CA2331641C

CA2331641C - Multivalent antibody constructs

Info

Publication number: CA2331641C
Application number: CA2331641A
Authority: CA
Inventors: Melvyn Little; Sergej Kipriyanov
Original assignee: Deutsches Krebsforschungszentrum DKFZ
Current assignee: Deutsches Krebsforschungszentrum DKFZ
Priority date: 1998-05-05
Filing date: 1999-05-05
Publication date: 2011-06-28
Anticipated expiration: 2019-05-05
Also published as: DE59914538D1; ATE377027T1; US20070031436A1; WO1999057150A2; EP1078004A2; US7129330B1; AU4896099A; DE19819846A1; US8148496B2; DK1078004T3; DE19819846B4; ES2296395T3; US7507796B2; JP2002513805A; EP1078004B1; US20100099853A1; JP4431277B2; WO1999057150A3; CA2331641A1

Abstract

The invention relates to a multivalent Fv antibody construct comprising at least four variable domains which are connected to one another via peptide linkers 1, 2 and 3. The invention also relates to expression plasmids which code for such an Fv antibody construct. In addition, the invention relates to a method for producing the Fv antibody constructs and to the use thereof.

Description

Applicant: Deutsches Krebsforschungszentrum Attorney's File: K 2675 Multivalent Antibody Constructs The present invention relates to multivalent F, antibody constructs, expression plasmids which code for them, and a method for producing the Fv antibody constructs as well as the use thereof.

Natural antibodies are dimers and are therefore referred to as bivalent. They have four variable domains, namely two VH
domains and two VL domains. The variable domains serve as binding sites for an antigen, a binding site being formed from a VH domain and a VL domain. Natural antibodies recognize one antigen each, so that they are also referred to as monospecific. Furthermore, they also have constant domains which add to the stability of the natural antibodies. On the other hand, they are also co-responsible for undesired immune responses which result when natural antibodies of various animal species are administered mutually.

In order to avoid such immune responses, antibodies are constructed which lack the constant domains. In particular, these are antibodies which only comprise the variable domains. Such antibodies are designated Fv antibody constructs. They are often available in the form of single-chain monomers paired with one another.

However, it showed that F, antibody constructs only have little stability. Therefore, their usability for therapeutic purposes is strongly limited.

Thus, it is the object of the present invention to provide an antibody by means of which undesired immune responses can be avoided. Furthermore, it shall have a stability which makes it usable for therapeutic uses.

According to the invention this is achieved by the subject matters defined in the claims.

Therefore, the subject matter of the present invention relates to a multivalent F, antibody construct which has great stability. Such a construct is suitable for diagnostic and therapeutic purposes.

The present invention is based on the applicant's insights that the stability of an Fv antibody construct can be increased if it is present in the form of a single-chain dimer where the four variable domains are linked with one another via three peptide linkers. The applicant also recognized that the Fv antibody construct folds with itself when the middle peptide linker has a length of about 10 to 30 amino acids. The applicant also recognized that the F, antibody construct folds with other F,, antibody constructs when the middle peptide linker has a length of about up to amino acids so as to obtain a multimeric, i.e.
multivalent, Fv antibody construct. The applicant also realized that the Fv antibody construct can be multi-specific.

According to the invention the applicant's insights are utilized to provide a multi-valent FF, antibody construct which comprises at least four variable domains which are linked with one another via peptide linkers 1, 2 and 3.

The expression "FV antibody construct" refers to an antibody which has variable domains but no constant domains.

The expression "multivalent Fv antibody construct" refers to an FV antibody which has several, but at least four, variable domains. This is achieved when the single-chain Fv antibody construct folds with itself so as to give four variable domains, or folds with other single-chain Fv antibody constructs. In the latter case, an Fv antibody construct is given which has 8, 12, 16, etc., variable domains. It is favorable for the F, antibody construct to have four or eight variable domains, i.e. it is bivalent or tetravalent (cf. Fig. 1) . Furthermore, the variable domains may be equal or differ from one another, so that the antibody construct recognizes one or several antigens. The antibody construct preferably recognizes one or two antigens, i.e. it is monospecific and bispecific, respectively. Examples of such antigens are proteins CD19 and CD3.

