrometers for parallel analysis of a plurality of samples comprising mass tags.

In an aspect, the invention provides a method for simultaneously sequencing a plurality of different nucleic acids, comprising a) providing a plurality of different nucleic acids immobilized on a solid support, a DNA polymerase, primers capable of hybridizing to said plurality of different nucleic acids, and four different nucleotide analogues, wherein each nucleotide analogue comprises a nucleotide having i) a base labeled with a different label attached through a chemically cleavable linker and ii) a chemical moiety of less than 300 daltons in mass capping the 3'-OH group, wherein said chemical moiety is removable by chemical means and is not a fluorescent dye;

b) incorporating with said DNA polymerase one or more of said nucleotide analogues into said primers to create a plurality of different extension strands;
and c) detecting said label of each of said incorporated nucleotide analogues, so as to thereby identify each of the incorporated nucleotide analogue in said plurality of different extension strands, -12a-thereby simultaneously sequencing a plurality of different nucleic acids.

In another aspect, the methods of the invention may further comprise removing by chemical means the chemical moiety of each of the incorporated nucleotide analogs having the 3'-OH group, so as to permit incorporation of another analog into each of the extension strands. In anther aspect, step b) comprises hybridizing primers to said different nucleic acids.

In an aspect, the label is fluorescent. In another aspect, at least one of the nucleotide analogs is a deaza analog.

In yet another aspect, the present invention provides a plurality of different nucleic acids immobilized on a solid support and hybridized to primers, a portion of the primers comprising incorporated nucleotide analogs, the nucleotide analogs comprising:

i) a base labelled with a different removable label attached through a cleavable linker and ii) a chemical moiety of less than 300 daltons in mass capping the 3'-OH group, wherein said chemical moiety is removable by chemical means and is not a fluorescent dye.

In an aspect, each nucleotide analog comprises a base selected from the group consisting of adenine, guanine, cytosine, thymine, uracil, and analogs thereof. In another aspect, at least one of the nucleotide analogs is a deaza analog. In yet another aspect, the nucleotide analogs are selected from the group consisting of cytosine, thymine, deaza-adenine and deaza-guanine, wherein each unique removable label is attached through a cleavable linker to a 5-position of cytosine or thymine or to a 7-position of deaza-adenine or deaza-guanine.

In another aspect, in the methods of the invention, at least 100,000 different nucleic acid sequences spotted on a surface are simultaneously sequenced.
-13-Brief Description Of The Figures Figure 1: The 3D structure of the ternary complexes of rat DNA polymerase, a DNA template-primer, and dideoxycytidine triphosphate (ddCTP). The left side of the illustration shows the mechanism for the addition of ddCTP and the right side of the illustration shows the active site of the polymerase. Note that the 3' position of the dideoxyribose ring is very crowded, while ample space is available at the 5 position of the cytidine base.

Figure 2A-2B: Scheme of sequencing by the synthesis approach. A: Example where the unique labels are dyes and the solid surface is a chip. B: Example where the unique labels are mass tags and the solid surface is channels etched into a glass chip. A, C, G, T;
nucleotide triphosphates comprising bases adenine, cytosine, guanine, and thymine; d, deoxy; dd, dideoxy;
R, cleavable chemical group used to cap the -OH group;
Y, cleavable linker.

Figure 3: The synthetic scheme for the immobilization of an azido (N3) labeled DNA fragment to a solid surface coated with a triarylphosphine moiety. Me, methyl group;
P, phosphorus; Ph, phenyl.

Figure 4: The synthesis of triarylphosphine N-hydroxysuccinimide (NHS) ester.

Figure 5: The synthetic scheme for attaching an azido (N3) group through a linker to the 5' end of a DNA
-14-fragment, which is then used to couple with the triarylphosphine moiety on a solid surface. DMSO, dimethylsulfonyl oxide.

Figure 6A-6B: Ligate the looped primer (B) to the immobilized single stranded DNA template forming a self primed DNA template moiety on a solid surface. P (in circle), phosphate.

Figure 7: Examples of structures of four nucleotide analogues for use in the sequencing by synthesis approach. Each nucleotide analogue has a unique fluorescent dye attached to the base through a photocleavable linker and the 3'-OH is either exposed or capped with a MOM group or an allyl group. FAM, 5-carboxyfluorescein; R6G, 6-carboxyrhodamine-6G; TAM, N,N,N',N'-tetramethyl-6-carboxyrhodamine; ROX, 6-carboxy-X-rhodamine. R = H, CH20CH3 (MOM) or CH2CH=CH2 (Allyl).

Figure 8: A representative scheme for the synthesis of the nucleotide analogue 3'-RO-G-Tam= A similar scheme can be used to create the other three modified nucleotides:

3'-RO-A Dyel, 3'-RO-C-Dye2, 3'-RO-T-Dye4 (i) tetrakis(triphenylphosphine)palladium(0); (ii) POC13, Bn4N+pyrophosphate; (iii) NH4OH; (iv) Na2CO3/NaHCO3 (pH =
9.0) /DMSO.

Figure 9: A scheme for testing the sequencing by synthesis approach. Each nucleotide, modified by the attachment of a unique fluorescent dye, is added one by
-15-one, based on the complimentary template. The dye is detected and cleaved to test the approach. Dyel = Fam;
Dye2 = R6G; Dye3 = Tam; Dye4 = Rox.

Figure 10: The expected photocleavage products of DNA
containing a photo-cleavable dye (Tam). Light absorption (300 - 360 nm) by the aromatic 2-nitrobenzyl moiety causes reduction of the 2-nitro group to a nitroso group and an oxygen insertion into the carbon-hydrogen bond located in the 2-position followed by cleavage and decarboxylation (Pillai 1980).

Figure 11: Synthesis of PC-LC-Biotin-FAM to evaluate the photolysis efficiency of the fluorophore coupled with the photocleavable linker 2-nitrobenzyl group.

Figure 12: Fluorescence spectra (?ex = 480 nm) of PC-LC-Biotin-FAM immobilized on a microscope glass slide coated with streptavidin (a); after 10 min photolysis (2 jrr = 350 nm; -0.5 mW/cm2) (b) ; and after washing with water to remove the photocleaved dye (c).

Figure 13A-13B: Synthetic scheme for capping the 3'-OH
of nucleotide.

Figure 14: Chemical cleavage of the MOM group (top row) and the allyl group (bottom row) to free the 3'-OH in the nucleotide. CITMS = chlorotrimethylsilane.

Figure 15A-15B: Examples of energy transfer coupled dye systems, where Fam or Cy2 is employed as a light absorber (energy transfer donor) and C12Fam, C12R6G,
-16-C12Tam, or C12Rox as an energy transfer acceptor. Cy2, cyanine; FAM, 5-carboxyfluorescein; R6G, 6-carboxyrhodamine-6G; TAM, N,N,N',N'-tetramethyl-6-carboxyrhodamine; ROX, 6-carboxy-X-rhodamine.

Figure 16: The synthesis of a photocleavable energy transfer dye-labeled nucleotide. DMF, dimethylformide.
DEC = 1-(3-dimethylaminopropyl)-3-ethylcarbodimide hydrochloride. R = H, CH2OCH3 (MOM) or CH2CH=CH2 (Allyl) Figure 17: Structures of four mass tag precursors and four photoactive mass tags. Precursors: a) acetophenone;
b) 3-fluoroacetophenone; c) 3,4-difluoroacetophenone;
and d) 3,4-dimethoxyacetophenone. Four photoactive mass tags are used to code for the identity of each of the four nucleotides (A, C, G, T).

Figure 18: Atmospheric Pressure Chemical Ionization (APCI) mass spectrum of mass tag precursors shown in Figure 17.

Figure 19: Examples of structures of four nucleotide analogues for use in the sequencing by synthesis approach. Each nucleotide analogue has a unique mass tag attached to the base through a photocleavable linker, and the 3'-OH is either exposed or capped with a MOM
group or an allyl group. The square brackets indicated that the mass tag is cleavable. R = H, CH2OCH3 (MOM) or CH2CH=CH2 (Allyl).
-17-Figure 20: Example of synthesis of NHS ester of one mass tag (Tag-3). A similar scheme is used to create other mass tags.

Figure 21: A representative scheme for the synthesis of the nucleotide analogue 3'-RO-G-Tag3 = A similar scheme is used to create the other three modified bases 3'-RO-A-Tag1r 3' -RO-C-Tag2 r 3' -RO-T-Tag4 (i) tetrakis(triphenylphosphine)palladium(0); (ii) POC13r Bn4N+pyrophosphate; (iii) NH4OH; (iv) Na2CO3/NaHCO3 (pH =
9.0)/DMSO.

Figure 22: Examples of expected photocleavage products of DNA containing a photocleavable mass tag.

Figure 23: System for DNA sequencing comprising multiple channels in parallel and multiple mass spectrometers in parallel. The example shows 96 channels in a silica glass chip.

Figure 24: Parallel mass spectrometry system for DNA
sequencing. Example shows three mass spectrometers in parallel. Samples are injected into the ion source where they are mixed with a nebulizer gas and ionized. A
turbo pump is used to continuously sweep away free radicals, neutral compounds and other undesirable elements coming, from the ion source. A second turbo pump is used to generate a continuous vacuum in all three analyzers and detectors simultaneously. The acquired signal is then converted to a digital signal by the A/D converter. All three signals are then sent to
-18-the data acquisition processor to convert the signal to identify the mass tag in the injected sample and thus identify the nucleotide sequence.
-19-Detailed Description Of The Invention The following definitions are presented as an aid in understanding this invention.

As used herein, to cap an -OH group means to replace the "H" in the -OH group with a chemical group. As disclosed herein, the -OH group of the nucleotide analogue is capped with a cleavable chemical group. To uncap an -OH group means to cleave the chemical group from a capped -OH group and to replace the chemical group with "H", i.e., to replace the "R" in -OR with "H"
wherein "R" is the chemical group used to cap the -OH
group.

The nucleotide bases are abbreviated as follows: adenine (A), cytosine (C), guanine (G), thymine (T), and uracil (U).

An analogue of a nucleotide base refers to a structural and functional derivative of the base of a nucleotide which can be recognized by polymerase as a substrate.
That is, for example, an analogue of adenine (A) should form hydrogen bonds with thymine (T), a C analogue should form hydrogen bonds with G, a G analogue should form hydrogen bonds with C, and a T analogue should form hydrogen bonds with A, in a double helix format.
Examples of analogues of nucleotide bases include, but are not limited to, 7-deaza-adenine and 7-deaza-guanine, wherein the nitrogen atom at the 7-position of adenine or guanine is substituted with a carbon atom.
-20-A nucleotide analogue refers to a chemical compound that is structurally and functionally similar to the nucleotide, i.e. the nucleotide analogue can be recognized by polymerase as a substrate. That is, for example, a nucleotide analogue comprising adenine or an analogue of adenine should form hydrogen bonds with thymine, a nucleotide analogue comprising C or an analogue of C should form hydrogen bonds with G, a nucleotide analogue comprising G or an analogue of G
should form hydrogen bonds with C, and a nucleotide analogue comprising T or an analogue of T should form hydrogen bonds with A, in a double helix format.
Examples of nucleotide analogues disclosed herein include analogues which comprise an analogue of the nucleotide base such as 7-deaza-adenine or 7-deaza-guanine, wherein the nitrogen atom at the 7-position of adenine or guanine is substituted with a carbon atom.
Further examples include analogues in which a label is attached through a cleavable linker to the 5-position of cytosine or thymine or to the 7-position of deaza-adenine or deaza-guanine. Other examples include analogues in which a small chemical moiety such as -CH2OCH3 or -CH2CH=CH2 is used to cap the -OH group at the 3'-position of deoxyribose. Analogues of dideoxynucleotides can similarly be prepared.

As used herein, a porous surface is a surface which contains pores or is otherwise uneven, such that the surface area of the porous surface is increased relative to the surface area when the surface is smooth.
-21-The present invention is directed to a method for sequencing a nucleic acid by detecting the identity of a nucleotide analogue after the nucleotide analogue is incorporated into a growing strand of DNA in a polymerase reaction, which comprises the following steps:

(i) attaching a 5' end of the nucleic acid to a solid surface;

(ii) attaching a primer to the nucleic acid attached to the solid surface;

(iii) adding a polymerase and one or more different nucleotide analogues to the nucleic acid to thereby incorporate a nucleotide analogue into the growing strand of DNA, wherein the incorporated nucleotide analogue terminates the polymerase reaction and wherein each different nucleotide analogue comprises (a) a base selected from the group consisting of adenine, guanine, cytosine, thymine, and uracil, and their analogues; (b) a unique label attached through a cleavable linker to the base or to an analogue of the base; (c) a deoxyribose; and (d) a cleavable chemical group to cap an -OH group at a 3'-position of the deoxyribose;

(iv) washing the solid surface to remove unincorporated nucleotide analogues;
-22-(v) detecting the unique label attached to the nucleotide analogue that has been incorporated into the growing strand of DNA, so as to thereby identify the incorporated nucleotide analogue;

(vi) adding one or more chemical compounds to permanently cap any unreacted -OH group on the primer attached to the nucleic acid or on a primer extension strand formed by adding one or more nucleotides or nucleotide analogues to the primer;

(vii) cleaving the cleavable linker between the nucleotide analogue that was incorporated into the growing strand of DNA and the unique label;

(viii) cleaving the cleavable chemical group capping the -OH group at the 3'-position of the deoxyribose to uncap the -OH group, and washing the solid surface to remove cleaved compounds; and (ix) repeating steps (iii) through (viii) so as to detect the identity of a newly incorporated nucleotide analogue into the growing strand of DNA;

wherein if the unique label is a dye, the order of steps (v) through (vii) is: (v), (vi), and (vii);
and
-23-wherein if the unique label is a mass tag, the order of steps (v) through (vii) is: (vi), (vii), and (v).
In one embodiment of any of the nucleotide analogues described herein, the nucleotide base is adenine. In one embodiment, the nucleotide base is guanine. In one embodiment, the nucleotide base is cytosine. In one embodiment, the nucleotide base is thymine. In one embodiment, the nucleotide base is uracil. In one embodiment, the nucleotide base is an analogue of adenine. In one embodiment, the nucleotide base is an analogue of guanine. In one embodiment, the nucleotide base is an analogue of cytosine. In one embodiment, the nucleotide base is an analogue of thymine. In one embodiment, the nucleotide base is an analogue of uracil.

In different embodiments of any of the inventions described herein, the solid surface is glass, silicon, or gold. In different embodiments, the solid surface is a magnetic bead, a chip, a channel in a chip, or a porous channel in a chip. In one embodiment, the solid surface is glass. In one embodiment, the solid surface is silicon. In one embodiment, the solid surface is gold. In one embodiments, the solid surface is a magnetic bead. In one embodiment, the solid surface is a chip. In one embodiment, the solid surface is a channel in a chip. In one embodiment, the solid surface is a porous channel in a chip. Other materials can also be used as long as the material does not interfere with the steps of the method.
-24-In one embodiment, the step of attaching the nucleic acid to the solid surface comprises:

(i) coating the solid surface with a phosphine moiety, (ii) attaching an azido group to the 5' end of the nucleic acid, and (iii) immobilizing the 5' end of the nucleic acid to the solid surface through interaction between the phosphine moiety on the solid surface and the azido group on the 5' end of the nucleic acid.

In one embodiment, the step of coating the solid surface with the phosphine moiety comprises:

(i) coating the surface with a primary amine, and (ii) covalently coupling a N-hydroxysuccinimidyl ester of triarylphosphine with the primary amine.

In one embodiment, the nucleic acid that is attached to the solid surface is a single-stranded deoxyribonucleic acid (DNA). In another embodiment, the nucleic acid that is attached to the solid surface in step (1) is a double-stranded DNA, wherein only one strand is directly attached to the solid surface, and wherein the strand that is not directly attached to the solid surface is removed by denaturing before proceeding to step (ii).
in one embodiment, the nucleic acid that is attached to
-25-the solid surface is a ribonucleic acid (RNA), and the polymerase in step (iii) is reverse transcriptase.

In one embodiment, the primer is attached to a 3' end of the nucleic acid in step (ii), and the attached primer comprises a stable loop and an -OH group at a 3'-position of a deoxyribose capable of self-priming in the polymerase reaction. In one embodiment, the step of attaching the primer to the nucleic acid comprises hybridizing the primer to the nucleic acid or ligating the primer to the nucleic acid. In one embodiment, the primer is attached to the nucleic acid through a ligation reaction which links the 3' end of the nucleic acid with the 5' end of the primer.

In one embodiment, one or more of four different nucleotide analogs is added in step (iii), wherein each different nucleotide analogue comprises a different base selected from the group consisting of thymine or uracil or an analogue of thymine or uracil, adenine or an analogue of adenine, cytosine or an analogue of cytosine, and guanine or an analogue of guanine, and wherein each of the four different nucleotide analogues comprises a unique label.

In one embodiment, the cleavable chemical group that caps the -OH group at the 3'-position of the deoxyribose in the nucleotide analogue is -CH2OCH3 or -CH2CH=CH2. Any chemical group could be used as long as the group 1) is stable during the polymerase reaction, 2) does not interfere with the recognition of the nucleotide
-26-analogue by polymerase as a substrate, and 3) is cleavable.

In one embodiment, the unique label that is attached to the nucleotide analogue is a fluorescent moiety or a fluorescent semiconductor crystal. In further embodiments, the fluorescent moiety is selected from the group consisting of 5-carboxyfluorescein, 6-carboxyrhodamine-6G, N,N,N',N'-tetramethyl-6-carboxyrhodamine, and 6-carboxy-X-rhodamine. In one embodiment, the fluorescent moiety is 5-carboxyfluorescein. In one embodiment, the fluorescent moiety is 6-carboxyrhodamine-6G, N,N,N',N'-tetramethyl-6-carboxyrhodamine. In one embodiment, the fluorescent moiety is 6-carboxy-X-rhodamine.

In one embodiment, the unique label that is attached to the nucleotide analogue is a fluorescence energy transfer tag which comprises an energy transfer donor and an energy transfer acceptor. In further embodiments, the energy transfer donor is 5-carboxyfluorescein or cyanine, and wherein the energy transfer acceptor is selected from the group consisting of dichlorocarboxyfluorescein, dichloro-6-carboxyrhodamine-6G, dichloro-N,N,N',NT-tetramethyl-6-carboxyrhodamine, and dichloro-6-carboxy-X-rhodamine.
In one embodiment, the energy transfer acceptor is dichlorocarboxyfluorescein. In one embodiment, the energy transfer acceptor is dichloro-6-carboxyrhodamine-6G. In one embodiment, the energy transfer acceptor is dichloro-N,N,N1,N'-tetramethyl-6-carboxyrhodamine. In one embodiment, the energy transfer acceptor is dichloro-6-carboxy-X-rhodamine.
-27-In one embodiment, the unique label that is attached to the nucleotide analogue is a mass tag that can be detected and differentiated by a mass spectrometer. In further embodiments, the mass tag is selected from the group consisting of a 2-nitro-a-methyl-benzyl group, a 2-nitro-a-methyl-3-fluorobenzyl group, a 2-nitro-a-methyl-3,4-difluorobenzyl group, and a 2-nitro-a-methyl-3,4-dimethoxybenzyl group. In one embodiment, the mass tag is a 2-nitro-a-methyl-benzyl group. In one embodiment, the mass tag is a 2-nitro-a-methyl-3-fluorobenzyl group. In one embodiment, the mass tag is a 2-nitro-a-methyl-3,4-difluorobenzyl group. In one embodiment, the mass tag is a 2-nitro-a-methyl-3,4-dimethoxybenzyl group. In one embodiment, the mass tag is detected using a parallel mass spectrometry system which comprises a plurality of atmospheric pressure chemical ionization mass spectrometers for parallel analysis of a plurality of samples comprising mass tags.
In one embodiment, the unique label is attached through a cleavable linker to a 5-position of cytosine or thymine or to a 7-position of deaza-adenine or deaza-guanine. The unique label could also be attached through a cleavable linker to another position in the nucleotide analogue as long as the attachment of the label is stable during the polymerase reaction and the nucleotide analog can be recognized by polymerase as a substrate. For example, the cleavable label could be attached to the deoxyribose.
-28-In one embodiment, the linker between the unique label and the nucleotide analogue is cleaved by a means selected from the group consisting of one or more of a physical means, a chemical means, a physical chemical means, heat, and light. In one embodiment, the linker is cleaved by a physical means. In one embodiment, the linker is cleaved by a chemical means. In one embodiment, the linker is cleaved by a physical chemical means. In one embodiment, the linker is cleaved by heat.
In one embodiment, the linker is cleaved by light. In one embodiment, the linker is cleaved by ultraviolet light. In a further embodiment, the cleavable linker is a photocleavable linker which comprises a 2-nitrobenzyl moiety.
In one embodiment, the cleavable chemical group used to cap the -OH group at the 3'-position of the deoxyribose is cleaved by a means selected from the group consisting of one or more of a physical means, a chemical means, a physical chemical means, heat, and light. In one embodiment, the linker is cleaved by a physical chemical means. In one embodiment, the linker is cleaved by heat.
In one embodiment, the linker is cleaved by light. In one embodiment, the linker is cleaved by ultraviolet light.