The expression "peptide linkers 1, 3" refers to a peptide linker adapted to link variable domains of an Fv antibody construct with one another. The peptide linker may contain any amino acids, the amino acids glycine (G), serine (S) and proline (P) being preferred. The peptide linkers 1 and 3 may be equal or differ from each other. Furthermore, the peptide linker may have a length of about 0 to 10 amino acids. In the former case, the peptide linker is only a peptide bond from the COOH residue of one of the variable domains and the NH2 residue of another of the variable domains. The peptide linker preferably comprises the amino acid sequence GG.

The expression "peptide linker 2" refers to a peptide linker adapted to link variable domains of an Fv antibody construct with one another. The peptide linker may contain any amino acids, the amino acids glycine (G), serine (S) and proline (P) being preferred. The peptide linker may also have a length of about 3 to 10 amino acids, in partiuclar 5 amino acids, and most particularly the amino acid sequence GGPGS, which serves for achieving that the single-chain F, antibody construct folds with other single-chain Fv antibody constructs. The peptide linker can also have a length of about 11 to 20 amino acids, in particular 15 to 20 amino acids, and most particularly the amino acid sequence (G4S) 4, which serves for achieving that the single-chain F, antibody construct folds with itself.

An F, antibody construct according to the invention can be produced by common methods. A method is favorable in which DNAs coding for the peptide linkers 1, 2 and 3 are ligated with DNAs coding for the four variable domains of an Fv antibody construct such that the peptide linkers link the variable domains with one another and the resulting DNA
molecule is expressed in an expression plasmid. Reference is made to Examples 1 to 6. As to the expressions "FV antibody construct" and "peptide linker" reference is made to the above explanations and, by way of supplement, to Maniatis, T. et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory 1982.

DNAs which code for an F, antibody construct according to the invention also represent a subject matter of the present invention. Furthermore, expression plasmids which contain such DNAs also represent a subject matter of the present invention. Preferred expression plasmids are pDISC3x19-LL, pDISC3xl9-SL, pPIC-DISC-LL, pPIC-DISC-SL, pDISC5-LL and pDISC6-SL. The first four were deposited with the DSMZ
(Deutsche Sammlung fur Mikroorganismen and Zellen) [German-type collection for micro-organisms and cells] on April 30, 1998 under DSM 12150, DSM 12149, DSM 12152 and DSM 12151, respectively.

Another subject matter of the present invention relates to a kit, comprising:

(a) an F, antibody construct according to the invention, and/or (b) an expression plasmid according to the invention, and (c) conventional auxiliary agents, such as buffers, solvents and controls.

One or several representatives of the individual components may be present.

The present invention provides a multivalent FV antibody construct where the variable domains are linked with one another via peptide linkers. Such an antibody construct distinguishes itself in that it contains no parts which can lead to undesired immune reactions. Furthermore, it has great stability. It also enables to bind several antigens simultaneously. Therefore, the FV antibody construct according to the invention is perfectly adapted to be used not only for diagnostic but also for therapeutic purposes.
Such purposes can be seen as regards any disease, in particular a viral, bacterial or tumoral disease.

Brief description of the drawings:

Fig. 1 shows the genetic organization of an FV antibody construct (A) according to the invention and schemes for forming a bivalent (B) or tetravalent E, antibody construct (C) . Ag: antigen; His6: six C-terminal histidine residues;
stop: stop codon (TAA); VH and VL: variable region of the heavy and light chains.

Fig. 2 shows the scheme for the construction of the plasmids pDISC3xl9-LL and pDISC3xl9-SL. c-myc: sequence coding for an epitope which is recognized by the antibody 9E1, His6:
sequence which codes for six C-terminal histidine residues;
PelB: signal peptide sequence of the bacterial pectate lyase (PelB leader); rbs: ribosome binding site; Stop: stop codon (TAA); VH and VL: variable region of the heavy and light chains.