In one embodiment, the chemical compounds added in step (vi) to permanently cap any unreacted -OH group on the primer attached to the nucleic acid or on the primer extension strand are a polymerase and one or more different dideoxynucleotides or analogues of dideoxynucleotides. In further embodiments, the
-29-different dideoxynucleotides are selected from the group consisting of 2',3'-dideoxyadenosine 5'-triphosphate, 2',3'-dideoxyguanosine 5'-triphosphate, 2',3'-dideoxycytidine 5'-triphosphate, 2',3'-dideoxythymidine 5'-triphosphate, 2',3'-dideoxyuridine 5'-triphosphase, and their analogues. In one embodiment, the dideoxynucleotide is 2',3'-dideoxyadenosine 5'-triphosphate. In one embodiment, the dideoxynucleotide is 2',3'-dideoxyguanosine 5'-triphosphate. In one embodiment, the dideoxynucleotide is 2',3'-dideoxycytidine 5'-triphosphate. In one embodiment, the dideoxynucleotide is 2',3'-dideoxythymidine 5'-triphosphate. In one embodiment, the dideoxynucleotide is 2',3'-dideoxyuridine 5'-triphosphase. In one embodiment, the dideoxynucleotide is an analogue of 2',3'-dideoxyadenosine 5'-triphosphate. In one embodiment, the dideoxynucleotide is an analogue of 2',3'-dideoxyguanosine 5'-triphosphate. In one embodiment, the dideoxynucleotide is an analogue of 2',3'-dideoxycytidine 5'-triphosphate. In one embodiment, the dideoxynucleotide is an analogue of 2',3'-dideoxythymidine 5'-triphosphate. In one Pmbodiment, the dideoxynucleotide is an analogue of 2',3'-dideoxyuridine 5'-triphosphase.

In one embodiment, a polymerase and one or more of four different dideoxynucleotides are added in step (vi), wherein each different dideoxynucleotide is selected from the group consisting of 2',3'-dideoxyadenosine 5'-triphosphate or an analogue of 2',3'-dideoxyadenosine 5'-triphosphate; 2',3'-dideoxyguanosine 5'-triphosphate or an analogue of 2',3'-dideoxyguanosine 5'-
-30-triphosphate; 2',3'-dideoxycytidine 5'-triphosphate or an analogue of 2',3'-dideoxycytidine 5'-triphosphate;
and 2',3'-dideoxythymidine 5'-triphosphate or 2',3'-dideoxyuridine 5'-triphosphase or an analogue of 2',3'-dideoxythymidine 5'-triphosphate or an analogue of 2',3'-dideoxyuridine 5'-triphosphase. In one embodiment, the dideoxynucleotide is 2',3'-dideoxyadenosine 5'-triphosphate. In one embodiment, the dideoxynucleotide is an analogue of 2',3'-dideoxyadenosine 5'-triphosphate. In one embodiment, the dideoxynucleotide is 2',3'-dideoxyguanosine 5'-triphosphate. In one embodiment, the dideoxynucleotide is an analogue of 2',3'-dideoxyguanosine 5'-triphosphate. In one embodiment, the dideoxynucleotide is 2',3'-dideoxycytidine 5'-triphosphate. In one embodiment, the dideoxynucleotide is an analogue of 2',3'-dideoxycytidine 5'-triphosphate. In one embodiment, the dideoxynucleotide is 2',3'-dideoxythymidine 5'-triphosphate. In one embodiment, the dideoxynucleotide is 2',3'-dideoxyuridine 5'-triphosphase. In one embodiment, the dideoxynucleotide is an analogue of 2',3'-dideoxythymidine 5'-triphosphate. In one embodiment, the dideoxynucleotide is an analogue of 2',3'-dideoxyuridine 5'-triphosphase.

Another type of chemical compound that reacts specifically with the -OH group could also be used to permanently cap any unreacted -OH group on the primer attached to the nucleic acid or on an extension strand formed by adding one or more nucleotides or nucleotide analogues to the primer.
-31-The invention provides a method for simultaneously sequencing a plurality of different nucleic acids, which comprises simultaneously applying any of the methods disclosed herein for sequencing a nucleic acid to the plurality of different nucleic acids. In different embodiments, the method can be used to sequence from one to over 100,000 different nucleic acids simultaneously.
The invention provides for the use of any of the methods disclosed herein for detection of single nucleotide polymorphisms, genetic mutation analysis, serial analysis of gene expression, gene expression analysis, identification in forensics, genetic disease association studies, DNA sequencing, genomic sequencing, translational analysis, or transcriptional analysis.

`1'he invention provides a method of attaching a nucleic acid to a solid surface which comprises:

(i) coating the solid surface with a phosphene moiety, (ii) attaching an azido group to a 5' end of the nucleic acid, and (iii) immobilizing the 5' end of the nucleic acid to the solid surface through interaction between the phosphine moiety on the solid surface and the azido group on the 5' end of the nucleic acid.
-32-In one embodiment, the step of coating the solid surface with the phosphine moiety comprises:

(i) coating the surface with a primary amine, and (ii) covalently coupling a N-hydroxysuccinimidyl ester of triarylphosphine with the primary amine.

In different embodiments, the solid surface is glass, silicon, or gold. In different embodiments, the solid surface is a magnetic bead, a chip, a channel in an chip, or a porous channel in a chip.

In different embodiments, the nucleic acid that is attached to the solid surface is a single-stranded or double-stranded DNA or a RNA. In one embodiment, the nucleic acid is a double-stranded DNA and only one strand is attached to the solid surface. In a further embodiment, the strand of the double-stranded DNA that is not attached to the solid surface is removed by denaturing.

The invention provides for the use of any of the methods disclosed herein for attaching a nucleic acid to a surface for gene expression analysis, microarray based gene expression analysis, or mutation detection, translational analysis, transcriptional analysis, or for other genetic applications.

The invention provides a nucleotide analogue which comprises:
-33-(a) a base selected from the group consisting of adenine or an analogue of adenine, cytosine or an analogue of cytosine, guanine or an analogue of guanine, thymine or an analogue of thymine, and uracil or an analogue of uracil;
(b) a unique label attached through a cleavable linker to the base or to an analogue of the base;

(c) a deoxyribose; and (d) a cleavable chemical group to cap an -OH group at a 3'-position of the deoxyribose.

In one embodiment of the nucleotide analogue, the cleavable chemical group that caps the -OH group at the 3'-position of the deoxyribose is -CH20CH3 or -CH2CH=CH2 .
In one embodiment, the unique label is a fluorescent moiety or a fluorescent semiconductor crystal. In further embodiments, the fluorescent moiety is selected from the group consisting of 5-carboxyfluorescein, 6-carboxyrhodamine-6G, N,N,N',N'-tetramethyl-6-carboxyrhodamine, and 6-carboxy-X-rhodamine.

In one embodiment, the unique label is a fluorescence energy transfer tag which comprises an energy transfer donor and an energy transfer acceptor. In further embodiments, the energy transfer donor is 5-carboxyfluorescein or cyanine, and wherein the energy
-34-transfer acceptor is selected from the group consisting of dichlorocarboxyfluorescein, dichloro-6-carboxyrhodamine-6G, dichloro-N,N,N',N'-tetramethyl-6-carboxyrhodamine, and dichloro-6-carboxy-X-rhodamine.

In one embodiment, the unique label is a mass tag that can be detected and differentiated by a mass spectrometer. In further embodiments, the mass tag is selected from the group consisting of a 2-nitro-a-methyl-benzyl group, a 2-nitro-a-methyl-3-fluorobenzyl group, a 2-nitro-a-methyl-3,4-difluorobenzyl group, and a 2-nitro-a-methyl-3,4-dimethoxybenzyl group.

In one embodiment, the unique label is attached through a cleavable linker to a 5-position of cytosine or thymine or to a 7-position of deaza-adenine or deaza-guanine. The unique label could also be attached through a cleavable linker to another position in the nucleotide analogue as long as the attachment of the label is stable during the polymerase reaction and the nucleotide analog can be recognized by polymerase as a substrate. For example, the cleavable label could be attached to the deoxyribose.

In one embodiment, the linker between the unique label and the nucleotide analogue is cleavable by a means selected from the group consisting of one or more of a physical means, a chemical means, a physical chemical means, heat, and light. In a further embodiment, the cleavable linker is a photocleavable linker which comprises a 2-nitrobenzyl moiety.
-35-In one embodiment, the cleavable chemical group used to cap the -OH group at the 3'-position of the deoxyribose is cleavable by a means selected from the group consisting of one or more of a physical means, a chemical means, a physical chemical means, heat, and light.
-36-In different embodiments, the nucleotide analogue is selected from the group consisting of:

NH2 - a` o N
0 0 o O2H
O =
' O= O
OR

N"z 0 0 0 O 0= oy.~
=o F-O-p- P-O= o- o=
OR

o HN
O O O H2-+ " - Dyy ~" , and =O-P-04-0--O O
O= O' O-R

p o =o-faroP- -P-o o or., O' O= O=
OR s wherein Dye,, Dye2, Dyes, and Dye4 are four different unique labels; and wherein R is a cleavable chemical group used to cap the -OH group at the 3'-position of the deoxyribose.
-37-In different embodiments, the nucleotide analogue is selected from the group consisting of:

COOH

'O-P-O-P-O-P-O 0 0 OR
H,CH2CHN 0 NHCH2CH3 N i I - N~O OO' 1'O-P-O-P-O-P: -O 0 0 O' O' O' OR

(H3C)2N 0 / N(CH3)2 O = N0 Y Coo' HN O N

and OR

0 NV O \ I /
H II COO' "0-9-0--P-0-9-0O 0 6- O' O' OR

wherein R is -CH2OCH3 or -CH2CH=CH2.
-38-In different embodiments, the nucleotide analogue is selected from the group consisting of:

N112 = N H
O\
N~ III( ' I Tag1 'O-P-O-P-0-P-0 0 O' 0' O"
OR

N O
N 1 "-Tag2 , O''N 0 'O-P-O-P-O-P-O
O' O' O' OR
H
N 0 \Tag3 and HN I
~-~

'0-1;-O-l;-O P-0 0 O' O"
OR
O H
NO
HN I f Tag4 O O O o1).,N
u It 'O-P-O-P-O-P-O O
0' O' O' OR

wherein Tag,, Tager Tags, and Tag4 are four different mass tag labels; and wherein R is a cleavable chemical group used to cap the -OH group at the 3'-position of the deoxyribose.
-39-In different embodiments, the nucleotide analogue is selected from the group consisting of:

N
0 0 0 I`N \ 011 0-0-0-0-0-P-0 0' 0' O" 0 OR

N~0 0--'-N 0 0-P-0-P-0-P-0 02N F-~:~o OR

-HN \ II
0 0 0 H2N 'N N 02N F and '0-9-0-0-0-9-0 O" O' O' 0 F
OR

HN~N O

n ON
O-P-O-uP-O-i ~-O 02N OMe~
O' O' O' ~ OMe OR

wherein R is -CH2OCH3 or -CH2CH=CH2.
-40-The invention provides for the use any of the nucleotide analogues disclosed herein for detection of single nucleotide polymorphisms, genetic mutation analysis, serial analysis of gene expression, gene expression analysis, identification in forensics, genetic disease association studies, DNA sequencing, genomic sequencing, translational analysis, or transcriptional analysis.

The invention provides a parallel mass spectrometry system, which comprises a plurality of atmospheric pressure chemical ionization mass spectrometers for parallel analysis of a plurality of samples comprising mass tags. In one embodiment, the mass spectrometers are quadrupole mass spectrometers. In one embodiment, the mass spectrometers are time-of-flight mass spectrometers. In one embodiment, the mass spectrometers are contained in one device. In one embodiment, the system further comprises two turbo-pumps, wherein one pump is used to generate a vacuum and a second pump is used to remove undesired elements. In one embodiment, the system comprises at least three mass spectrometers. In one embodiment, the mass tags have molecular weights between 150 daltons and 250 daltons.
The invention provides for the use of the system for DNA
sequencing analysis, detection of single nucleotide polymorphisms, genetic mutation analysis, serial, analysis of gene expression, gene expression analysis, identification in forensics, genetic disease association studies, DNA sequencing, genomic sequencing, translational analysis, or transcriptional analysis.
-41-This invention will be better understood from the Experimental Details which follow. However, one skilled in the art will readily appreciate that the specific methods and results discussed are merely illustrative of the invention as described more fully in the claims which follow thereafter.
-42-Experimental Details 1. The Sequencing by Synthesis Approach Sequencing DNA by synthesis involves the detection of the identity of each nucleotide as it is incorporated into the growing strand of DNA in the polymerase reaction. The fundamental requirements for such a system to work are: (1) the availability of 4 nucleotide analogues (aA, aC, aG, aT) each labeled with a unique label and containing a chemical moiety capping the 3'-OH
group; (2) the 4 nucleotide analogues (aA, aC, aG, aT) need to be efficiently and faithfully incorporated by DNA polymerase as terminators in the polymerase reaction; (3) the tag and the group capping the 3'-OH

need to be removed with high yield to allow the incorporation and detection of the next nucleotide; and (4) the growing strand of DNA should survive the washing, detection and cleavage processes to remain annealed to the DNA template.

The sequencing by synthesis approach disclosed herein is illustrated in Figure 2A-2B. In Figure 2A, an example is shown where the unique labels are fluorescent dyes and the surface is a chip; in Figure 2B, the unique labels are mass tags and the surface is channels etched into a chip. The synthesis approach uses a solid surface such as a glass chip with an immobilized DNA
template that is able to self prime for initiating the polymerase reaction, and four nucleotide analogues (3'-RO-A-LABELI, 3'-RO-C-LABEL2, 3'-RO-G-LABEL3, 3'-RO-T-LABEL4) each labeled with a unique label, e.g. a fluorescent dye or a mass tag, at a specific location on the purine or
-43-pyrimidine base, and a small cleavable chemical group (R) to cap the 3'-OH group. Upon adding the four nucleotide analogues and DNA polymerase, only one nucleotide analogue that is complementary to the next nucleotide on the template is incorporated by the polymerase on each spot of the surface (step 1 in Fig.
2A and 2B).

As shown in Figure 2A, where the unique labels are dyes, after removing the excess reagents and washing away any unincorporated nucleotide analogues on the chip, a detector is used to detect the unique label. For example, a four color fluorescence imager is used to image the surface of the chip, and the unique fluorescence emission from a specific dye on the nucleotide analogues on each spot of the chip will reveal the identity of the incorporated nucleotide (step 2 in Fig. 2A). After imaging, the small amount of unreacted 3'-OH group on the self-primed template moiety is capped by excess dideoxynucleoside triphosphates (ddNTPs) (ddATP, ddGTP, ddTTP, and ddCTP) and DNA
polymerase to avoid interference with the next round of synthesis (step 3 in Fig. 2A), a concept similar to the capping step in automated solid phase DNA synthesis (Caruthers, 1985). The ddNTPs, which lack a 3'-hydroxyl group, are chosen to cap the unreacted 3'-OH of the nucleotide due to their small size compared with the dye-labeled nucleotides, and the excellent efficiency with which they are incorporated by DNA polymerase. The dye moiety is then cleaved by light (-350 nm), and the R
group protecting the 3'-OH is removed chemically to generate free 3'-OH group with high yield (step 4 in
-44-Fig. 2A) A washing step is applied to wash away the cleaved dyes and the R group. The self-primed DNA
moiety on the chip at this stage is ready for the next cycle of the reaction to identify the next nucleotide sequence of the template DNA (step 5 in Fig 2A).

It is a routine procedure now to immobilize high density (>10,000 spots per chip) single stranded DNA on a 4cm x lcm glass chip (Schena et al. 1995). Thus, in the DNA
sequencing system disclosed herein, more than 10,000 bases can be identified after each cycle and after 100 cycles, a million base pairs will be generated from one sequencing chip.

Possible DNA polymerases include Thermo Sequenase, Taq FS DNA polymerase, T7 DNA polymerase, and Vent (exo-) DNA polymerase. The fluorescence emission from each specific dye can be detected using a fluorimeter that is equipped with an accessory to detect fluorescence from a glass slide. For large scale evaluation, a multi-color scanning system capable of detecting multiple different fluorescent dyes (500 nm - 700 nm) (GSI Lumonics ScanArray 5000 Standard Biochip Scanning System) on a glass slide can be used.

An example of the sequencing by synthesis approach using mass tags is shown in Figure 2B. The approach uses a solid surface, such as a porous silica glass channels in a chip, with immobilized DNA template that is able to self prime for initiating the polymerase reaction, and four nucleotide analogues (3'-RO-A-Tag1r 3'-RO-C-Tag2r 3'-RO-G-Tag3r 3'-RO-T-Tag4) each labeled with a unique photocleavable
-45-mass tag on the specific location of the base, and a small cleavable chemical group (R) to cap the 3'-OH
group. Upon adding the four nucleotide analogues and DNA
polymerase, only one nucleotide analogue that is complementary to the next nucleotide on the template is incorporated by polymerase in each channel of the glass chip (step 1 in Fig. 2B) After removing the excess reagents and washing away any unincorporated nucleotide analogues on the chip, the small amount of unreacted 3'-OH group on the self-primed template moiety is capped by excess ddNTPs (ddATP, ddGTP, ddTTP and ddCTP) and DNA
polymerase to avoid interference with the next round of synthesis (step 2 in Fig. 2B) . The ddNTPs are chosen to cap the unreacted 3'-OH of the nucleotide due to their small size compared with the labeled nucleotides, and their excellent efficiency to be incorporated by DNA
polymerase. The mass tags are cleaved by irradiation with light (-350 nm) (step 3 in Fig. 2B) and then detected with a mass spectrometer. The unique mass of each tag yields the identity of the nucleotide in each channel (step 4 in Fig. 2B) . The R protecting group is then removed chemically and washed away to generate free 3'-OH group with high yield (step 5 in Fig. 2B) . The self-primed DNA moiety on the chip at this stage is ready for the next cycle of the reaction to identify the next nucleotide sequence of the template DNA (step 6 in Fig. 2B).

Since the development of new ionization techniques such as matrix assisted laser desorption ionization (MALDI) and electrospray ionization (ESI), mass spectrometry has become an indispensable tool in many areas of biomedical
-46-research. Though these ionization methods are suitable for the analysis of bioorganic molecules, such as peptides and proteins, improvements in both detection and sample preparation are required for implementation of mass spectrometry for DNA sequencing applications.
Since the approach disclosed herein uses small and stable mass tags, there is no need to detect large DNA
sequencing fragments directly and it is not necessary to use MALDI or ESI methods for detection. Atmospheric pressure chemical ionization (APCI) is an ionization method that uses a gas-phase ion-molecular reaction at atmospheric pressure (Dizidic et al. 1975). In this method, samples are introduced by either chromatography or flow injection into a pneumatic nebulizer where they are converted into small droplets by a high-speed beam of nitrogen gas. When the heated gas and solution arrive at the reaction area, the excess amount of solvent is ionized by corona discharge. This ionized mobile phase acts as the ionizing agent toward the samples and yields pseudo molecular (M+H)+ and (M-H)-ions. Due to the corona discharge ionization method, high ionization efficiency is attainable, maintaining stable ionization conditions with detection sensitivity lower than femtomole region for small and stable organic compounds. However, due to the limited detection of large molecules, ESI and MALDI have replaced APCI for analysis of peptides and nucleic acids. Since in the approach disclosed the mass tags to be detected are relatively small and very stable organic molecules, the ability to detect large biological molecules gained by using ESI and MALDI is not necessary. APCI has several advantages over ESI and MALDI because it does not
-47-require any tedious sample preparation such as desalting or mixing with matrix to prepare crystals on a target plate. In ESI, the sample nature and sample preparation conditions (i.e. the existence of buffer or inorganic salts) suppress the ionization efficiency. MALDI
requires the addition of matrix prior to sample introduction into the mass spectrometer and its speed is often limited by the need to search for an ideal irradiation spot to obtain interpretable mass spectra.

These limitations are overcome by APCI because the mass tag solution can be injected directly with no additional sample purification or preparation into the mass spectrometer. Since the mass tagged samples are volatile and have small mass numbers, these compounds are easily detectable by APCI ionization with high sensitivity. This system can be scaled up into a high throughput operation.

Each component of the sequencing by synthesis system is described in more detail below.

2. Construction of a Surface Containing Immobilized Self-primed DNA Moiety The single stranded DNA template immobilized on a surface is prepared according to the scheme shown in Figure 3. The surface can be, for example, a glass chip, such as a 4cm x lcm glass chip, or channels in a glass chip. The surface is first treated with 0.5 M
NaOH, washed with water, and then coated with high density 3-aminopropyltrimethoxysilane in aqueous ethanol (Woolley et al. 1994) forming a primary amine surface.
N-Hydroxy Succinimidyl (NHS) ester of triarylphosphine
-48-(1) is covalently coupled with the primary amine group converting the amine surface to a novel triarylphosphine surface, which specifically reacts with DNA containing an azido group (2) forming a chip with immobilized DNA.

Since the azido group is only located at the 5' end of the DNA and the coupling reaction is through the unique reaction of the triarylphosphine moiety with the azido group in aqueous solution (Saxon and Bertozzi 2000), such a DNA surface will provide an optimal condition for hybridization.

The NHS ester of triarylphosphine (1) is prepared according to the scheme shown in Figure 4. 3-diphenylphosphino-4-methoxycarbonyl-benzoic acid (3) is prepared according to the procedure described by Bertozzi et al. (Saxon and Bertozzi 2000). Treatment of (3) with N-Hydroxysuccinimide forms the corresponding NHS ester (4). Coupling of (4) with an amino carboxylic acid moiety produces compound (5) that has a long linker (n = 1 to 10) for optimized coupling with DNA on the surface. Treatment of (5) with N-Hydroxysuccinimide generates the NHS ester (1) which is ready for coupling with the primary amine coated surface (Figure 3).

The azido labeled DNA (2) is synthesized according to the scheme shown in Figure 5. Treatment of ethyl ester of 5-bromovaleric acid with sodium azide and then hydrolysis produces 5-azidovaleric acid (Khoukhi et al., 1987), which is subsequently converted to a NHS ester for coupling with an amino linker modified oligonucleotide primer. Using the azido-labeled primer to perform polymerase chain reaction (PCR) reaction
-49-generates azido-labeled DNA template (2) for coupling with the triarylphosphine-modified surface (Figure 3).
The self-primed DNA template moiety on the sequencing chip is constructed as shown in Figure 6 (A & B) using enzymatic ligation. A 5'-phosphorylated, 3'-OH capped loop oligonucleotide primer (B) is synthesized by a solid phase DNA synthesizer. Primer (B) is synthesized using a modified C phosphoramidite whose 3'-OH is capped with either a MOM (-CH2OCH3) group or an allyl (-CH2CH=CH2) group (designated by "R" in Figure 6) at the 3'-end of the oligonucleotide to prevent the self ligation of the primer in the ligation reaction. Thus, the looped primer can only ligate to the 3'-end of the DNA templates that are immobilized on the sequencing chip using T4 RNA ligase (Zhang et al. 1996) to form the self-primed DNA template moiety (A) . The looped primer (B) is designed to contain a very stable loop (Antao et al. 1991) and a stem containing the sequence of M13 reverse DNA sequencing primer for efficient priming in the polymerase reaction once the primer is ligated to the immobilized DNA on the sequencing chip and the 3'-OH
cap group is chemically cleaved off (Ireland et al.
1986; Kamal et al. 1999).

3. Sequencing by Synthesis Evaluation Using Nucleotide Analogues 3' -HO-A-Dyel , 3' -HO-C-Dye2 r 3' -HO'-G-Dye3 r 3' -HO-T-Dye4 A scheme has been developed for evaluating the photocleavage efficiency using different dyes and testing the sequencing by synthesis approach. Four nucleotide analogues 3'-HO-A-Dyelr 3'-HO-C Dye2r 3'-H0-G-"Dye3, 3'-
-50-HO-T-Dye4 each labeled with a unique fluorescent dye through a photocleavable linker are synthesized and used in the sequencing by synthesis approach. Examples of dyes include, but are not limited to: Dyel = FAM, 5-carboxyfluorescein; Dye2 = R6G, 6-carboxyrhodamine-6G;
Dye3 = TAM, N,N,N',N'-tetramethyl-6-carboxyrhodamine;
and Dye4 = ROX, 6-carboxy-X-rhodamine. The structures of the 4 nucleotide analogues are shown in Figure 7 (R =
h).

The photocleavable 2-nitrobenzyl moiety has been used to link biotin to DNA and protein for efficient removal by QV light (- 350 nm) (Olejnik et al. 1995, 1999). In the approach disclosed herein the 2-nitrobenzyl group is used to bridge the fluorescent dye and nucleotide together to form the dye labeled nucleotides as shown in Figure 7.

As a representative example, the synthesis of 3'-HO-G-Dye3 (Dye3 = Tam) is shown in Figure 8. 7-deaza-alkynylamino-dGTP is prepared using well-established procedures (Prober et al. 1987; Lee et al. 1992 and Hobbs et al. 1991). Linker-Tam is synthesized by coupling the Photocleavable Linker (Rollaf 1982) with NHS-Tam. 7-deaza-alkynylamino-dGTP is then coupled with the Linker-Tam to produce 31-HO-G- TAM, The nucleotide analogues with a free 3'-OH (i.e., R = H) are good substrates for the polymerase. An immobilized DNA
template is synthesized (Figure 9) that contains a portion of nucleotide sequence ACGTACGACGT (SEQ ID NO:
1) that has no repeated sequences after the priming .site. 3'-HO-A-Dye1 and DNA polymerase are added to the
-51-self-primed DNA moiety and it is incorporated to the 3' site of the DNA. Then the steps in Figure 2A are followed (the chemical cleavage step is not required here because the 3'-OH is free) to detect the fluorescent signal from Dye-1 at 520 nm. Next, 3'-HO-C-Dye2 is added to image the fluorescent signal from Dye-2 at 550 nm. Next, 3'-HO-'G-Dye3 is added to image the fluorescent signal from Dye-3 at 580 nm, and finally 3'-HO-T-Dye4 is added to image the fluorescent signal from Dye-4 at 610 nm.

Results on photochemical cleavage efficiency The expected photolysis products of DNA containing a photocleavable fluorescent dye at the 3' end of the DNA
are shown in Figure 10. The 2-nitrobenzyl moiety has been successfully employed in a wide range of studies as a photocleavable-protecting group (Pillai 1980). The efficiency of the photocleavage step depends on several factors including the efficiency of light absorption by the 2-nitrobenzyl moiety, the efficiency of the primary photochemical step, and the efficiency of the secondary thermal processes which lead to the final cleavage process (Turro 1991). Burgess et al. (1997) have reported the successful photocleavage of a fluorescent dye attached through a 2-nitrobenzyl linker on a nucleotide moiety, which shows that the fluorescent dye is not quenching the photocleavage process. A
photoliable protecting group based on the 2-nitrobenzyl chromophore has also been developed for biological labeling applications that involve photocleavage (Olejnik et al. 1999). The protocol disclosed herein is used to optimize the photocleavage process shown in
-52-Figure 10. The absorption spectra of 2-nitro benzyl compounds are examined and compared quantitatively to the absorption spectra of the fluorescent dyes. Since there will be a one-to-one relationship between the number of 2-nitrobenzyl moieties and the dye molecules, the ratio of extinction coefficients of these two species will reflect the competition for light absorption at specific wavelengths. From this information, the wavelengths at which the 2-nitrobenzyl moieties absorbed most competitively can be determined, similar to the approach reported by Olejnik et al.(1995).

A photolysis setup can be used which allows a high throughput of monochromatic light from a 1000 watt high pressure xenon lamp (LX1000UV, ILC) in conjunction with a monochromator (Kratos, Schoeffel Instruments) . This instrument allows the evaluation of the photocleavage of model systems as a function of the intensity and excitation wavelength of the absorbed light. Standard analytical analysis is used to determine the extent of photocleavage. From this information, the efficiency of the photocleavage as a function of wavelength can be determined. The wavelength at which photocleavage occurs most efficiently can be selected as for use in the sequencing system.

Photocleavage results have been obtained using a model system as shown in Figure 11. Coupling of PC-LC-Biotin-NHS ester (Pierce, Rockford IL) with 5-(aminoacetamido)-fluorescein (5-aminoFAM) (Molecular Probes, Eugene OR) in dimethylsulfonyl oxide
-53-(DMSO) /NaHC03 (pH=8.2) overnight at room temperature produces PC-LC-Biotin-FAM which is composed of a biotin at one end, a photocleavable 2-nitrobenzyl group in the middle, and a dye tag (FAM) at the other end. This photocleavable moiety closely mimics the designed photocleavable nucleotide analogues shown in Figure 10.
Thus the successful photolysis of the PC-LC-Biotin-FAM
moiety provides proof of the principle of high efficiency photolysis as used in the DNA sequencing system. For photolysis study, PC-LC-Biotin-FAM is first immobilized on a microscope glass slide coated with streptavidin (XENOPORE, Hawthorne NJ). After washing off the non-immobilized PC-LC-Biotin-FAM, the fluorescence emission spectrum of the immobilized PC-LC-Biotin-FAM was taken as shown in Figure 12 (Spectrum a).
The strong fluorescence emission indicates that PC-LC-Biotin-FAM is successfully immobilized to the streptavidin coated slide surface. The photocleavability of the 2-nitrobenzyl linker by irradiation at 350 nm was then tested. After 10 minutes of photolysis (Airy = 350 nm; -0.5 mW/cm2) and before any washing, the fluorescence emission spectrum of the same spot on the slide was taken that showed no decrease in intensity (Figure 12, Spectrum b), indicating that the dye (FAM) was not bleached during the photolysis process at 350 nm. After washing the glass slide with HPLC
water following photolysis, the fluorescence emission spectrum of the same spot on the slide showed significant intensity decrease (Figure 12, Spectrum c) which indicates that most of the fluorescence dye (FAM) was cleaved from the immobilized biotin moiety and was removed by the washing procedure. This experiment shows *Trade-mark
-54-that high efficiency cleavage of the fluorescent dye can be obtained using the 2-nitrobenzyl photocleavable linker.

4. Sequencing by Synthesis Evaluation Using Nucleotide Analogues 3' -RO-A-Dye1 r 3' -RO-C-Dye2 r 3' -RO-CG-Dye3 r 3' -RO-T-Dye4 Once the steps and conditions in Section 3 are optimized, the synthesis of nucleotide analogues 3'-RO-A-Dyel r 3' -RO-G-Dye2, 3' -RO-G-Dye3 r 3' -RO-T-Dye4 can be pursued for further study of the system. Here the 3'-OH is capped in all four nucleotide analogues, which then can be mixed together with DNA polymerase and used to evaluate the sequencing system using the scheme in Figure 9. The MOM (-CH2OCH3) or allyl (-CH2CH=CH2) group is used to cap the 31-OH group using well-established synthetic procedures (Figure 13) (Fuji et al. 1975, Metzker et al.
1994). These groups can be removed chemically with high yield as shown in Figure 14 (Ireland, et al. 1986; Kamal et al. 1999) . The chemical cleavage of the MOM and allyl groups is fairly mild and specific, so as not to degrade the DNA template moiety. For example, the cleavage of the allyl group takes 3 minutes with more than 93% yield (Kamal et al. 1999), while the MOM group is reported to be cleaved with close to 100% yield (Ireland, et al. 1986).

5. Using Energy Transfer Coupled Dyes To Optimize The Sequencing By Synthesis System The spectral property of the fluorescent tags can be optimized by using energy transfer (ET) coupled dyes.
-55-The ET primer and ET dideoxynucleotides have been shown to be a superior set of reagents for 4-color DNA
sequencing that allows the use of one laser to excite multiple sets of fluorescent tags (Ju et al. 1995) . It has been shown that DNA polymerase (Thermo Sequenase and Taq FS) can efficiently incorporate the ET dye labeled dideoxynucleotides (Rosenblum et al. 1997) . These ET
dye-labeled sequencing reagents are now widely used in large scale DNA sequencing projects, such as the human genome project. A library of ET dye labeled nucleotide analogues can be synthesized as shown in Figure' 15 for optimization of the DNA sequencing system. The ET dye set (FAM-C12FAM, FAM-C12R6G, FAM-C12TAM, FAM-C12ROX) using FAM as a donor and dichloro(FAM, R6G, TAM, ROX) as acceptors has been reported in the literature (Lee et al. 1997) and constitutes a set of commercially available DNA sequencing reagents. These ET dye sets have been proven to produce enhanced fluorescence intensity, and the nucleotides labeled with these ET
dyes at the 5-position of T and C and the 7-position of G and A are excellent substrates of DNA polymerase.
Alternatively, an ET dye set can be constructed using cyanine (Cy2) as a donor and C12FAM, C12R6G, C12TAM, or C12ROX as energy acceptors. Since Cy2 possesses higher molar absorbance compared with the rhodamine and fluorescein derivatives, an ET system using Cy2 as a donor produces much stronger fluorescence signals than the system using FAM as a donor (Hung et al. 1996).
Figure 16 shows a synthetic scheme for an ET dye labeled nucleotide analogue with Cy2 as a donor and C12FAM as an acceptor using similar coupling chemistry as for the synthesis of an energy transfer system using FAM as a *Trade-mark
-56-donor (Lee et al. 1997) Coupling of C12FAM (I) with spacer 4-aminomethylbenzoic acid (II) produces III, which is then converted to NHS ester IV. Coupling of IV
with amino-Cy2, and then converting the resulting compound to a NHS ester produces V, which subsequently couples with amino-photolinker nucleotide VI yields the ET dye labeled nucleotide VII.

6. Sequencing by synthesis evaluation using nucleotide analogues 3' -HO-A-Tag1 r 3' -HO-C- Tag2 r 3' -HO-G- Tag3 r 3' -HO-T- Tag4 The precursors of four examples of mass tags are shown in Figure 17. The precursors are: (a) acetophenone; (b) 3-fluoroacetophenone; (c) 3,4-difluoroacetophenone; and (d) 3,4-dimethoxyacetophenone. Upon nitration and reduction, four photoactive tags are produced from the four precursors and used to code for the identity of each of the four nucleotides (A, C, G, T) . Clean APCI
mass spectra are obtained for the four mass tag precursors (a, b, c, d) as shown in Figure 18. The peak with m/z of 121 is a, 139 is b, 157 is c, and 181 is d.
This result shows that these four mass tags are extremely stable and produce very high resolution data in an APCI mass spectrometer with no cross talk between the mass tags. In the examples shown below, each of the unique m/z from each mass tag translates to the identity of the nucleotide [Tag-1 (m/z,150) = A; Tag-2 (m/z,168) = C; Tag-3 (m/z,186) = G; Tag-4 (m/z,210) = T].

Different combinations of mass tags and nucleotides can be used, as indicated by the general scheme: 3'-HO-A-Tagir 3'-HO-C-Tag2, 3'-HO-G-Tag3, 3'-HO-T-Tag4 where Tagl, Tag2, Tag3,
-57-and Tag4 are four different unique cleavable mass tags.
Four specific examples of nucleotide analogues are shown in Figure 19. In Figure 19, "R" is H when the 3'-OH
group is not capped. As discussed above, the photo cleavable 2-nitro benzyl moiety has been used to link biotin to DNA and protein for efficient removal by UV
light 350 nm) irradiation (Olejnik et al. 1995, 1999). Four different 2-nitro benzyl groups with different molecular weights as mass tags are used to form the mass tag labeled nucleotides as shown in Figure 19: 2-nitro-a-methyl-benzyl (Tag-1) codes for A; 2-nitro-a-methyl-3-fluorobenzyl (Tag-2) codes for C; 2-nitro-a-methyl-3,4-difluorobenzyl (Tag-3) codes for G;
2-nitro-a-methyl-3,4-dimethoxybenzyl (Tag-4) codes for T.

As a representative example, the synthesis of the NHS
ester of one mass tag (Tag-3) is shown in Figure 20. A
similar scheme is used to create the other mass tags.
The synthesis of 3'-HO-G-Tag3 is shown in Figure 21 using well-established procedures (Prober et al. 1987; Lee et al. 1992 and Hobbs et al. 1991) . 7-propargylamino- dGTP
is first prepared by reacting 7-I-dGTP with N-trifluoroacetylpropargyl amine, which is then coupled with the NHS-Tag-3 to produce 3'-HO-G- Tag3. The nucleotide analogues with a free 3'-OH are good substrates for the polymerase.

The sequencing by synthesis approach can be tested using mass tags using a scheme similar to that show for dyes in Figure 9. A DNA template containing a portion of nucleotide sequence that has no repeated sequences after
-58-the priming site, is synthesized and immobilized to a glass channel. 3'-HO-A-Tagl and DNA polymerase are added to the self-primed DNA moiety to allow the incorporation of the nucleotide into the 3' site of the DNA. Then the steps in Figure 2B are followed (the chemical cleavage is not required here because the 3'-OH is free) to detect the mass tag from Tag-1 (m/z = 150). Next, 3'-Ho-C- Tag2 is added and the resulting mass spectra is measured after cleaving Tag-2 (m/z = 168). Next, 3'-HO-G-Tag3 and 3'-HO-T- Tag4 are added in turn and the mass spectra of the cleavage products Tag-3 (m/z =186) and Tag-4 (m/z = 210) are measured. Examples of expected photocleavage products are shown in Figure 22. The photocleavage mechanism is as described above for the case where the unique labels are dyes. Light absorption (300 - 360 nm) by the aromatic 2-nitro benzyl moiety causes reduction of the 2-nitro group to a nitroso group and an oxygen insertion into the carbon-hydrogen bond located in the 2-position followed by cleavage and decarboxylation (Pillai 1980).