Fig. 3 shows a diagram of the expression plasmid pDISC3xl9-LL. 6xHis: sequence which codes for six C-terminal histidine residues; bla: gene which codes for B-lactamase responsible for ampicillin resistance; bp: base pairs; c-myc: sequence coding for an epitope which is recognized by the 9E10 antibody; ColEl: origin of the DNA replication; fl-IG:
intergenic region of the bacteriophage fl; Lac P/O: wt lac-operon promoter/operator; linker 1: sequence which codes for a GlyGly dipeptide linking the VH and VL domains; linker 2:
sequence coding for a (Gly4Ser)4 polypeptide which links the hybrid scFv fragments; Pel-B leader: signal peptide sequence of the bacterial pectate lyase; rbs: ribosome binding site;
VH and VL: variable region of the heavy and light chains.

Fig. 4 shows a diagram of the expression plasmid pDISC3xl9-SL. 6xHis: sequence which codes for six C-terminal histidine residues; bla: gene which codes for 13-lactamase which is responsible for the ampicillin resistance; bp: base pairs;
c-myc: sequence coding for an epitope recognized by the 9E10 antibody; ColEl: origin of DNA replication; fl-IG:
intergenic region of the bacteriophage fl; Lac P/0: wt lac-operon promoter/operator: linker 1: sequence which codes for a GlyGly dipeptide which links the VH and VL domains; linker 3: sequence which codes for a GlyGlyProGlySer oligopeptide which links the hybrid scFv fragments; Pel-B leader: signal peptide sequence of the bacterial pectate lyase; rbs:
ribosome binding site; VH and VL: variable region of the heavy and light chains.

Fig. 5 shows the nucleotide sequence and the amino acid sequence derived therefrom of the bivalent Fv antibody construct encoded by the expression plasmid pDIS3xl9-LL. c-myc epitope: sequence coding for an epitope which is recognized by the antibody 9E10; CDR: region determining the complementarity; framework: framework region; His6 tail:
sequence which codes for six C-terminal histidine residues;
PelB leader: signal peptide sequence of the bacterial pectate lyase; RBS: ribosome binding site; VH and VL:
variable region of the heavy and light chains.

Fig. 6 shows the nucleotide sequence and the derived amino acid sequence of the tetravalent Fv antibody construct encoded by the expression plasmid pDISC3x19-SL. c-myc epitope: sequence coding for an epitope which is recognized by the 9E10 antibody; CDR: region determining complementarity; framework: framework region; His6 tail:
sequence coding for the six C-terminal histidine residues;
Pe1B leader: signal peptide sequence of the bacterial pectate lyase; RBS: ribosome binding site; Vii and VL:
variable region of the heavy and light chains.

Fig. 7 shows the nucleotide sequence and the derived amino acid sequence of a connection between a gene which codes for an a-factor leader sequence and a gene coding for the tetravalent F, antibody construct in the Pichia expression plasmid pPIC-DISC-SL. Alpha-factor signal: leader peptide sequence of the Saccharomyces cerevisiae-a factor secretion signal; VH: variable region of the heavy chain. Rhombs indicate the signal cleaving sites.

Fig. 8 shows the nucleotide sequence and the derived amino acid sequence of a connection between a gene coding for an a-factor leader sequence and a gene which codes for the bivalent F, antibody construct in the Pichia expression plasmid pPIC-DISC-LL. Alpha-factor signal: leader peptide sequence of the Saccharomyces cerevisiae-a factor secretion signal; VH: variable region of the heavy chain. Rhombs show the signal cleaving sites.