The synthesis of nucleotide analogues 3'-RO-A-Tagl, 3'-RO-C-Tag2, 3'-RO-G-Tag3, 3'-RO-T-Tag4 can be pursued for further study of the system a discussed above for the case where the unique labels are dyes. Here the 3'-OH is capped in all four nucleotide analogues, which then can be mixed together with DNA polymerase and used to evaluate the sequencing system using a scheme similar to that in Figure 9. The MOM (-CH20CH3) or allyl (-CH2CH=CH2) group is used to cap the 3'-OH group using well-established synthetic procedures (Figure 13) (Fuji et al. 1975, Metzker et al. 1994). These groups can be removed
-59-chemically with high yield as shown in Figure 14 (Ireland, et al. 1986; Kamal et al. 1999). The chemical cleavage of the MOM and allyl groups is fairly mild and specific, so as not to degrade the DNA template moiety.

7. Parallel Channel System for Sequencing by Synthesis Figure 23 illustrates an example of a parallel channel system. The system can be used with mass tag labels as shown and also with dye labels. A plurality of channels in a silica glass chip are connected on each end of the channel to a well in a well plate. In the example shown there are 96 channels each connected to its own wells.
The sequencing system also permits a number of channels other than 96 to be used. 96 channel devices for separating DNA sequencing and sizing fragments have been reported (Woolley and Mathies 1994, Woolley et al. 1997, Simpson et al. 1998). The chip is made by photolithographic masking and chemical etching techniques. The photolithographically defined channel patterns are etched in a silica glass substrate, and then capillary channels (id - 100 pm) are formed by thermally bonding the etched substrate to a second silica glass slide. Channels are porous to increase surface area. The immobilized single stranded DNA
template chip is prepared according to the scheme shown in Figure 3. Each channel is first treated with 0.5 M
NaOH, washed with water, and is then coated with high density 3-aminopropyltrimethoxysilane in aqueous ethanol (Woolley et al. 1994) forming a primary amine surface.
Succinimidyl (NHS) ester of triarylphosphine (1) is covalently coupled with the primary amine group converting the amine surface to a novel triarylphosphine
-60-surface, which specifically reacts with DNA containing an azido group (2) forming a chip with immobilized DNA.
Since the azido group is only located at the 5' end of the DNA and the coupling reaction is through the unique reaction of triarylphosphine moiety with azido group in aqueous solution (Saxon and Bertozzi 2000), such a DNA
surface provides an optimized condition for hybridization. Fluids, such as sequencing reagents and washing solutions, can be easily pressure driven between the two 96 well plates to wash and add reagents to each channel in the chip for carrying out the polymerase reaction as well as collecting the photocleaved labels.
The silica chip is transparent to ultraviolet light (A ti 350 nm) . In the Figure, photocleaved mass tags are detected by an APCI mass spectrometer upon irradiation with a UV light source.

8. Parallel Mass Tag Sequencing by Synthesis System The approach disclosed herein comprises detecting four unique photoreleased mass tags, which can have molecular weights from 150 to 250 daltons, to decode the DNA
sequence, thereby obviating the issue of detecting large DNA fragments using a mass spectrometer as well as the stringent sample requirement for using mass spectrometry to directly detect long DNA fragments. It takes 10 seconds or less to analyze each mass tag using the APCI
mass spectrometer. With 8 miniaturized APCI mass spectrometers in a system, close to 100,000 bp of high quality digital DNA sequencing data could be generated each day by each instrument using this approach. Since there is no separation and purification requirements using this approach, such a system is cost effective.
-61-To make mass spectrometry competitive with a 96 capillary array method for analyzing DNA, a parallel mass spectrometer approach is needed. Such a complete system has not been reported mainly due to the fact that most of the mass spectrometers are designed to achieve adequate resolution for large biomolecules. The system disclosed herein requires the detection of four mass tags, with molecular weight range between 150 and 250 daltons, coding for the identity of the four nucleotides (A, C, G, T) Since a mass spectrometer dedicated to detection of these mass tags only requires high resolution for the mass range of 150 to 250 daltons instead of covering a wide mass range, the mass spectrometer can be miniaturized and have a simple design. Either quadrupole (including ion trap detector) or time-of-flight mass spectrometers can be selected for the ion optics. While modern mass spectrometer technology has made it possible to produce miniaturized mass spectrometers, most current research has focused on the design of a single stand-alone miniaturized mass spectrometer. Individual components of the mass spectrometer has been miniaturized for enhancing the mass spectrometer analysis capability (Liu et al. 2000, Zhang et al. 1999) . A miniaturized mass spectrometry system using multiple analyzers (up to 10) in parallel has been reported (Badman and Cooks 2000) However, the mass spectrometer of Badman and Cook was designed to measure only single samples rather than multiple samples in parallel. They also noted that the miniaturization of the ion trap limited the capability of the mass spectrometer to scan wide mass ranges. Since the
-62-approach disclosed herein focuses on detecting four small stable mass tags (the mass range is less than 300 daltons), multiple miniaturized APCI mass spectrometers are easily constructed and assembled into a single unit for parallel analysis of the mass tags for DNA
sequencing analysis.

A complete parallel mass spectrometry system includes multiple APCI sources interfaced with multiple analyzers, coupled with appropriate electronics and power supply configuration. A mass spectrometry system with parallel detection capability will overcome the throughput bottleneck issue for application in DNA
analysis. A parallel system containing multiple mass spectrometers in a single device is illustrated in Figures 23 and 24. The examples in the figures show a system with three mass spectrometers in parallel. Higher throughput is obtained using a greater number of in parallel mass spectrometers.

As illustrated in Figure 24, the three miniature mass spectrometers are contained in one device with two turbo-pumps. Samples are injected into the ion source where they are mixed with a nebulizer gas and ionized.
One turbo pump is used as a differential pumping system to continuously sweep away free radicals, neutral compounds and other undesirable elements coming from the ion source at the orifice between the ion source and the analyzer. The second turbo pump is used to generate a continuous vacuum in all three analyzers and detectors simultaneously. Since the corona discharge mode and
-63-scanning mode of mass spectrometers are the same for each miniaturized mass spectrometer, one power supply for each analyzer and the ionization source can provide the necessary power for all three instruments. One power supply for each of the three independent detectors is used for spectrum collection. The data obtained are transferred to three independent A/D converters and processed by the data system simultaneously to identify the mass tag in the injected sample and thus identify the nucleotide. Despite containing three mass spectrometers, the entire device is able to fit on a laboratory bench top.

9. Validate the Complete Sequencing by Synthesis System By Sequencing P53 Genes The tumor suppressor gene p53 can be used as a model system to validate the DNA sequencing system. The p53 gene is one of the most frequently mutated genes in human cancer (O'Connor et al. 1997). First, a base pair DNA template (shown below) is synthesized containing an azido group at the 5' end and a portion of the sequences from exon 7 and exon 8 of the p53 gene:
5'-N3-TTCCTGCATGGGCGGCATGAACCCGAGGCCCATCCTCACCATCATCAC
ACTGGAAGACTCCAGTGGTAATCTACTGGGACGGAACAGCTTTGAGGTGCATT
-3' (SEQ ID NO: 2).

This template is chosen to explore the use of the sequencing system for the detection of clustered hot spot single base mutations. The potentially mutated bases are underlined (A, G, C and T) in the synthetic template. The synthetic template is immobilized on a
-64-sequencing chip or glass channels, then the loop primer is ligated to the immobilized template as described in Figure 6, and then the steps in Figure 2 are followed for sequencing evaluation. DNA templates generated by PCR can be used to further validate the DNA sequencing system. The sequencing templates can be generated by PCR using flanking primers (one of the pair is labeled with an azido group at the 5' end) in the intron region located at each p53 exon boundary from a pool of genomic DNA (Boehringer, Indianapolis, IN) as described by Fu et al. (1998) and then immobilized on the DNA chip for sequencing evaluation.
-65-References Antao VP, Lai SY, Tinoco I Jr. (1991) A thermodynamic study of unusually stable RNA and DNA hairpins. Nucleic Acids Res. 19: 5901-5905..

Axelrod VD, Vartikyan RM, Aivazashvili VA, Beabealashvili RS. (1978) Specific termination of RNA
polymerase synthesis as a method of RNA and DNA
sequencing. Nucleic Acids Res. 5(10): 3549-3563.

Badman ER and Cooks RG. (2000) Cylindrical Ion Trap Array with Mass Selection by Variation in Trap Dimensions Anal. Chem. 72(20):5079-5086.

Badman ER and Cooks RG. (2000) A Parallel Miniature Cylindrical Ion Trap Array. Anal. Chem. 72(14):3291-3297.

Bowling JM, Bruner KL, Cmarik JL, Tibbetts C. (1991) Neighboring nucleotide interactions during DNA
sequencing gel electrophoresis. Nucleic Acids Res. 19:
3089-3097.

Burgess K, Jacutin SE, Lim D, Shitangkoon A. (1997) An approach to photolabile, fluorescent protecting groups.
J. Org. Chem. 62(15): 5165-5168.

Canard B, Cardona B, Sarfati RS. (1995) Catalytic editing properties of DNA polymerases. Proc. Natl. Acad.
Sci. USA 92: 10859-10863.
-66-Caruthers MH. (1985) Gene synthesis machines: DNA
chemistry and its uses. Science 230: 281-285.

Chee M, Yang R, Hubbell E, Berno, A, Huang, XC., Stern D, Winkler, J, Lockhart DJ, Morris M S, Fodor, SP.
(1996) Accessing genetic information with high-density DNA arrays. Science. 274: 610-614.

Cheeseman PC. Method For Sequencing Polynucleotides, United States Patent No. 5,302,509, issued April 12, 1994.

Dizidic I, Carrol, DI, Stillwell, RN, and Horning, MG.
(1975) Atmospheric pressure ionization (API) mass spectrometry: formation of phenoxide ions from chlorinated aromatic compounds Anal. Chem.,47:1308-1312.
Fu DJ, Tang K, Braun A, Reuter D, Darnhofer-Demar B, Little DP, O'Donnell MJ, Cantor CR, Koster H. (1998) Sequencing exons 5 to 8 of the p53 gene by MALDI-TOF
mass spectrometry. Nat Biotechnol. 16: 381-384.

Fuji K, Nakano S, Fujita E. (1975) An improved method for methoxymethylation of alcohols under mild acidic conditions. Synthesis 276-277.

Hobbs FW Jr, Cocuzza AJ. Alkynylamino-Nucleotides.
United States Patent No. 5,047,519, issued September 10, 1991.

Hung SC; Ju J; Mathies RA; Glazer AN. (1996) Cyanine dyes with high absorption cross section as donor
-67-chromophores in energy transfer primers. Anal Biochem.
243(l): 15-27.

Hyman ED, (1988) A new method of sequencing DNA.
Analytical Biochemistry 174: 423-436.

Ireland RE, Varney MD (1986) Approach to the total synthesis of chlorothricolide-synthesis of (+/-)-19.20-dihydro-24-O-methylchlorothricolide, methyl-ester, ethyl carbonate. J. Org. Chem. 51: 635-648.

Ju J, Glazer AN, Mathies RA. (1996) Cassette labeling for facile construction of energy transfer fluorescent primers. Nucleic Acids Res. 24: 1144-1148.

Ju J, Ruan C, Fuller CW, Glazer AN Mathies RA. (1995) Energy transfer fluorescent dye-labeled primers for DNA
sequencing and analysis. Proc. Natl. Acad. Sci. USA 92:
4347-4351.

Kamal A, Laxman E, Rao NV. (1999) A mild and rapid regeneration of alcohols from their allylic ethers by chlorotrimethylsilane/sodium iodide. Tetrahedron letters 40: 371-372.

Kheterpal I, Scherer J, Clark SM, Radhakrishnan A, Ju J, Ginther CL, Sensabaugh GF, Mathies RA. (1996) DNA
Sequencing Using a Four-Color Confocal Fluorescence Capillary Array Scanner. Electrophoresis. 17: 1852-1859.
-68-Khoukhi N, Vaultier M, Carrie R. (1987) Synthesis and reactivity of methyl-azido butyrates and ethyl-azido valerates and of the corresponding acid chlorides as useful reagents for the aminoalkylation. Tetrahedron 43:
1811-1822.

Lee LG, Connell CR, Woo SL, Cheng RD, Mcardle BF, Fuller CW, Halloran ND, Wilson RK. (1992) DNA sequencing with dye-labeled terminators and T7 DNA -polymerase-effect of dyes and dNTPs on incorporation of dye-terminators and probability analysis of termination fragments. Nucleic Acids Res. 20: 2471-2483.

Lee LG, Spurgeon SL, Heiner CR, Benson SC, Rosenblum BB, Menchen SM, Graham RJ, Constantinescu A, upadhya KG, Cassel JM, (1997) New energy transfer dyes for DNA
sequencing. Nucleic Acids Res. 25: 2816-2822.

Liu H.H., Felton C.,Xue Q.F., Zhang B., Jedrzejewski P., Karger B.L. and Foret F. (2000) Development of multichannel Devices with an Array of Electrospray tips for high-throughput mass spectrometry. Anal. Chem.
72:3303-3310.

Metzker ML, Raghavachari R, Richards S, Jacutin SE, Civitello A, Burgess K, Gibbs RA. (1994) Termination of DNA synthesis by novel 31-modified-deoxyribonucleoside 5'-triphosphates. Nucleic Acids Res. 22: 4259-4267.

O'Connor PM, Jackman J, Bae I, Myers TG, Fan S, Mutoh M, Scudiero DA, Monks A, Sausville EA, Weinstein JN, Friend S, Fornace AJ Jr, Kohn KW. (1997)
-69-Characterization of the p53 tumor suppressor pathway in cell lines of the National Cancer Institute anticancer drug screen and correlations with the growth-inhibitory potency of 123 anticancer agents. Cancer Res. 57: 4285-4300.

Olejnik J, Ludemann HC, Krzymanska-Olejnik E, Berkenkamp S, Hillenkamp F, Rothschild KJ. (1999) Photocleavable peptide-DNA conjugates: synthesis and applications to DNA analysis using MALDI-MS. Nucleic Acids Res. 27:
4626-4631.

Olejnik J, Sonar S, Krzymanska-Olejnik E, Rothschild KJ.
(1995) Photocleavable biotin derivatives: a versatile approach for the isolation of biomolecules. Proc. Natl.
Acad. Sci. USA. 92: 7590-7594.

Pelletier H, Sawaya MR, Kumar A, Wilson SH, Kraut J.
(1994) Structures of ternary complexes of rat DNA
polymerase 5, a DNA template-primer, and ddCTP. Science 264: 1891-1903.

Pennisi E. (2000) DOE Team Sequences Three Chromosomes.
Science 288: 417 - 419.

Pillai VNR. (1980) Photoremovable Protecting Groups in Organic Synthesis. Synthesis 1-62.

Prober JM, Trainor GL, Dam RJ, Hobbs FW, Robertson CW, Zagursky RJ, Cocuzza AJ, Jensen MA, Baumeister K. (1987) A system for rapid DNA sequencing with fluorescent
-70-chain-terminating dideoxynucleotides. Science 238: 336-341.

Rollaf F. (1982) Sodium-borohydride reactions under phase-transfer conditions - reduction of azides to amines. J. Org. Chem. 47: 4327-4329.

Ronaghi M, Uhlen M, Nyren P. (1998) A sequencing Method based on real-time pyrophosphate. Science 281: 364-365.

Rosenblum BB, Lee LG, Spurgeon SL, Khan SH, Menchen SM, Feiner CR, Chen SM. (1997) New dye-labeled terminators for improved DNA sequencing patterns. Nucleic Acids Res.
25: 4500-4504.

Roses A. (2000) Pharmacogenetics and the practice of medicie. Nature. 405: 857-865.

Salas-Solano 0, Carrilho E, Kotler L, Miller AW, Goetzinger W, Sosic Z, Karger BL, (1998) Routine DNA
sequencing of 1000 bases in less than one hour by capillary electrophoresis with replaceable linear polyacrylamide solutions. Anal. Chem. 70: 3996-4003.

Saxon E and Bertozzi CR (2000) Cell surface engineering by a modified Staudinger reaction. Science 287: 2007-2010.

Schena M, Shalon D, Davis, R. Brown P.O. (1995) Quantitative monitoring of gene expression patterns with a cDNA microarray. Science 270: 467-470.
-71-Simpson PC, Adam DR, Woolley T, Thorsen T, Johnston R, Sensabaugh GF, and Mathies RA. (1998) High-throughput genetic analysis using microfabricated 96-sample capillary array electrophoresis microplates. Proc. Natl.
Acad. Sci. U. S. A. 95:2256-2261.

Smith LM, Sanders JZ, Kaiser RJ, Hughes P, Dodd C, Connell CR, Heiner C, Kent SBH, Hood LE. (1986) Fluorescence detection in automated DNA sequencing analysis. Nature 321: 674-679.

Tabor S, Richardson C.C. (1987) DNA sequence analysis with a modified bacteriophage T7 DNA polymerase. Proc.
Natl. Acad. Sci. U.S.A. 84: 4767-4771.

Tabor S. & Richardson, CC. (1995) A single residue in DNA polymerases of the Escherichia coli DNA polymerase I
family is critical for distinguishing between deoxy- and dideoxyribonucleotides. Proc. Natl. Acad. Sci. U.S.A.
92: 6339-6343.

Turro NJ. (1991) Modern Molecular Photochemistry;
University Science Books, Mill Valley, CA.

Velculescu VE, Zhang, I, Vogeistein, B. and Kinzler KW
(1995) Serial Analysis of Gene Expression. Science 270:
484-487.

Welch MB, Burgess K, (1999) Synthesis of fluorescent, photolabile 3'-O-protected nucleoside triphosphates for the base addition sequencing scheme. Nucleosides and Nucleotides 18:197-201.
-72-Woolley AT, Mathies RA. (1994) Ultra-high-speed DNA
fragment separations using microfabricated capillary array electrophoresis chips. Proc. Natl. Acad. Sci.
USA. 91: 11348-11352.

Woolley AT, Sensabaugh GF and Mathies RA. (1997) High-Speed DNA Genotyping Using Microfabricated Capillary Array Electrophoresis Chips, Anal. Chem. 69(11);2181-2186.

Yamakawa H, Ohara O. (1997) A DNA cycle sequencing reaction that minimizes compressions on automated fluorescent sequencers. Nucleic. Acids. Res. 25: 1311-1312.

Zhang XH, Chiang VL, (1996) Single-stranded DNA ligation by T4 RNA ligase for PCR cloning of 5'-noncoding fragments and coding sequence of a specific gene.
Nucleic Acids Res. 24: 990-991.

Zhang B., Liu H. Karger BL. Foret F. (1999) Microfabricated devices for capillary electrophoresis-electrospray mass spectrometry. Anal. Chem. 71:3258-3264.

Zhu Z, Chao J, Yu H, Waggoner AS. (1994) Directly labeled DNA probes using fluorescent nucleotides with different length linkers. Nucleic Acids Res. 22: 3418-3422.

-72a-SEQUENCE LISTING

<110> The Trustees Of Columbia University In The City Of New York <120> Massive Parallel Method For Decoding DNA And RNA

<130> 7579-159CA FC/gc <140> 2,425,112 <141> 2001-10-05 <150> 09/684,670 <151> 2000-10-06 <150> 60/300,894 <151> 2001-06-26 <160> 2 <170> Patentln Ver. 2.1 <210> 1 <211> 11 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: template <400> 1 acgtacgacg t 11 <210> 2 <211> 101 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: template <400> 2 ttcctgcatg ggcggcatga acccgaggcc catcctcacc atcatcacac tggaagactc 60 cagtggtaat ctactgggac ggaacagctt tgaggtgcat t 101

Claims (10)

What is claimed:
1. A method for simultaneously sequencing a plurality of different nucleic acids, comprising:

a) providing a plurality of different nucleic acids immobilized on a solid support, a DNA polymerase, primers capable of hybridizing to said plurality of different nucleic acids, and four different nucleotide analogues, wherein each nucleotide analogue comprises a nucleotide having i) a base labeled with a different label attached through a chemically cleavable linker and ii) a chemical moiety of less than 300 daltons in mass capping the 3'-OH group, wherein said chemical moiety is removable by chemical means and is not a fluorescent dye;

b) incorporating with said DNA polymerase one or more of said nucleotide analogues into said primers to create a plurality of different extension strands; and c) detecting said label of each of said incorporated nucleotide analogues, so as to thereby identify each of the incorporated nucleotide analogue in said plurality of different extension strands thereby simultaneously sequencing a plurality of different nucleic acids.
2. The method of Claim 1, further comprising:

d) removing by chemical means the chemical moiety of each of said incorporated nucleotide analogues capping the 3'-OH group, so as to permit incorporation of another analogue into each of said extension strand.
3. The method of Claim 1, wherein said incorporating in step b) comprises hybridizing primers to said different nucleic acids.
4. The method of Claim 1, wherein said label is fluorescent.
5. The method of Claim 1, wherein at least one of said nucleotide analogues is a deaza analogue.
6. A plurality of different nucleic acids immobilized on a solid support and hybridized to primers, a portion of said primers comprising incorporated nucleotide analogues, said nucleotide analogues comprising i) a base labeled with a different removable label attached through a cleavable linker and ii) a chemical moiety of less than 300 daltons in mass capping the 3'-OH group, wherein said chemical moiety removable by chemical means and is not a fluorescent dye.
7. The plurality of different nucleic acids of Claim 6, wherein each nucleotide analogue comprises a base selected from the group consisting of adenine, guanine, cytosine, thymine, and uracil, and their analogues.
8. The plurality of different nucleic acids of Claim 6, wherein at least one of said nucleotide analogues is a deaza analogue.
9. The plurality of different nucleic acids of Claim 6, wherein said nucleotide analogues are selected from the group consisting of cytosine, thymine, deaza-adenine and deaza-guanine, and wherein said unique removable label is attached through a cleavable linker to a 5-position of cytosine or thymine or to a 7-position of deaza-adenine or deaza-guanine.
10. The method of Claim 1, wherein at least 100,000 different nucleic acid sequences spotted on a surface are simultaneously sequenced.
CA2425112A 2000-10-06 2001-10-05 Massive parallel method for decoding dna and rna Expired - Lifetime CA2425112C (en)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
US68467000A 2000-10-06 2000-10-06
US09/684,670 2000-10-06
US30089401P 2001-06-26 2001-06-26
US60/300,894 2001-06-26
PCT/US2001/031243 WO2002029003A2 (en) 2000-10-06 2001-10-05 Massive parallel method for decoding dna and rna

Publications (2)

Publication Number Publication Date
CA2425112A1 CA2425112A1 (en) 2002-04-11
CA2425112C true CA2425112C (en) 2011-09-27

Family

ID=26972030

Family Applications (1)

Application Number Title Priority Date Filing Date
CA2425112A Expired - Lifetime CA2425112C (en) 2000-10-06 2001-10-05 Massive parallel method for decoding dna and rna

Country Status (9)

Country Link
US (25) US6664079B2 (en)
EP (3) EP1790736A3 (en)
JP (1) JP2004510433A (en)
AT (1) ATE356222T1 (en)
AU (1) AU2001296645A1 (en)
CA (1) CA2425112C (en)
DE (2) DE20122767U1 (en)
HK (1) HK1227441A1 (en)
WO (1) WO2002029003A2 (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9115163B2 (en) 2007-10-19 2015-08-25 The Trustees Of Columbia University In The City Of New York DNA sequence with non-fluorescent nucleotide reversible terminators and cleavable label modified nucleotide terminators
US9133511B2 (en) 2000-10-06 2015-09-15 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US9175342B2 (en) 2007-10-19 2015-11-03 The Trustees Of Columbia University In The City Of New York Synthesis of cleavable fluorescent nucleotides as reversible terminators for DNA sequencing by synthesis
US9528151B2 (en) 2006-12-01 2016-12-27 The Trustees Of Columbia University In The City Of New York Four-color DNA sequencing by synthesis using cleavable fluorescent nucleotide reversible terminators