Fig. 9 shows a diagram of the expression plasmid pDISC5-LL.
6xHis: sequence coding for six C.-terminal histidine residues; bla: gene which codes for 8-lactamase responsible for ampicillin resistance; bp: base pairs; c-myc: sequence coding for an epitope which is recognized by the 9E10 antibody; hok-sok: plasmid-stabilizing DNA locus; Lacl: gene which codes for the Lac repressor; Lac P/O: wt lac-operon-promoter/operator; LacZ': gene which codes for the a-peptide of B-galactosidase; linker 1: sequence which codes for a GlyGly dipeptide connecting the VH and VL domains; linker 2:
sequence which codes for a (Gly4Ser)4 polypeptide linking the hybrid scFv fragments; M13 IG: intergenic region of the M13 bacteriophage; pBR322ori: origin of DNA replication;
Pel-B leader: signal peptide sequence of the bacterial pectate lyase; rbs: ribosome binding site which originates from the E. coli lacZ gene (lacZ), from the bacteriophage T7 gene 10 (T7glO) or from the E. coli skp gene (skp); skp:
gene which codes for the bacterial periplasmic factor Skp/OmpH; tHP: strong transcription terminator; tIPP:
transcription terminator; VH and VL: variable region of the heavy and light chains.

Fig. 10 shows a diagram of the expression plasmid p9ISC6-SL.
6xHis: sequence which codes for six C-terminal histidine residues; bla: gene which codes for I-lactamase responsible for ampicillin resistance; bp: base pairs: c-myc: sequence coding for an epitope which is recognized by the 9E10 antibody; hok-sok: plasmid-stabilized DNA locus; Lacl: gene which codes for the Lac repressor; Lac P/O: wt lac-operon promoter/operator; LacZ': gene which codes for the a-peptide of J-galactosidase; linker 1: sequence which codes for a GlyGly dipeptide which links the VH and VL domains; linker 3: sequence which codes for a GlyGlyProGlySer oligopeptide linking the hybrid scFv fragments: M13 IG: intergenic region of the M13 bacteriophage; pBR322ori: origin of DNA
replication; Pel-B leader: signal peptide sequence of the bacterial pectate lyase; rbs: ribosome binding site originating from the E. coli lacZ gene (lacZ), from the bacteriophage T7 gene 10 (T7g10) or from the E. coli skp gene (skp); skp: gene which codes for the bacterial periplasmic factor Skp/OmpH; tHP: strong transcription terminator; tIPP: transcription terminator; VH and VL:
variable region of the heavy and light chains.

The invention is explained by the below examples.

Example 1: Construction of the plasmids pDISC3x19-LL and pDISC3x19-SL for the expression of bivalent, bispecific and/or tetravalent, bispecific Fõ
antibody constructs in bacteria The plasmids pHOG-aCD19 and pHOG-dmOKT3 which code for the scFv fragments derived from the hybridoma HD37 which is specific to human CD19 (Kipriyanov et al., 1996, J.-Immunol.
Meth. 196, 51-62) and from the hybridoma OKT3 which is specific to human CD3 (Kipriyanov et al., 1997, Protein Eng. 10, 445-453), respectively, were used for the construction of expression plasmids for a single-chain F, antibody construct. A PCR fragment 1 of the VH domain of anti-CD19, followed by a segment which codes for a GlyGly linker, was produced using the primers DP1, 5'-TCACACAGAATTC-TTAGATCTATTAAAGAGGAGAAATTAACC, and DP2, 51-AGCACACGATATCACCGCCAAGCTTGGGTGTTGTTTTGGC (cf. Fig. 2). The PCR fragment 1 was cleaved by EcoRI and EcoRV and ligated with the EcoRI/EcoRV-linearized plasmid pHOG-dmOKT3 so as to produce the vector pHOG19-3. The PCR fragment 2 of the VL
domain of anti-CD19, followed by a segment which codes for a c-myc epitope and a hexahistidinyl tail, was produced using the primers DP3, 5'-AGCACACAAGCTTG000GTGATATCTTGCTCACCCAAAC-TCCA, and DP4, 5' -AGCACACTCTAGAGACACACAGATCTTTAGTGATGGTGAT-GGTGATGTGAGTTTAGG. The PCR fragment 2 was cleaved by Hindlll and XbaI and ligated with the HIndIII/XbaI-linearized plasmid pHOG-dmOKT3 so as to obtain the vector pHOG3-19 (cf.
Fig. 2) . The gene coding for the hybrid scFv-3-19 in the plasmid pHOG3-19 was amplified by means of PCR with the primers Bi3sk, 5'-CAGCCGGCCATGGCGCAGGTGCAACTGCAGCAG and either Li-1, 5'-TATATACTGCAGCTGCACCTGGCTACCACCACCACCGGAGCCG-CCACCACCGCTACCACCGCCGCCAGAACCACCACCACCAGCGGCCGCAGCATCAGCCCG, for the production of a long flexible (Gly4Ser)4 inter-scFV
linker (PCR fragment 3, cf. Fig. 2) or Li-2, 5'-TATATA-CTGCAGCTGCACCTGCGACCCTGGGCCACCAGCGGCCGCAGCATCAGCCCG, for the production of a short rigid GGPGS linker (PCR fragment 4, cf. Fig. 2). The expression plasmids pDISC3x19-LL and pDISC3x19-SL were constructed by ligating the NcoI/PvuII
restriction fragment from pHOG19-3, comprising the vector framework and the NcoI/PvuII-cleaved PCR fragments 3 and 4, respectively (cf. Figs. 3, 4). The complete nucleotide and protein sequences of the bivalent and tetravalent Fv antibody constructs are indicated in Figs 5 and 6, respectively.