Families Citing this family (241)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7153943B2 (en) * 1997-07-14 2006-12-26 Bolder Biotechnology, Inc. Derivatives of growth hormone and related proteins, and methods of use thereof
US6780591B2 (en) 1998-05-01 2004-08-24 Arizona Board Of Regents Method of determining the nucleotide sequence of oligonucleotides and DNA molecules
US7875440B2 (en) 1998-05-01 2011-01-25 Arizona Board Of Regents Method of determining the nucleotide sequence of oligonucleotides and DNA molecules
US6818395B1 (en) 1999-06-28 2004-11-16 California Institute Of Technology Methods and apparatus for analyzing polynucleotide sequences
US7501245B2 (en) * 1999-06-28 2009-03-10 Helicos Biosciences Corp. Methods and apparatuses for analyzing polynucleotide sequences
US20060057565A1 (en) * 2000-09-11 2006-03-16 Jingyue Ju Combinatorial fluorescence energy transfer tags and uses thereof
US6627748B1 (en) 2000-09-11 2003-09-30 The Trustees Of Columbia University In The City Of New York Combinatorial fluorescence energy transfer tags and their applications for multiplex genetic analyses
US9708358B2 (en) 2000-10-06 2017-07-18 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US7297518B2 (en) * 2001-03-12 2007-11-20 California Institute Of Technology Methods and apparatus for analyzing polynucleotide sequences by asynchronous base extension
GB0129012D0 (en) 2001-12-04 2002-01-23 Solexa Ltd Labelled nucleotides
US7057026B2 (en) 2001-12-04 2006-06-06 Solexa Limited Labelled nucleotides
US7166478B2 (en) * 2002-03-12 2007-01-23 Enzo Life Sciences, Inc., C/O Enzo Biochem, Inc. Labeling reagents and labeled targets, target labeling processes and other processes for using same in nucleic acid determinations and analyses
US7700306B2 (en) 2002-04-04 2010-04-20 Electrophoretics Limited Method for charcterising analytes
US7074597B2 (en) * 2002-07-12 2006-07-11 The Trustees Of Columbia University In The City Of New York Multiplex genotyping using solid phase capturable dideoxynucleotides and mass spectrometry
EP3002289B1 (en) 2002-08-23 2018-02-28 Illumina Cambridge Limited Modified nucleotides for polynucleotide sequencing
US7414116B2 (en) 2002-08-23 2008-08-19 Illumina Cambridge Limited Labelled nucleotides
US11008359B2 (en) 2002-08-23 2021-05-18 Illumina Cambridge Limited Labelled nucleotides
SI3147292T1 (en) 2002-08-23 2019-01-31 Illumina Cambridge Limited Labelled nucleotides
WO2004055160A2 (en) * 2002-12-13 2004-07-01 The Trustees Of Columbia University In The City Of New York Biomolecular coupling methods using 1,3-dipolar cycloaddition chemistry
US7323555B2 (en) * 2002-12-26 2008-01-29 Isao Saito Nucleotide derivative and DNA microarray
US7414117B2 (en) * 2002-12-26 2008-08-19 Ngk Insulators, Ltd. Nucleotide derivative and DNA microarray
EP1725572B1 (en) 2003-11-05 2017-05-31 AGCT GmbH Macromolecular nucleotide compounds and methods for using the same
US7169560B2 (en) 2003-11-12 2007-01-30 Helicos Biosciences Corporation Short cycle methods for sequencing polynucleotides
WO2005080605A2 (en) * 2004-02-19 2005-09-01 Helicos Biosciences Corporation Methods and kits for analyzing polynucleotide sequences
CA2557818A1 (en) * 2004-03-03 2005-09-15 The Trustees Of Columbia University In The City Of New York Photocleavable fluorescent nucleotides for dna sequencing on chip constructed by site-specific coupling chemistry
US7157699B2 (en) * 2004-03-29 2007-01-02 Purdue Research Foundation Multiplexed mass spectrometer
WO2006073436A2 (en) * 2004-04-29 2006-07-13 The Trustees Of Columbia University In The City Of New York Mass tag pcr for multiplex diagnostics
US20070054345A1 (en) 2004-05-19 2007-03-08 Hunter Christie L Expression quantification using mass spectrometry
US7759061B2 (en) * 2004-06-02 2010-07-20 Twistdx, Inc. 2′-nitrobenzyl-modified ribonucleotides
JP2005353340A (en) * 2004-06-09 2005-12-22 Hitachi Ltd Mass spectrometer
US20070048752A1 (en) 2004-07-12 2007-03-01 Applera Corporation Mass tags for quantitative analyses
US20060172319A1 (en) * 2004-07-12 2006-08-03 Applera Corporation Mass tags for quantitative analyses
GB0421294D0 (en) * 2004-09-24 2004-10-27 Angiogene Pharm Ltd Bioreductively-activated prodrugs
US7960543B2 (en) * 2004-11-08 2011-06-14 Riken Nucleoside or nucleotide derivative and use thereof
EP2239342A3 (en) 2005-02-01 2010-11-03 AB Advanced Genetic Analysis Corporation Reagents, methods and libraries for bead-based sequencing
EP2241637A1 (en) 2005-02-01 2010-10-20 AB Advanced Genetic Analysis Corporation Nucleic acid sequencing by performing successive cycles of duplex extension
US20060183238A1 (en) 2005-02-09 2006-08-17 Applera Corporation Amine-containing compound analysis methods
JP2006241133A (en) * 2005-03-04 2006-09-14 Univ Of Tokyo Photodecomposable protecting group
US8212020B2 (en) * 2005-03-11 2012-07-03 Steven Albert Benner Reagents for reversibly terminating primer extension
US7544794B1 (en) * 2005-03-11 2009-06-09 Steven Albert Benner Method for sequencing DNA and RNA by synthesis
GB0507835D0 (en) * 2005-04-18 2005-05-25 Solexa Ltd Method and device for nucleic acid sequencing using a planar wave guide
WO2007002204A2 (en) * 2005-06-21 2007-01-04 The Trustees Of Columbia University In The City Of New York Pyrosequencing methods and related compostions
WO2007014397A2 (en) * 2005-07-28 2007-02-01 Helicos Biosciences Corporation Consecutive base single molecule sequencing
US8101430B2 (en) 2005-08-15 2012-01-24 Massachusetts Institute Of Technology Fluorescent sensor based on two fluorescent moieties one of which is a semiconductor nanocrystal and methods of using and making
GB0517097D0 (en) 2005-08-19 2005-09-28 Solexa Ltd Modified nucleosides and nucleotides and uses thereof
US7666593B2 (en) 2005-08-26 2010-02-23 Helicos Biosciences Corporation Single molecule sequencing of captured nucleic acids
US7405281B2 (en) 2005-09-29 2008-07-29 Pacific Biosciences Of California, Inc. Fluorescent nucleotide analogs and uses therefor
JP5430937B2 (en) 2005-10-27 2014-03-05 プレジデント アンド フェロウズ オブ ハーバード カレッジ Methods and compositions for labeling nucleic acids
WO2007053702A2 (en) * 2005-10-31 2007-05-10 The Trustees Of Columbia University In The City Of New York Synthesis of four color 3'-o-allyl modified photocleavable fluorescent nucleotides and related methods
US8796432B2 (en) * 2005-10-31 2014-08-05 The Trustees Of Columbia University In The City Of New York Chemically cleavable 3'-o-allyl-DNTP-allyl-fluorophore fluorescent nucleotide analogues and related methods
CA2630544A1 (en) * 2005-11-21 2007-05-31 The Trustees Of Columbia University In The City Of New York Multiplex digital immuno-sensing using a library of photocleavable mass tags
JP2009519717A (en) * 2005-12-16 2009-05-21 アプレラ コーポレイション Method and system for fixed phase sequencing
US8114636B2 (en) * 2006-02-10 2012-02-14 Life Technologies Corporation Labeling and detection of nucleic acids
US20070249014A1 (en) 2006-02-10 2007-10-25 Invitrogen Corporation Labeling and detection of post translationally modified proteins
AU2007237909A1 (en) * 2006-04-19 2007-10-25 Applied Biosystems, Llc. Reagents, methods, and libraries for gel-free bead-based sequencing
US8178360B2 (en) 2006-05-18 2012-05-15 Illumina Cambridge Limited Dye compounds and the use of their labelled conjugates
WO2007146158A1 (en) 2006-06-07 2007-12-21 The Trustees Of Columbia University In The City Of New York Dna sequencing by nanopore using modified nucleotides
WO2008037568A2 (en) * 2006-09-04 2008-04-03 Quiatech Ab Reversible terminators for efficient sequencing by synthesis
WO2008042067A2 (en) 2006-09-28 2008-04-10 Illumina, Inc. Compositions and methods for nucleotide sequencing
RU2009121089A (en) * 2006-12-05 2011-01-20 Лазержен, Инкорпорэйтед (Сша) (Us) PHOTOGRAPHABLE TAGGED NUCLEOTIDES AND NUCLEOSIDES AND TAGGED NUCLEOTIDES AND NUCLEOSIDES, AND WAYS OF THEIR USE IN DNA SEQUENCING
US7893227B2 (en) 2006-12-05 2011-02-22 Lasergen, Inc. 3′-OH unblocked nucleotides and nucleosides base modified with non-cleavable, terminating groups and methods for their use in DNA sequencing
US7897737B2 (en) 2006-12-05 2011-03-01 Lasergen, Inc. 3′-OH unblocked, nucleotides and nucleosides, base modified with photocleavable, terminating groups and methods for their use in DNA sequencing
US8481259B2 (en) 2007-02-05 2013-07-09 Intelligent Bio-Systems, Inc. Methods and devices for sequencing nucleic acids in smaller batches
US11940413B2 (en) 2007-02-05 2024-03-26 IsoPlexis Corporation Methods and devices for sequencing nucleic acids in smaller batches
US11035823B2 (en) 2009-03-17 2021-06-15 Qiagen Sciences, Llc Methods and devices for sequencing nucleic acids in smaller batches
JP5750209B2 (en) 2007-03-16 2015-07-15 アプタ バイオサイエンス リミテッド Functional molecule, amidite for functional molecule synthesis, and target substance analysis method
US9163053B2 (en) * 2007-05-18 2015-10-20 Fluidigm Corporation Nucleotide analogs
EP2181204A2 (en) * 2007-08-23 2010-05-05 Applied Biosystems Inc. Methods of modifying support surfaces for the immobilization of particles and the use of the immobilized particles for analyzing nucleic acids
US20090062132A1 (en) * 2007-08-29 2009-03-05 Borner Scott R Alternative nucleic acid sequencing methods
EP2212434A1 (en) * 2007-10-01 2010-08-04 Applied Biosystems Inc. Chase ligation sequencing
US20090171078A1 (en) * 2007-11-20 2009-07-02 Applied Biosystems Inc. Method of sequencing nucleic acids using elaborated nucleotide phosphorotiolate compounds
US8017338B2 (en) * 2007-11-20 2011-09-13 Life Technologies Corporation Reversible di-nucleotide terminator sequencing
EP2222341B1 (en) 2007-11-21 2015-02-25 University Of Georgia Research Foundation, Inc. Alkynes and methods of reacting alkynes with 1,3-dipole-functional compounds
WO2009114182A1 (en) 2008-03-13 2009-09-17 Pacific Biosciences Of California, Inc. Labeled reactants and their uses
US8883999B2 (en) * 2008-03-19 2014-11-11 Intelligent Bio Systems, Inc. Methods and solutions for inhibiting undesired cleaving of labels
US9017973B2 (en) 2008-03-19 2015-04-28 Intelligent Biosystems, Inc. Methods and compositions for incorporating nucleotides
US10745740B2 (en) 2008-03-19 2020-08-18 Qiagen Sciences, Llc Sample preparation
US8058414B2 (en) * 2008-04-29 2011-11-15 Life Technologies Corporation Unnatural polymerase substrates that can sustain enzymatic synthesis of double stranded nucleic acids from a nucleic acid template and methods of use
CN102119223A (en) 2008-05-16 2011-07-06 生命技术公司 Dual labeling methods for measuring cellular proliferation
GB2473778B (en) * 2008-05-27 2013-04-10 Trilink Biotechnologies Chemically modified nucleoside 5'-triphosphates for thermally initiated amplification of nucleic acid
AU2009257369B2 (en) 2008-06-11 2015-03-26 Agilent Technologies, Inc. Nucleotides and nucleosides and methods for their use in DNA sequencing
US20110281740A1 (en) * 2008-06-30 2011-11-17 Joseph Beechem Methods for Real Time Single Molecule Sequencing
US20100120034A1 (en) * 2008-07-03 2010-05-13 Life Technologies Corporation Methylation analysis of mate pairs
US8173198B2 (en) * 2008-07-23 2012-05-08 Life Technologies Corporation Deposition of metal oxides onto surfaces as an immobilization vehicle for carboxylated or phophated particles or polymers
US20100179075A1 (en) * 2008-07-30 2010-07-15 Life Technologies Corporation Particles for use in supported nucleic acid ligation and detection sequencing
EP2340314B8 (en) 2008-10-22 2015-02-18 Illumina, Inc. Preservation of information related to genomic dna methylation
EP2206780B1 (en) 2008-12-23 2012-02-29 Qiagen GmbH Method and device for carrying out a nucleic acid preparation and/or amplification
KR20100089688A (en) * 2009-02-04 2010-08-12 삼성전자주식회사 Method for analyzing target nucleic acid
US20110014612A1 (en) 2009-03-27 2011-01-20 Life Technologies Corporation Polymerase compositions & methods
US20100330569A1 (en) 2009-04-23 2010-12-30 Intelligent Bio-Systems, Inc. Hydroxymethyl Linkers For Labeling Nucleotides
US8501405B2 (en) * 2009-04-27 2013-08-06 Pacific Biosciences Of California, Inc. Real-time sequencing methods and systems
GB0907372D0 (en) 2009-04-29 2009-06-10 Invitrogen Dynal As Particles
WO2011032040A1 (en) 2009-09-10 2011-03-17 Centrillion Technology Holding Corporation Methods of targeted sequencing
US10174368B2 (en) 2009-09-10 2019-01-08 Centrillion Technology Holdings Corporation Methods and systems for sequencing long nucleic acids
US9315860B2 (en) 2009-10-26 2016-04-19 Genovoxx Gmbh Conjugates of nucleotides and method for the application thereof
US9605307B2 (en) 2010-02-08 2017-03-28 Genia Technologies, Inc. Systems and methods for forming a nanopore in a lipid bilayer
US8324914B2 (en) 2010-02-08 2012-12-04 Genia Technologies, Inc. Systems and methods for characterizing a molecule
US9678055B2 (en) 2010-02-08 2017-06-13 Genia Technologies, Inc. Methods for forming a nanopore in a lipid bilayer
US20110192723A1 (en) * 2010-02-08 2011-08-11 Genia Technologies, Inc. Systems and methods for manipulating a molecule in a nanopore
US8603741B2 (en) 2010-02-18 2013-12-10 Pacific Biosciences Of California, Inc. Single molecule sequencing with two distinct chemistry steps
WO2011106368A2 (en) 2010-02-23 2011-09-01 Illumina, Inc. Amplification methods to minimise sequence specific bias
US8951940B2 (en) 2010-04-01 2015-02-10 Illumina, Inc. Solid-phase clonal amplification and related methods
US9029103B2 (en) 2010-08-27 2015-05-12 Illumina Cambridge Limited Methods for sequencing polynucleotides
US20120083417A1 (en) * 2010-09-23 2012-04-05 Centrillion Technology Holding Corporation Native-extension parallel sequencing
GB201016484D0 (en) 2010-09-30 2010-11-17 Geneseque As Method
US9187783B2 (en) 2010-10-04 2015-11-17 Genapsys, Inc. Systems and methods for automated reusable parallel biological reactions
WO2013082164A1 (en) 2011-11-28 2013-06-06 Life Technologies Corporation Enhanced ligation reactions
CN103282518B (en) 2010-12-17 2016-11-16 纽约哥伦比亚大学理事会 Use synthesis limit, the DNA limit order-checking of modified nucleotide and nano-pore detection
WO2012088341A2 (en) 2010-12-22 2012-06-28 Genia Technologies, Inc. Nanopore-based single dna molecule characterization, identification and isolation using speed bumps
US9217132B2 (en) 2011-01-20 2015-12-22 Ibis Biosciences, Inc. Microfluidic transducer
US8962242B2 (en) 2011-01-24 2015-02-24 Genia Technologies, Inc. System for detecting electrical properties of a molecular complex
US9110478B2 (en) 2011-01-27 2015-08-18 Genia Technologies, Inc. Temperature regulation of measurement arrays
US20120252682A1 (en) * 2011-04-01 2012-10-04 Maples Corporate Services Limited Methods and systems for sequencing nucleic acids
DE102012008375A1 (en) 2011-04-27 2012-10-31 Genovoxx Gmbh Methods and components for the detection of nucleic acid chains
US20150086981A1 (en) 2011-05-04 2015-03-26 Genovoxx Gmbh Nucleoside-triphosphate conjugate and methods for the use thereof
WO2012162429A2 (en) 2011-05-23 2012-11-29 The Trustees Of Columbia University In The City Of New York Dna sequencing by synthesis using raman and infrared spectroscopy detection
US9926596B2 (en) 2011-05-27 2018-03-27 Genapsys, Inc. Systems and methods for genetic and biological analysis
MX2014002027A (en) 2011-08-19 2014-11-10 Synthetic Genomics Inc Integrated method for high-throughput identification of novel pesticidal compositions and uses therefor.
US9988680B2 (en) 2011-09-01 2018-06-05 Case Western Reserve University Non-natural nucleosides as theranostic agents
KR102048274B1 (en) 2011-09-13 2019-11-25 애질런트 테크놀로지스, 인크. 5-methoxy, 3'-OH unblocked, fast photocleavable terminating nucleotides and methods for nucleic acid sequencing
US10378051B2 (en) 2011-09-29 2019-08-13 Illumina Cambridge Limited Continuous extension and deblocking in reactions for nucleic acids synthesis and sequencing
CN104105797B (en) 2011-12-01 2016-08-31 吉纳普赛斯股份有限公司 System and method for efficent electronic order-checking with detection
US20130244340A1 (en) 2012-01-20 2013-09-19 Genia Technologies, Inc. Nanopore Based Molecular Detection and Sequencing
US8986629B2 (en) 2012-02-27 2015-03-24 Genia Technologies, Inc. Sensor circuit for controlling, detecting, and measuring a molecular complex
WO2013154999A2 (en) 2012-04-09 2013-10-17 The Trustees Of Columbia University In The City Of New York Method of preparation of nanopore and uses thereof
JP2015525077A (en) 2012-06-15 2015-09-03 ジェニア・テクノロジーズ・インコーポレイテッド Chip configuration and highly accurate nucleic acid sequencing
WO2013191793A1 (en) 2012-06-20 2013-12-27 The Trustees Of Columbia University In The City Of New York Nucleic acid sequencing by nanopore detection of tag molecules
US9605309B2 (en) 2012-11-09 2017-03-28 Genia Technologies, Inc. Nucleic acid sequencing using tags
US9759711B2 (en) 2013-02-05 2017-09-12 Genia Technologies, Inc. Nanopore arrays
CN103232489B (en) * 2013-02-18 2016-09-28 常州津坛生物科技有限公司 A kind of fluorescent probe compounds and its production and use
US9146248B2 (en) 2013-03-14 2015-09-29 Intelligent Bio-Systems, Inc. Apparatus and methods for purging flow cells in nucleic acid sequencing instruments
CN105051214B (en) 2013-03-15 2018-12-28 吉纳普赛斯股份有限公司 System and method for bioanalysis
US10732183B2 (en) 2013-03-15 2020-08-04 The Trustees Of Columbia University In The City Of New York Method for detecting multiple predetermined compounds in a sample
US10648026B2 (en) 2013-03-15 2020-05-12 The Trustees Of Columbia University In The City Of New York Raman cluster tagged molecules for biological imaging
CN108864232B (en) 2013-03-15 2022-01-04 伊鲁米纳剑桥有限公司 Modified nucleosides or nucleotides
US9591268B2 (en) 2013-03-15 2017-03-07 Qiagen Waltham, Inc. Flow cell alignment methods and systems
US10683536B2 (en) 2013-04-02 2020-06-16 Molecular Assemblies, Inc. Reusable initiators for synthesizing nucleic acids
US8808989B1 (en) 2013-04-02 2014-08-19 Molecular Assemblies, Inc. Methods and apparatus for synthesizing nucleic acids
US11384377B2 (en) 2013-04-02 2022-07-12 Molecular Assemblies, Inc. Reusable initiators for synthesizing nucleic acids
US11331643B2 (en) 2013-04-02 2022-05-17 Molecular Assemblies, Inc. Reusable initiators for synthesizing nucleic acids
US9279149B2 (en) 2013-04-02 2016-03-08 Molecular Assemblies, Inc. Methods and apparatus for synthesizing nucleic acids
US9771613B2 (en) 2013-04-02 2017-09-26 Molecular Assemblies, Inc. Methods and apparatus for synthesizing nucleic acid
US10337049B2 (en) 2013-06-17 2019-07-02 The Trustees Of Columbia University In The City Of New York Universal methylation profiling methods
CN103601779B (en) * 2013-10-17 2016-05-04 上海交通大学 The synthetic method of 7-denitrification-2 '-deoxidation-7-halogen 9 substituted guanine nucleosides
US9551697B2 (en) 2013-10-17 2017-01-24 Genia Technologies, Inc. Non-faradaic, capacitively coupled measurement in a nanopore cell array
CN103601778A (en) * 2013-10-17 2014-02-26 上海交通大学 Synthetic method of 7-denitrified-7-substituted guanosine
CN105723222B (en) 2013-10-23 2019-01-22 吉尼亚科技公司 It is sensed using the high-velocity molecular of nano-pore
US9567630B2 (en) 2013-10-23 2017-02-14 Genia Technologies, Inc. Methods for forming lipid bilayers on biochips
CN103588838A (en) * 2013-10-30 2014-02-19 上海交通大学 Synthesis method of base modified nucleotide and application thereof
CN103819523B (en) * 2014-01-22 2016-02-10 上海交通大学 The synthetic method of 7-denitrification-7-halogen guanosine-
CA2943952A1 (en) * 2014-03-24 2015-10-01 The Trustees Of Columbia University In The City Of New York Chemical methods for producing tagged nucleotides
FR3020071B1 (en) 2014-04-17 2017-12-22 Dna Script PROCESS FOR THE SYNTHESIS OF NUCLEIC ACIDS, IN PARTICULAR LARGE NUCLEIC ACIDS, USE OF THE METHOD AND KIT FOR IMPLEMENTING THE METHOD
EP3556864B1 (en) 2014-04-18 2020-12-09 Genapsys, Inc. Methods and systems for nucleic acid amplification
EP3143140A4 (en) * 2014-05-16 2017-11-08 The Regents Of The University Of California Compositions and methods for single-molecule construction of dna
WO2016022540A1 (en) * 2014-08-04 2016-02-11 The Trustees Of The University Of Pennsylvania Transcriptome in vivo analysis ( tiva) and transcriptome in situ analysis (tisa)
GB201413929D0 (en) 2014-08-06 2014-09-17 Geneseque As Method
FR3025201B1 (en) 2014-09-02 2018-10-12 Dna Script MODIFIED NUCLEOTIDES FOR THE SYNTHESIS OF NUCLEIC ACIDS, A KIT COMPRISING SUCH NUCLEOTIDES AND THEIR USE FOR GENERATING SYNTHETIC NUCLEIC ACID GENES OR SEQUENCES
US10544455B2 (en) 2014-10-03 2020-01-28 Life Technologies Corporation Sequencing methods, compositions and systems using terminator nucleotides
US10487357B2 (en) 2014-10-03 2019-11-26 Life Technologies Corporation Methods of nucleic acid analysis using terminator nucleotides
EP3699283A1 (en) 2014-10-20 2020-08-26 Molecular Assemblies Inc. Modified template-independent enzymes for polydeoxynucleotide systhesis
WO2016144973A1 (en) 2015-03-09 2016-09-15 The Trustees Of Columbia University In The City Of New York Pore-forming protein conjugate compositions and methods
US9856285B2 (en) * 2015-03-17 2018-01-02 Kaohsiung Medical University Reagents for universal site-specific labeling and modifications of nucleic acids
US10344336B2 (en) 2015-06-09 2019-07-09 Life Technologies Corporation Methods, systems, compositions, kits, apparatus and computer-readable media for molecular tagging
US10077470B2 (en) 2015-07-21 2018-09-18 Omniome, Inc. Nucleic acid sequencing methods and systems
RU2742955C2 (en) 2015-07-30 2021-02-12 Иллюмина, Инк. Orthogonal deblocking of nucleotides
CN108779138B (en) 2015-09-28 2022-06-17 哥伦比亚大学董事会 Design and synthesis of nucleotides based on novel disulfide linkers for use as reversible terminators for DNA sequencing by synthesis
WO2017075293A1 (en) 2015-10-28 2017-05-04 Silicon Valley Scientific, Inc. Method and apparatus for encoding cellular spatial position information
TWI664160B (en) 2015-11-06 2019-07-01 美商齊亞雋科學公司 Nucleotide analogues
US11421264B2 (en) 2015-11-06 2022-08-23 IsoPlexis Corporation Thiol-containing cleave reagents and oxidative wash
WO2017104398A1 (en) * 2015-12-17 2017-06-22 株式会社日立ハイテクノロジーズ Biomolecule measurement apparatus
WO2017139418A1 (en) 2016-02-11 2017-08-17 Qiagen Waltham, Inc. Additive to improve sequencing by synthesis performance
US10036011B2 (en) 2016-02-11 2018-07-31 Qiagen Waltham, Inc. Scavenger compounds for improved sequencing-by-synthesis
US10337050B2 (en) 2016-02-11 2019-07-02 Qiagen Sciences, Llc Polyphenolic additives in sequencing by synthesis
CA3021769C (en) 2016-04-29 2021-11-23 Omniome, Inc. Sequencing method employing ternary complex destabilization to identify cognate nucleotides
CN109661232B (en) 2016-05-23 2023-03-03 纽约哥伦比亚大学董事会 Nucleotide derivatives and methods of use thereof
AU2017278350B2 (en) 2016-06-06 2023-10-19 Redvault Biosciences, Lp Target reporter constructs and uses thereof
EP3488017A4 (en) 2016-07-20 2020-02-26 Genapsys Inc. Systems and methods for nucleic acid sequencing
WO2018034780A1 (en) 2016-08-15 2018-02-22 Omniome, Inc. Sequencing method for rapid identification and processing of cognate nucleotide pairs
CN117385014A (en) 2016-08-15 2024-01-12 加利福尼亚太平洋生物科学股份有限公司 Methods and systems for sequencing nucleic acids
WO2018089231A1 (en) 2016-11-09 2018-05-17 Qiagen Sciences Llc Photoprotective mixtures as imaging reagents in sequencing-by-synthesis
WO2018125759A1 (en) 2016-12-30 2018-07-05 Omniome, Inc. Method and system employing distinguishable polymerases for detecting ternary complexes and identifying cognate nucleotides
EP3565905B1 (en) 2017-01-04 2022-05-25 MGI Tech Co., Ltd. Nucleic acid sequencing using affinity reagents
EP3571319A1 (en) 2017-01-20 2019-11-27 Omniome, Inc. Process for cognate nucleotide detection in a nucleic acid sequencing workflow
GB201700983D0 (en) 2017-01-20 2017-03-08 Life Tech As Polymeric particles
EP3596099A4 (en) 2017-03-06 2020-12-09 Singular Genomics Systems, Inc. Nucleic acid sequencing-by-synthesis (sbs) methods that combine sbs cycle steps
WO2018183538A1 (en) * 2017-03-28 2018-10-04 The Trustees Of Columbia University In The City Of New York 3'-o-modified nucleotide analogues with different cleavable linkers for attaching fluorescent labels to the base for dna sequencing by synthesis
US9951385B1 (en) 2017-04-25 2018-04-24 Omniome, Inc. Methods and apparatus that increase sequencing-by-binding efficiency
US10161003B2 (en) 2017-04-25 2018-12-25 Omniome, Inc. Methods and apparatus that increase sequencing-by-binding efficiency
US11542540B2 (en) 2017-06-16 2023-01-03 Life Technologies Corporation Control nucleic acids, and compositions, kits, and uses thereof
US11110114B2 (en) 2017-07-17 2021-09-07 Oxford University Innovation Limited Dinucleotides
US11104700B2 (en) 2017-07-17 2021-08-31 Oxford University Innovation Limited Oligonucleotides
HUE061474T2 (en) 2017-08-01 2023-07-28 Mgi Tech Co Ltd Nucleic acid sequencing method
MX2020003204A (en) 2017-09-20 2020-07-20 Regeneron Pharma Immunotherapy methods for patients whose tumors carry a high passenger gene mutation burden.
CN111566224A (en) * 2017-09-21 2020-08-21 吉纳普赛斯股份有限公司 Systems and methods for nucleic acid sequencing
US11193166B2 (en) 2017-10-19 2021-12-07 Omniome, Inc. Simultaneous background reduction and complex stabilization in binding assay workflows
WO2019079802A1 (en) * 2017-10-20 2019-04-25 President And Fellows Of Harvard College Methods of encoding and high-throughput decoding of information stored in dna
CN111836904A (en) 2017-12-21 2020-10-27 豪夫迈·罗氏有限公司 Compositions and methods for unidirectional nucleic acid sequencing
US10844430B2 (en) 2018-01-24 2020-11-24 Qiagen Sciences, Llc DNA sequencing reaction additive
WO2019209946A1 (en) 2018-04-25 2019-10-31 Qiagen Sciences Llc Sequential paired-end sequencing
PT3794012T (en) 2018-05-15 2024-01-17 Illumina Inc Compositions and methods for chemical cleavage and deprotection of surface-bound oligonucleotides
WO2019222653A1 (en) 2018-05-18 2019-11-21 Singular Genomics Systems, Inc. Silicon containing detectable compounds
WO2019226689A1 (en) 2018-05-22 2019-11-28 Axbio Inc. Methods, systems, and compositions for nucleic acid sequencing
MX2020012765A (en) 2018-05-30 2021-04-28 Dtx Pharma Inc Lipid-modified nucleic acid compounds and methods.
CN110818757A (en) * 2018-08-07 2020-02-21 深圳华大生命科学研究院 Nucleotide analogs and method for screening DNA polymerase
US11136565B2 (en) 2018-09-11 2021-10-05 Singular Genomics Systems, Inc. Modified archaeal family B polymerases
EP3870593A4 (en) 2018-10-25 2022-11-16 Singular Genomics Systems, Inc. Nucleotide analogues
KR20210088637A (en) 2018-11-07 2021-07-14 이지아이 테크 (센젠) 컴퍼니 리미티드 Methods for sequencing polynucleotides
US10704094B1 (en) 2018-11-14 2020-07-07 Element Biosciences, Inc. Multipart reagents having increased avidity for polymerase binding
US10768173B1 (en) * 2019-09-06 2020-09-08 Element Biosciences, Inc. Multivalent binding composition for nucleic acid analysis
US10876148B2 (en) 2018-11-14 2020-12-29 Element Biosciences, Inc. De novo surface preparation and uses thereof
EP3894593A2 (en) 2018-12-13 2021-10-20 DNA Script Direct oligonucleotide synthesis on cells and biomolecules
US11293061B2 (en) * 2018-12-26 2022-04-05 Illumina Cambridge Limited Sequencing methods using nucleotides with 3′ AOM blocking group
EP3908286A4 (en) 2019-01-08 2022-10-12 Singular Genomics Systems, Inc. Nucleotide cleavable linkers and uses thereof
SG11202107921SA (en) 2019-02-12 2021-08-30 Dna Script Efficient product cleavage in template-free enzymatic synthesis of polynucleotides.
CN113710686A (en) 2019-02-19 2021-11-26 阿尔缇玛基因组学公司 Linker and method for optical detection and sequencing
KR20220009992A (en) 2019-05-15 2022-01-25 이지아이 테크 (센젠) 컴퍼니 리미티드 Single-channel sequencing method based on self-luminescence
US20230242979A1 (en) 2019-08-20 2023-08-03 Egi Tech (Shen Zhen) Co., Limited Method for sequencing polynucleotides based on optical signal kinetics of luminescent labels and secondary luminescent signals
US11512295B2 (en) 2019-09-12 2022-11-29 Singular Genomics Systems, Inc. Modified thermoccocus polymerases
US20220403436A1 (en) 2019-09-23 2022-12-22 Dna Script Increasing Long-Sequence Yields in Template-Free Enzymatic Synthesis of Polynucleotides
US11287422B2 (en) 2019-09-23 2022-03-29 Element Biosciences, Inc. Multivalent binding composition for nucleic acid analysis
WO2021092035A1 (en) 2019-11-07 2021-05-14 Singular Genomics Systems, Inc. Silicon containing detectable compounds and uses thereof
CA3165571C (en) 2019-12-23 2023-02-07 Singular Genomics Systems, Inc. Methods for long read sequencing
WO2021138094A1 (en) 2019-12-31 2021-07-08 Singular Genomics Systems, Inc. Polynucleotide barcodes for long read sequencing
US11807851B1 (en) 2020-02-18 2023-11-07 Ultima Genomics, Inc. Modified polynucleotides and uses thereof
US11034942B1 (en) 2020-02-27 2021-06-15 Singular Genomics Systems, Inc. Modified pyrococcus polymerases and uses thereof
WO2021178893A2 (en) 2020-03-06 2021-09-10 Singular Genomics Systems, Inc. Linked paired strand sequencing
WO2021216998A1 (en) 2020-04-24 2021-10-28 Singular Genomics Systems, Inc. Modified nucleotides and uses thereof
WO2021226327A1 (en) * 2020-05-08 2021-11-11 Singular Genomics Systems, Inc. Nucleotide cleavable linkers with rigid spacers and uses thereof
PE20230492A1 (en) 2020-06-22 2023-03-23 Illumina Cambridge Ltd NUCLEOSIDES AND NUCLEOTIDES WITH 3' ACETAL BLOCKING GROUP
AU2021299216A1 (en) 2020-06-30 2022-12-08 Illumina, Inc. Catalytically controlled sequencing by synthesis to produce scarless DNA
EP4153606A2 (en) 2020-07-13 2023-03-29 Singular Genomics Systems, Inc. Methods of sequencing complementary polynucleotides
AU2021372349A1 (en) * 2020-10-29 2023-04-20 Ambergen, Inc. Novel photocleavable mass-tags for multiplexed mass spectrometric imaging of tissues using biomolecular probes
WO2022170212A1 (en) 2021-02-08 2022-08-11 Singular Genomics Systems, Inc. Methods and compositions for sequencing complementary polynucleotides
US11578320B2 (en) 2021-04-27 2023-02-14 Singular Genomics Systems, Inc. High density sequencing and multiplexed priming
EP4089098A1 (en) * 2021-05-10 2022-11-16 Miltenyi Biotec B.V. & Co. KG Fret dye labeled reversible nucleotide terminators and their use in sequencing of dna
US20230047225A1 (en) 2021-08-14 2023-02-16 Illumina, Inc. Polymerases, compositions, and methods of use
WO2023035108A1 (en) 2021-09-07 2023-03-16 深圳华大智造科技股份有限公司 Method for analyzing sequence of target polynucleotide
CN115943217A (en) 2021-09-07 2023-04-07 深圳华大智造科技股份有限公司 Method for analyzing sequence of target polynucleotide
WO2023107673A2 (en) 2021-12-10 2023-06-15 Singular Genomics Systems, Inc. Cleavable disulfide linkers and uses thereof
US20230332197A1 (en) 2022-03-31 2023-10-19 Illumina Singapore Pte. Ltd. Nucleosides and nucleotides with 3' vinyl blocking group
US20230383342A1 (en) 2022-05-31 2023-11-30 Illumina Cambridge Limited Compositions and methods for nucleic acid sequencing

Family Cites Families (220)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4711955A (en) 1981-04-17 1987-12-08 Yale University Modified nucleotides and methods of preparing and using same
US5175269A (en) 1984-01-30 1992-12-29 Enzo Diagnostics, Inc. Compound and detectable molecules having an oligo- or polynucleotide with modifiable reactive group
US5118605A (en) * 1984-10-16 1992-06-02 Chiron Corporation Polynucleotide determination with selectable cleavage sites
US4824775A (en) 1985-01-03 1989-04-25 Molecular Diagnostics, Inc. Cells labeled with multiple Fluorophores bound to a nucleic acid carrier
US4772691A (en) 1985-06-05 1988-09-20 The Medical College Of Wisconsin, Inc. Chemically cleavable nucleotides
US4863849A (en) 1985-07-18 1989-09-05 New York Medical College Automatable process for sequencing nucleotide
DE3529478A1 (en) 1985-08-16 1987-02-19 Boehringer Mannheim Gmbh 7-DESAZA-2'DESOXYGUANOSINE NUCLEOTIDES, METHOD FOR THE PRODUCTION THEREOF AND THEIR USE FOR NUCLEIC ACID SEQUENCING
US4888274A (en) 1985-09-18 1989-12-19 Yale University RecA nucleoprotein filament and methods
US5047519A (en) 1986-07-02 1991-09-10 E. I. Du Pont De Nemours And Company Alkynylamino-nucleotides
CA1340806C (en) 1986-07-02 1999-11-02 James Merrill Prober Method, system and reagents for dna sequencing
US5242796A (en) 1986-07-02 1993-09-07 E. I. Du Pont De Nemours And Company Method, system and reagents for DNA sequencing
US5151507A (en) 1986-07-02 1992-09-29 E. I. Du Pont De Nemours And Company Alkynylamino-nucleotides
GB8810400D0 (en) 1988-05-03 1988-06-08 Southern E Analysing polynucleotide sequences
SE8801070D0 (en) 1988-03-23 1988-03-23 Pharmacia Ab METHOD FOR IMMOBILIZING A DNA SEQUENCE ON A SOLID SUPPORT
WO1989011548A1 (en) 1988-05-20 1989-11-30 Cetus Corporation Immobilized sequence-specific probes
US5174962A (en) 1988-06-20 1992-12-29 Genomyx, Inc. Apparatus for determining DNA sequences by mass spectrometry
US5043272A (en) 1989-04-27 1991-08-27 Life Technologies, Incorporated Amplification of nucleic acid sequences using oligonucleotides of random sequence as primers
GB8910880D0 (en) 1989-05-11 1989-06-28 Amersham Int Plc Sequencing method
US5547839A (en) 1989-06-07 1996-08-20 Affymax Technologies N.V. Sequencing of surface immobilized polymers utilizing microflourescence detection
US5424186A (en) 1989-06-07 1995-06-13 Affymax Technologies N.V. Very large scale immobilized polymer synthesis
US5302509A (en) 1989-08-14 1994-04-12 Beckman Instruments, Inc. Method for sequencing polynucleotides
WO1991006678A1 (en) * 1989-10-26 1991-05-16 Sri International Dna sequencing
US5437975A (en) 1991-02-25 1995-08-01 California Institute Of Biological Research Consensus sequence primed polymerase chain reaction method for fingerprinting genomes
JPH04337446A (en) 1991-05-15 1992-11-25 Hitachi Ltd Method and device for measuring fine grain and constant quantity method
US5556748A (en) 1991-07-30 1996-09-17 Xenopore Corporation Methods of sandwich hybridization for the quantitative analysis of oligonucleotides
AU2674092A (en) 1991-09-09 1993-04-05 Baylor College Of Medicine Method and device for rapid dna or rna sequencing determination by a base addition sequencing scheme
DE4141178A1 (en) 1991-12-13 1993-06-17 Europ Lab Molekularbiolog New nucleic acid sequencing method - using one labelled nucleotide at one time in cycles comprising elongation, wash, label detection and removal of the label, then repeating
DE4141698A1 (en) 1991-12-18 1993-07-01 Bosch Gmbh Robert CLOSING TIME CONTROL METHOD
US6555349B1 (en) * 1993-01-22 2003-04-29 Cornell Research Foundation, Inc. Methods for amplifying and sequencing nucleic acid molecules using a three component polymerase
GB9208733D0 (en) 1992-04-22 1992-06-10 Medical Res Council Dna sequencing method
US5637469A (en) 1992-05-01 1997-06-10 Trustees Of The University Of Pennsylvania Methods and apparatus for the detection of an analyte utilizing mesoscale flow systems
GB9210176D0 (en) 1992-05-12 1992-06-24 Cemu Bioteknik Ab Chemical method
US5383858B1 (en) 1992-08-17 1996-10-29 Medrad Inc Front-loading medical injector and syringe for use therewith
US5516664A (en) 1992-12-23 1996-05-14 Hyman; Edward D. Enzymatic synthesis of repeat regions of oligonucleotides
US5436143A (en) 1992-12-23 1995-07-25 Hyman; Edward D. Method for enzymatic synthesis of oligonucleotides
US6074823A (en) * 1993-03-19 2000-06-13 Sequenom, Inc. DNA sequencing by mass spectrometry via exonuclease degradation
FR2703052B1 (en) 1993-03-26 1995-06-02 Pasteur Institut New method of nucleic acid sequencing.
US5959089A (en) 1993-07-19 1999-09-28 Hannessian; Stephen Amino-cyclodextrin syntheses
GB9315847D0 (en) * 1993-07-30 1993-09-15 Isis Innovation Tag reagent and assay method
US5547859A (en) 1993-08-02 1996-08-20 Goodman; Myron F. Chain-terminating nucleotides for DNA sequencing methods
EP0730662A4 (en) 1993-09-10 1999-11-24 Genevue Inc Optical detection of position of oligonucleotides on large dna molecules
DE69426731T2 (en) 1993-11-17 2001-06-28 Amersham Pharm Biotech Uk Ltd METHOD FOR MASS SPECTROSCOPIC SEQUENCE ANALYSIS OF A NUCLEIC ACID BY PRIMER EXTENSION
US6028190A (en) 1994-02-01 2000-02-22 The Regents Of The University Of California Probes labeled with energy transfer coupled dyes
US5654419A (en) 1994-02-01 1997-08-05 The Regents Of The University Of California Fluorescent labels and their use in separations
US5869255A (en) 1994-02-01 1999-02-09 The Regents Of The University Of California Probes labeled with energy transfer couples dyes exemplified with DNA fragment analysis
FR2716263B1 (en) * 1994-02-11 1997-01-17 Pasteur Institut Method for aligning macromolecules by passing a meniscus and applications in a method for highlighting, separating and / or assaying a macromolecule in a sample.
US5714330A (en) 1994-04-04 1998-02-03 Lynx Therapeutics, Inc. DNA sequencing by stepwise ligation and cleavage
US5552278A (en) * 1994-04-04 1996-09-03 Spectragen, Inc. DNA sequencing by stepwise ligation and cleavage
US6589736B1 (en) 1994-11-22 2003-07-08 The Trustees Of Boston University Photocleavable agents and conjugates for the detection and isolation of biomolecules
US20020168642A1 (en) 1994-06-06 2002-11-14 Andrzej Drukier Sequencing duplex DNA by mass spectroscopy
US5709999A (en) * 1994-08-12 1998-01-20 Myriad Genetics Inc. Linked breast and ovarian cancer susceptibility gene
US6232465B1 (en) 1994-09-02 2001-05-15 Andrew C. Hiatt Compositions for enzyme catalyzed template-independent creation of phosphodiester bonds using protected nucleotides
US5763594A (en) 1994-09-02 1998-06-09 Andrew C. Hiatt 3' protected nucleotides for enzyme catalyzed template-independent creation of phosphodiester bonds
US5872244A (en) 1994-09-02 1999-02-16 Andrew C. Hiatt 3' protected nucleotides for enzyme catalyzed template-independent creation of phosphodiester bonds
US5808045A (en) 1994-09-02 1998-09-15 Andrew C. Hiatt Compositions for enzyme catalyzed template-independent creation of phosphodiester bonds using protected nucleotides
US6214987B1 (en) 1994-09-02 2001-04-10 Andrew C. Hiatt Compositions for enzyme catalyzed template-independent formation of phosphodiester bonds using protected nucleotides
US6013445A (en) 1996-06-06 2000-01-11 Lynx Therapeutics, Inc. Massively parallel signature sequencing by ligation of encoded adaptors
US5614365A (en) 1994-10-17 1997-03-25 President & Fellow Of Harvard College DNA polymerase having modified nucleotide binding site for DNA sequencing
WO1997027317A1 (en) 1996-01-23 1997-07-31 Affymetrix, Inc. Nucleic acid analysis techniques
DE4438918A1 (en) 1994-11-04 1996-05-09 Hoechst Ag Modified oligonucleotides, their preparation and their use
SE9500342D0 (en) 1995-01-31 1995-01-31 Marek Kwiatkowski Novel chain terminators, the use thereof for nucleic acid sequencing and synthesis and a method of their preparation
AU5171696A (en) 1995-02-27 1996-09-18 Ely Michael Rabani Device, compounds, algorithms, and methods of molecular characterization and manipulation with molecular parallelism
CA2222744C (en) 1995-05-31 2008-03-25 Amersham Life Science, Inc. Thermostable dna polymerases
EP0745686A1 (en) 1995-06-01 1996-12-04 Roche Diagnostics GmbH The use of DNA polymerase 3'-intrinsic editing activity
US5770365A (en) 1995-08-25 1998-06-23 Tm Technologies, Inc. Nucleic acid capture moieties
US5728528A (en) 1995-09-20 1998-03-17 The Regents Of The University Of California Universal spacer/energy transfer dyes
US5962228A (en) * 1995-11-17 1999-10-05 Lynx Therapeutics, Inc. DNA extension and analysis with rolling primers
JP3439221B2 (en) 1995-12-18 2003-08-25 ワシントン ユニヴァーシティ Nucleic acid analysis method using fluorescence resonance energy transfer
US5658736A (en) 1996-01-16 1997-08-19 Genetics Institute, Inc. Oligonucleotide population preparation
US6312893B1 (en) 1996-01-23 2001-11-06 Qiagen Genomics, Inc. Methods and compositions for determining the sequence of nucleic acid molecules
US6613508B1 (en) 1996-01-23 2003-09-02 Qiagen Genomics, Inc. Methods and compositions for analyzing nucleic acid molecules utilizing sizing techniques
EP0992511B1 (en) 1996-01-23 2009-03-11 Operon Biotechnologies, Inc. Methods and compositions for determining the sequence of nucleic acid molecules
AU2320597A (en) 1996-03-19 1997-10-10 Molecular Tool, Inc. Method for determining the nucleotide sequence of a polynucleotide
EP0912752A1 (en) 1996-06-14 1999-05-06 Sarnoff Corporation Method for polynucleotide sequencing
US5821356A (en) 1996-08-12 1998-10-13 The Perkin Elmer Corporation Propargylethoxyamino nucleotides
US6361940B1 (en) 1996-09-24 2002-03-26 Qiagen Genomics, Inc. Compositions and methods for enhancing hybridization and priming specificity
GB9620209D0 (en) * 1996-09-27 1996-11-13 Cemu Bioteknik Ab Method of sequencing DNA
US5853992A (en) 1996-10-04 1998-12-29 The Regents Of The University Of California Cyanine dyes with high-absorbance cross section as donor chromophores in energy transfer labels
US5885775A (en) 1996-10-04 1999-03-23 Perseptive Biosystems, Inc. Methods for determining sequences information in polynucleotides using mass spectrometry
US5856104A (en) * 1996-10-28 1999-01-05 Affymetrix, Inc. Polymorphisms in the glucose-6 phosphate dehydrogenase locus
US5858671A (en) 1996-11-01 1999-01-12 The University Of Iowa Research Foundation Iterative and regenerative DNA sequencing method
AU5794498A (en) 1996-12-10 1998-07-03 Genetrace Systems, Inc. Releasable nonvolatile mass-label molecules
CA2277545A1 (en) 1997-01-08 1998-07-16 Proligo Llc Bioconjugation of oligonucleotides
US5876936A (en) * 1997-01-15 1999-03-02 Incyte Pharmaceuticals, Inc. Nucleic acid sequencing with solid phase capturable terminators
US6046005A (en) 1997-01-15 2000-04-04 Incyte Pharmaceuticals, Inc. Nucleic acid sequencing with solid phase capturable terminators comprising a cleavable linking group
US5804386A (en) 1997-01-15 1998-09-08 Incyte Pharmaceuticals, Inc. Sets of labeled energy transfer fluorescent primers and their use in multi component analysis
FR2758822B1 (en) 1997-01-30 1999-07-02 Centre Nat Rech Scient USE OF A POLYPEPTIDE AS A CELLULAR RECEPTOR OF ADENOVIRUS
US6136543A (en) * 1997-01-31 2000-10-24 Hitachi, Ltd. Method for determining nucleic acids base sequence and apparatus therefor
US6197557B1 (en) 1997-03-05 2001-03-06 The Regents Of The University Of Michigan Compositions and methods for analysis of nucleic acids
ATE280177T1 (en) 1997-03-20 2004-11-15 Hoffmann La Roche MODIFIED PRIMERS
ES2563643T3 (en) 1997-04-01 2016-03-15 Illumina Cambridge Limited Nucleic acid sequencing method
EP0985142A4 (en) 1997-05-23 2006-09-13 Lynx Therapeutics Inc System and apparaus for sequential processing of analytes
US6309829B1 (en) 1997-05-27 2001-10-30 Pe Corporation (Ny) Length determination of nucleic acid repeat sequences by discontinuous primer extension
EP2267165B1 (en) 1997-07-28 2016-11-30 Gen-Probe Incorporated Nucleic acid sequence analysis
US5834203A (en) 1997-08-25 1998-11-10 Applied Spectral Imaging Method for classification of pixels into groups according to their spectra using a plurality of wide band filters and hardwire therefore
US6008379A (en) 1997-10-01 1999-12-28 The Perkin-Elmer Corporation Aromatic-substituted xanthene dyes
JP2001519538A (en) 1997-10-10 2001-10-23 プレジデント・アンド・フェローズ・オブ・ハーバード・カレッジ Replica amplification of nucleic acid arrays
US6485944B1 (en) 1997-10-10 2002-11-26 President And Fellows Of Harvard College Replica amplification of nucleic acid arrays
US6511803B1 (en) 1997-10-10 2003-01-28 President And Fellows Of Harvard College Replica amplification of nucleic acid arrays
US6227607B1 (en) 1997-10-15 2001-05-08 James E. Dewald, Jr. Latching mechanism for latching a slide out room to main living area
US6627436B2 (en) 1997-10-31 2003-09-30 Stratagene Vector for gene expression in prokaryotic and eukaryotic systems
US5876036A (en) 1997-11-10 1999-03-02 Mathis; Darryl One-on-one basketball game apparatus
US5936087A (en) 1997-11-25 1999-08-10 The Perkin-Elmer Corporation Dibenzorhodamine dyes
GB9815163D0 (en) 1998-07-13 1998-09-09 Brax Genomics Ltd Compounds
CA2325399A1 (en) 1998-03-23 1999-09-30 Invitrogen Corporation Modified nucleotides and methods useful for nucleic acid sequencing
WO1999057321A1 (en) 1998-05-01 1999-11-11 Arizona Board Of Regents Method of determining the nucleotide sequence of oligonucleotides and dna molecules
US6780591B2 (en) 1998-05-01 2004-08-24 Arizona Board Of Regents Method of determining the nucleotide sequence of oligonucleotides and DNA molecules
US6175107B1 (en) * 1998-05-27 2001-01-16 Owens-Brockway Glass Container Inc. Inspection of containers employing a single area array sensor and alternately strobed light sources
US6096875A (en) 1998-05-29 2000-08-01 The Perlein-Elmer Corporation Nucleotide compounds including a rigid linker
US5948648A (en) 1998-05-29 1999-09-07 Khan; Shaheer H. Nucleotide compounds including a rigid linker
US6218530B1 (en) 1998-06-02 2001-04-17 Ambergen Inc. Compounds and methods for detecting biomolecules
US6287821B1 (en) 1998-06-11 2001-09-11 Orchid Biosciences, Inc. Nucleotide analogues with 3'-pro-fluorescent fluorophores in nucleic acid sequence analysis
US6335155B1 (en) 1998-06-26 2002-01-01 Sunesis Pharmaceuticals, Inc. Methods for rapidly identifying small organic molecule ligands for binding to biological target molecules
US6218118B1 (en) 1998-07-09 2001-04-17 Agilent Technologies, Inc. Method and mixture reagents for analyzing the nucleotide sequence of nucleic acids by mass spectrometry
CA2339121A1 (en) * 1998-07-30 2000-02-10 Shankar Balasubramanian Arrayed biomolecules and their use in sequencing
GB0002310D0 (en) 2000-02-01 2000-03-22 Solexa Ltd Polynucleotide sequencing
US6787308B2 (en) 1998-07-30 2004-09-07 Solexa Ltd. Arrayed biomolecules and their use in sequencing
WO2000009753A1 (en) 1998-08-11 2000-02-24 Caliper Technologies Corp. Methods and systems for sequencing dna by distinguishing the decay times of fluorescent probes
US6245507B1 (en) * 1998-08-18 2001-06-12 Orchid Biosciences, Inc. In-line complete hyperspectral fluorescent imaging of nucleic acid molecules
US20020012913A1 (en) 1998-09-15 2002-01-31 Kevin L. Gunderson Nucleic acid analysis using complete n-mer arrays
DE19844931C1 (en) 1998-09-30 2000-06-15 Stefan Seeger Procedures for DNA or RNA sequencing
US6500650B1 (en) 1998-10-01 2002-12-31 Variagenics, Inc. Method for identifying polymorphisms
US6221592B1 (en) * 1998-10-20 2001-04-24 Wisconsin Alumi Research Foundation Computer-based methods and systems for sequencing of individual nucleic acid molecules
AU772281B2 (en) 1998-12-14 2004-04-22 Li-Cor Inc. A system and methods for nucleic acid sequencing of single molecules by polymerase synthesis
US6207831B1 (en) 1998-12-21 2001-03-27 Novartis Ag Fluorescent dyes (AIDA) for solid phase and solution phase screening
US6380378B1 (en) 1998-12-24 2002-04-30 Toagosei Company, Ltd. Nucleotide compound, nucleotide block oligonucleotide, and method for producing them
ATE440148T1 (en) * 1999-01-06 2009-09-15 Callida Genomics Inc IMPROVED SEQUENCING VIA HYBRIDIZATION BY USING PROBE MIXTURES
US20030054360A1 (en) * 1999-01-19 2003-03-20 Larry Gold Method and apparatus for the automated generation of nucleic acid ligands
ATE469699T1 (en) 1999-02-23 2010-06-15 Caliper Life Sciences Inc MANIPULATION OF MICROPARTICLES IN MICROFLUID SYSTEMS
JP2002537858A (en) * 1999-03-10 2002-11-12 エーエスエム サイエンティフィック, インコーポレイテッド Methods for direct sequencing of nucleic acids
US7037654B2 (en) * 1999-04-30 2006-05-02 Aclara Biosciences, Inc. Methods and compositions for enhancing detection in determinations employing cleavable electrophoretic tag reagents
US7056661B2 (en) * 1999-05-19 2006-06-06 Cornell Research Foundation, Inc. Method for sequencing nucleic acid molecules
US6277607B1 (en) * 1999-05-24 2001-08-21 Sanjay Tyagi High specificity primers, amplification methods and kits
US6248884B1 (en) 1999-06-03 2001-06-19 The Perkin-Elmer Corporation Extended rhodamine compounds useful as fluorescent labels
DE60019512T2 (en) * 1999-06-07 2006-02-23 Fuji Photo Film Co., Ltd., Minami-Ashigara DNA chip, PNA chip, as well as manufacturing process
US6818395B1 (en) 1999-06-28 2004-11-16 California Institute Of Technology Methods and apparatus for analyzing polynucleotide sequences
US6242193B1 (en) 1999-07-30 2001-06-05 Hitachi, Ltd. Apparatus for determining base sequence of nucleic acid
US6316230B1 (en) 1999-08-13 2001-11-13 Applera Corporation Polymerase extension at 3′ terminus of PNA-DNA chimera
WO2001012776A2 (en) * 1999-08-16 2001-02-22 Human Genome Sciences, Inc. 18 human secreted proteins
US6982146B1 (en) 1999-08-30 2006-01-03 The United States Of America As Represented By The Department Of Health And Human Services High speed parallel molecular nucleic acid sequencing
WO2001016375A2 (en) 1999-08-30 2001-03-08 The Government Of The United States Of America, As Represented By The Secretary, Department Of Health And Human Services High speed parallel molecular nucleic acid sequencing
US6664399B1 (en) 1999-09-02 2003-12-16 E. I. Du Pont De Nemours & Company Triazole linked carbohydrates
US6274320B1 (en) * 1999-09-16 2001-08-14 Curagen Corporation Method of sequencing a nucleic acid
WO2001023610A2 (en) 1999-09-29 2001-04-05 Solexa Ltd. Polynucleotide sequencing
US6309836B1 (en) 1999-10-05 2001-10-30 Marek Kwiatkowski Compounds for protecting hydroxyls and methods for their use
DE60044030D1 (en) 1999-10-08 2010-04-29 Robert C Leif MARKER COMPLEXES OF CONJUGATED POLYMERS
WO2001029257A2 (en) * 1999-10-22 2001-04-26 Genset Methods of genetic cluster analysis
CA2388528A1 (en) 1999-11-04 2001-05-10 California Institute Of Technology Methods and apparatus for analyzing polynucleotide sequences
EP1244782A2 (en) * 1999-12-23 2002-10-02 Axaron Bioscience AG Method for carrying out the parallel sequencing of a nucleic acid mixture on a surface
GB0002389D0 (en) 2000-02-02 2000-03-22 Solexa Ltd Molecular arrays
AU2001241125A1 (en) 2000-03-14 2001-09-24 Itoham Foods Inc. Process for producing polypeptide having disulfide bond
US6495680B1 (en) 2000-03-24 2002-12-17 The University Of Toledo Helices and nanotubes on folding compositions and method of making same
WO2001073121A1 (en) 2000-03-30 2001-10-04 Toyota Jidosha Kabushiki Kaisha Method of determining base sequence of single nucleic acid molecule
GB0013276D0 (en) * 2000-06-01 2000-07-26 Amersham Pharm Biotech Uk Ltd Nucleotide analogues
GB0016473D0 (en) 2000-07-05 2000-08-23 Amersham Pharm Biotech Uk Ltd Sequencing method
DE60132596T2 (en) * 2000-08-03 2009-02-19 Roche Diagnostics Gmbh NUCLEIC ACID BINDING COMPOUNDS WITH PYRAZOLOi3,4-D PYRIMIDINE ANALOGUE OF PURINE-2,6-DIAMINE AND THEIR USE
JP2004508838A (en) 2000-09-11 2004-03-25 ザ・トラスティーズ・オブ・コランビア・ユニバーシティー・イン・ザ・シティー・オブ・ニューヨーク Combination fluorescent energy transfer tags and their use
US6627748B1 (en) 2000-09-11 2003-09-30 The Trustees Of Columbia University In The City Of New York Combinatorial fluorescence energy transfer tags and their applications for multiplex genetic analyses
US20060057565A1 (en) 2000-09-11 2006-03-16 Jingyue Ju Combinatorial fluorescence energy transfer tags and uses thereof
US9708358B2 (en) 2000-10-06 2017-07-18 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
ATE356222T1 (en) 2000-10-06 2007-03-15 Univ Columbia MASSIVE PARALLEL METHOD FOR DECODING DNA AND RNA
US7297518B2 (en) 2001-03-12 2007-11-20 California Institute Of Technology Methods and apparatus for analyzing polynucleotide sequences by asynchronous base extension
US20030027140A1 (en) 2001-03-30 2003-02-06 Jingyue Ju High-fidelity DNA sequencing using solid phase capturable dideoxynucleotides and mass spectrometry
DE10120797B4 (en) 2001-04-27 2005-12-22 Genovoxx Gmbh Method for analyzing nucleic acid chains
DE10120798B4 (en) 2001-04-27 2005-12-29 Genovoxx Gmbh Method for determining gene expression
US6573677B2 (en) * 2001-06-18 2003-06-03 Motorola, Inc. Method of compensating for abrupt load changes in an anti-pinch window control system
US6613523B2 (en) 2001-06-29 2003-09-02 Agilent Technologies, Inc. Method of DNA sequencing using cleavable tags
EP1415001A4 (en) 2001-07-13 2008-02-20 Ambergen Inc Nucleotide compositions comprising photocleavable markers and methods of preparation thereof
US6902904B2 (en) 2001-08-27 2005-06-07 Pharmanetics Incorporated Coagulation assay reagents containing lanthanides
WO2003020968A2 (en) 2001-08-29 2003-03-13 Genovoxx Gmbh Method for analyzing nucleic acid sequences and gene expression
GB0128526D0 (en) 2001-11-29 2002-01-23 Amersham Pharm Biotech Uk Ltd Nucleotide analogues
US7057026B2 (en) * 2001-12-04 2006-06-06 Solexa Limited Labelled nucleotides
GB0129012D0 (en) 2001-12-04 2002-01-23 Solexa Ltd Labelled nucleotides
WO2003064621A2 (en) * 2002-02-01 2003-08-07 Ambion, Inc. HIGH POTENCY siRNAS FOR REDUCING THE EXPRESSION OF TARGET GENES
US20030180769A1 (en) 2002-02-05 2003-09-25 Metzker Michael L. Substituted 4,4-difluoro-4-bora-3A,4A-diaza-s-indacene compounds for 8-color DNA sequencing
US6858393B1 (en) 2002-03-13 2005-02-22 Stratagene California Chain terminators for DNA synthesis
ATE304610T1 (en) 2002-04-04 2005-09-15 Biotage Ab PRIMER EXTENSION BASED METHOD USING NUCLEOTIDES LABELED BY CLIVABLE LINKERS
WO2003087302A2 (en) * 2002-04-12 2003-10-23 Stratagene Dual-labeled nucleotides
US7074597B2 (en) 2002-07-12 2006-07-11 The Trustees Of Columbia University In The City Of New York Multiplex genotyping using solid phase capturable dideoxynucleotides and mass spectrometry
WO2004018492A1 (en) 2002-08-12 2004-03-04 F. Hoffmann-La-Roche Ag Process for producing a ribofuranose
SI3147292T1 (en) 2002-08-23 2019-01-31 Illumina Cambridge Limited Labelled nucleotides
US7414116B2 (en) 2002-08-23 2008-08-19 Illumina Cambridge Limited Labelled nucleotides
EP3002289B1 (en) 2002-08-23 2018-02-28 Illumina Cambridge Limited Modified nucleotides for polynucleotide sequencing
JP2004085934A (en) * 2002-08-27 2004-03-18 Pentax Corp Extending cam mechanism for zoom lens barrel and extending cam mechanism
WO2004055160A2 (en) 2002-12-13 2004-07-01 The Trustees Of Columbia University In The City Of New York Biomolecular coupling methods using 1,3-dipolar cycloaddition chemistry
WO2004096747A1 (en) 2003-04-28 2004-11-11 Basf Aktiengesellschaft Process for the separation of palladium catalyst from crude reaction mixtures of aryl acetic acids obtained by carbonylation
DE10324808B4 (en) 2003-06-02 2005-10-20 Bosch Gmbh Robert Optimized controller configuration for a car parking brake
US20050170367A1 (en) 2003-06-10 2005-08-04 Quake Stephen R. Fluorescently labeled nucleoside triphosphates and analogs thereof for sequencing nucleic acids
GB0321306D0 (en) * 2003-09-11 2003-10-15 Solexa Ltd Modified polymerases for improved incorporation of nucleotide analogues
US7622026B2 (en) * 2004-03-02 2009-11-24 Panasonic Corporation Biosensor
CA2557818A1 (en) 2004-03-03 2005-09-15 The Trustees Of Columbia University In The City Of New York Photocleavable fluorescent nucleotides for dna sequencing on chip constructed by site-specific coupling chemistry
US20050239134A1 (en) 2004-04-21 2005-10-27 Board Of Regents, The University Of Texas System Combinatorial selection of phosphorothioate single-stranded DNA aptamers for TGF-beta-1 protein
WO2006073436A2 (en) 2004-04-29 2006-07-13 The Trustees Of Columbia University In The City Of New York Mass tag pcr for multiplex diagnostics
US20060105461A1 (en) * 2004-10-22 2006-05-18 May Tom-Moy Nanopore analysis system
US7393533B1 (en) 2004-11-08 2008-07-01 La Jolla Institute For Allergy And Immunology H3L envelope protein immunization methods and H3L envelope passive protection methods
WO2007002204A2 (en) 2005-06-21 2007-01-04 The Trustees Of Columbia University In The City Of New York Pyrosequencing methods and related compostions
US8796432B2 (en) 2005-10-31 2014-08-05 The Trustees Of Columbia University In The City Of New York Chemically cleavable 3'-o-allyl-DNTP-allyl-fluorophore fluorescent nucleotide analogues and related methods
WO2007053702A2 (en) 2005-10-31 2007-05-10 The Trustees Of Columbia University In The City Of New York Synthesis of four color 3'-o-allyl modified photocleavable fluorescent nucleotides and related methods
CA2630544A1 (en) 2005-11-21 2007-05-31 The Trustees Of Columbia University In The City Of New York Multiplex digital immuno-sensing using a library of photocleavable mass tags
WO2007146158A1 (en) 2006-06-07 2007-12-21 The Trustees Of Columbia University In The City Of New York Dna sequencing by nanopore using modified nucleotides
WO2008042067A2 (en) 2006-09-28 2008-04-10 Illumina, Inc. Compositions and methods for nucleotide sequencing
WO2008069973A2 (en) 2006-12-01 2008-06-12 The Trustees Of Columbia University In The City Of New York Four-color dna sequencing by synthesis using cleavable fluorescent nucleotide reversible terminators
US8481259B2 (en) 2007-02-05 2013-07-09 Intelligent Bio-Systems, Inc. Methods and devices for sequencing nucleic acids in smaller batches
WO2009054922A1 (en) 2007-10-19 2009-04-30 The Trustees Of Columbia University In The City Of New York Dna sequencing with non-fluorescent nucleotide reversible terminators and cleavable label modified nucleotide terminators
EP4310194A2 (en) 2007-10-19 2024-01-24 The Trustees of Columbia University in the City of New York Design and synthesis of cleavable fluorescent nucleotides as reversible terminators for dna sequencing by synthesis
JP5018402B2 (en) 2007-10-31 2012-09-05 ダイキン工業株式会社 Humidity control device
US8883999B2 (en) 2008-03-19 2014-11-11 Intelligent Bio Systems, Inc. Methods and solutions for inhibiting undesired cleaving of labels
DE102009027275A1 (en) 2009-06-29 2010-12-30 Robert Bosch Gmbh Image processing method for a driver assistance system of a motor vehicle for detecting and classifying at least a part of at least one predetermined picture element
US9309569B2 (en) 2010-08-26 2016-04-12 Intelligent Bio-Systems, Inc. Methods and compositions for sequencing nucleic acid using charge
CN103282518B (en) 2010-12-17 2016-11-16 纽约哥伦比亚大学理事会 Use synthesis limit, the DNA limit order-checking of modified nucleotide and nano-pore detection
WO2012162429A2 (en) 2011-05-23 2012-11-29 The Trustees Of Columbia University In The City Of New York Dna sequencing by synthesis using raman and infrared spectroscopy detection
WO2013154999A2 (en) 2012-04-09 2013-10-17 The Trustees Of Columbia University In The City Of New York Method of preparation of nanopore and uses thereof
WO2013191793A1 (en) 2012-06-20 2013-12-27 The Trustees Of Columbia University In The City Of New York Nucleic acid sequencing by nanopore detection of tag molecules
US10648026B2 (en) 2013-03-15 2020-05-12 The Trustees Of Columbia University In The City Of New York Raman cluster tagged molecules for biological imaging
US10732183B2 (en) 2013-03-15 2020-08-04 The Trustees Of Columbia University In The City Of New York Method for detecting multiple predetermined compounds in a sample
US9159610B2 (en) 2013-10-23 2015-10-13 Globalfoundires, Inc. Hybrid manganese and manganese nitride barriers for back-end-of-line metallization and methods for fabricating the same
US10718011B2 (en) 2014-02-12 2020-07-21 The Trustees Of Columbia University In The City Of New York Single molecule electronic multiplex SNP assay and PCR analysis
CA2943952A1 (en) 2014-03-24 2015-10-01 The Trustees Of Columbia University In The City Of New York Chemical methods for producing tagged nucleotides
CN106795554A (en) 2014-05-19 2017-05-31 哥伦比亚大学董事会 Use ion transducer DNA and the RNA synthesis order-checking of the reversible terminator of nucleotides
US10113084B2 (en) 2014-05-22 2018-10-30 Illinois Tool Works, Inc. Mold release agent