Example 2: Construction of the plasmids pPIC-DISC-LL and pPIC-DISC-SL for the expression of bivalent, bispecific and/or tetravalent, bispecific F, antibody constructs in yeast (A) Construction of pPIC-DISC-SL

The vector pPICZaA (Invitrogen By, Leek, Netherlands) for the expression and secretion of recombinant proteins in the yeast Pichia pastoris was used as a starting material. It contains a gene which codes for the Saccharomyces cerevisiae a-factor secretion signal, followed by a polylinker. The secretion of this vector is based on the dominant selectable marker, ZeocinTM which is bifunctional in both Pichia and E.
coif. The gene which codes for the tetravalent Fv antibody construct (scDia-SL) was amplified by means of PCR by the template pDISC3x19-SL using the primers 5-PIC, 51-CCGTGAATTCCAGGTGCAACTGCAGCAGTCTGGGGCTGAACTGGC, and pSEXBn 5'-GGTCGACGTTAACCGACAAACAACAGATAAAACG. The resulting PCR
product was cleaved by EcoRI and XbaI and ligated in EcoRI/XbaI-linearized pPICZaA. The expression plasmid pPIC-DISC-SL was obtained. The nucleotide and protein sequences of the tetravalent F, antibody construct are shown in Fig.
7.

(B) Construction of pPIC-DISC-LL

The construction of pPIC-DISC-LL was carried out on the basis of pPICZaA (Invitrogen By, Leek, Netherlands) and pDISC3xl9-LL (cf. Fig. 3). The plasrnid-DNA pPIr-ZaA was cleaved by EcoRI. The overhanging 5'-ends were filled using a Klenow fragment of the E. coli DNA polymerase I. The resulting DNA was cleaved by XbaI, and the large fragment comprising the pPIC vector was isolated. Analogous thereto the DNA of pDISC3xl9-LL was cleaved by NcoI and treated with a Klenow fragment. Following the cleavage using Xbal a small fragment, comprising a gene coding for the bivalent Fv antibody, was isolated. Its ligation with a pPIC-derived vector-DNA resulted in the plasmid pPIC-DISC-LL. The nucleotide and protein sequences of the bivalent Fv antibody construct are shown in Fig. 8.