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9133511B2 (en) 2000-10-06 2015-09-15 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US9528151B2 (en) 2006-12-01 2016-12-27 The Trustees Of Columbia University In The City Of New York Four-color DNA sequencing by synthesis using cleavable fluorescent nucleotide reversible terminators
US9115163B2 (en) 2007-10-19 2015-08-25 The Trustees Of Columbia University In The City Of New York DNA sequence with non-fluorescent nucleotide reversible terminators and cleavable label modified nucleotide terminators
US9175342B2 (en) 2007-10-19 2015-11-03 The Trustees Of Columbia University In The City Of New York Synthesis of cleavable fluorescent nucleotides as reversible terminators for DNA sequencing by synthesis
US10260094B2 (en) 2007-10-19 2019-04-16 The Trustees Of Columbia University In The City Of New York DNA sequencing with non-fluorescent nucleotide reversible terminators and cleavable label modified nucleotide terminators

Also Published As

Publication number Publication date
US9725480B2 (en) 2017-08-08
WO2002029003A3 (en) 2002-07-18
DE20122767U1 (en) 2007-08-09
US10570446B2 (en) 2020-02-25
JP2004510433A (en) 2004-04-08
US9718852B2 (en) 2017-08-01
US20160264612A1 (en) 2016-09-15
US9719139B2 (en) 2017-08-01
US20170088575A1 (en) 2017-03-30
US20100317012A1 (en) 2010-12-16
US20190031704A1 (en) 2019-01-31
EP3034627A1 (en) 2016-06-22
US10633700B2 (en) 2020-04-28
HK1227441A1 (en) 2017-10-20
DE60127162D1 (en) 2007-04-19
US10577652B2 (en) 2020-03-03
US20190031706A1 (en) 2019-01-31
EP3034627B1 (en) 2019-01-30
US8088575B2 (en) 2012-01-03
DE60127162T2 (en) 2008-04-24
US20130096015A1 (en) 2013-04-18
US10669577B2 (en) 2020-06-02
EP1337541A2 (en) 2003-08-27
US20120142006A1 (en) 2012-06-07
US10407458B2 (en) 2019-09-10
US10407459B2 (en) 2019-09-10
US7635578B2 (en) 2009-12-22
US20040185466A1 (en) 2004-09-23
US20170313737A1 (en) 2017-11-02
US20080199868A1 (en) 2008-08-21
US20140206553A1 (en) 2014-07-24
EP1790736A2 (en) 2007-05-30
US20180201642A1 (en) 2018-07-19
US9868985B2 (en) 2018-01-16
US20080319179A1 (en) 2008-12-25
US20080131895A1 (en) 2008-06-05
EP1337541B1 (en) 2007-03-07
US7345159B2 (en) 2008-03-18
CA2425112A1 (en) 2002-04-11
EP1337541A4 (en) 2004-07-14
US20190085014A1 (en) 2019-03-21
US10662472B2 (en) 2020-05-26
US20190135850A1 (en) 2019-05-09
US20190085015A1 (en) 2019-03-21
US10457984B2 (en) 2019-10-29
ATE356222T1 (en) 2007-03-15
US20190092805A1 (en) 2019-03-28
US9133511B2 (en) 2015-09-15
US20150197800A1 (en) 2015-07-16
US20190031705A1 (en) 2019-01-31
US10428380B2 (en) 2019-10-01
US20190085016A1 (en) 2019-03-21
US7790869B2 (en) 2010-09-07
AU2001296645A1 (en) 2002-04-15
WO2002029003A2 (en) 2002-04-11
US20190135851A1 (en) 2019-05-09
US10669582B2 (en) 2020-06-02
US10435742B2 (en) 2019-10-08
US20170088891A1 (en) 2017-03-30
US20020102586A1 (en) 2002-08-01
US10648028B2 (en) 2020-05-12
US6664079B2 (en) 2003-12-16
US7713698B2 (en) 2010-05-11
US20170190730A2 (en) 2017-07-06
US20190092806A1 (en) 2019-03-28
EP1790736A3 (en) 2007-08-15

Similar Documents

Publication Publication Date Title
US10577652B2 (en) Massive parallel method for decoding DNA and RNA
US9708358B2 (en) Massive parallel method for decoding DNA and RNA
CA2754196A1 (en) Massive parallel method for decoding dna and rna

Legal Events

Date Code Title Description
EEER Examination request
MKEX Expiry

Effective date: 20211005