Example 3: Expression of the tetravalent and/or bivalent Fv antibody construct in bacteria E. coli XL1-blue cells (Strategene, La Jolla, CA) which had been transformed with the expression plasmids pDISC3xl9-LL
and pDISC3xl9-SL, respectively, were cultured overnight in 2xYT medium with 50 pg/ml ampicillin and 100 mM glucose (2xYTGa) at 37 C. 1:50 dilutions of the overnight cultures in 2xYTGA were- cultured as flask cultures at 37 C while shaking with 200 rpm. When the cultures had reached an OD600 value of 0.8, the bacteria were pelleted by 10-minute centrifugation with 1500 g at 20 C and resuspended in the same volume of a fresh 2xYT medium containing 50 pg/ml ampicillin and 0.4 M saccharose. IPTG was added up to a final concentration of 0.1 mM, and the growth was continued at room temperature (20-22 C) for 18 - 20 h. The cells were harvested by 10-minute centrifugation with 5000 g at 4 C.
The culture supernatant was held back and stored on ice. In order to isolate the soluble periplasmic proteins, the pelleted bacteria were resuspended in 5 % of the initial volume of ice-cold 50 mM Tris-HC1, 20 % saccharose, 1 mM
EDTA, pH 8Ø Following 1 hour of incubation on _ice with occasional stirring the spheroplasts were centrifuged with 30,000 g at 4 C for 30 minutes, the soluble periplasmic extract being obtained as supernatant and the spheroplasts with the insoluble periplasmic material being obtained as pellet. The culture supernatant and the soluble periplasmic extract were combined and clarified by further centrifugation (30,000 g, 4 C, 40 min.). The recombinant product was concentrated by ammonium sulfate precipitation (final concentration 70 % saturation). The protein precipitate was obtained by centrifugation (10,000 g, 4 C, 40 min.) and dissolved in 10 % of the initial volume of 50 mM Tris-HC1, 1 M NaCl, pH 7Ø An immobilized metal affinity chromatography (IMAC) was carried out at 4 C using a 5 ml column of chelating sepharoseTM(Pharmacia) which was charged with Cu 2+ and had been equilibrated with 50 mM Tris-HC1, 1 M
NaCl, pH 7.0 (starting buffer) . The sample was loaded by passing it over the column. It was then washed with twenty column volumes of starting buffer, followed by starting buffer with 50 mM imidazole until the absorption at 280 nm of the effluent was at a minimum (about thirty column volumes) . The absorbed material was eluted with 50 mM Tris-HC1, 1 M NaCl, 250 mM imidazole, pH 7Ø

The protein concentrations were determined with the Bradford dye binding test (1976, Anal. Biochem. 72, 248-254) using the Bio-Rad (Munich, Germany) protein assay kit. The concentrations of the purified tetravalent and bivalent Fv antibody constructs were determined from the A280 values using the extinction coefficients 1mg/ml = 1.96 and 1.93, respectively.

Example 4: Expression of the tetravalent and/or bivalent antibody construct in the yeast Pichia pastoris Competent P. pastoris GS155 cells (Invitrogen) were electroporated in the presence of 10 pg plasmid-DNA of pPIC-DISC-LL and pPIC-DISC-SL, respectively, which had been linearized with Sacl. The transformants were selected for 3 days at 30 C on YPD plates containing 100 pg/ml ZeocinTM
The clones which secreted the bivalent and/or tetravalent Fv antibody constructs were selected by plate screening using an anti-c-myc-mAk 9E10 (IC Chemikalien, Ismaning, Germany).
For the expression of the bivalent Fv antibody constructs and tetravalent Fv antibody constructs, respectively, the clones were cultured in YPD medium in shaking flasks for 2 days at 30 C with stirring. The cells were centrifuged resuspended in the same volume of the medium containing methanol and incubated for another 3 days at 30 C with stirring. The supernatants were obtained after the centrifugation. The recombinant product was isolated by ammonium sulfate precipitation, followed by IMAC as described above.

Example 5: Characterization of the tetravalent F,, antibody construct and bivalent Fv antibody construct, respectively, (A) Size exclusion chromatography An analytical gel filtration of the F, antibody constructs was carried out in PBS using a superdex 200-HR10/30 column (Pharmacia). The sample volume and the flow rate were 200 p1/min and 0.5 ml/min, respectively. The column was calibrated with high-molecular and low-molecular gel filtration calibration kits (Pharmacia).

(B) Flow cytometry The human CD3+/CD19--acute T-cell leukemia line Jurkat and the CD19+/CD3- B-cell line JOK-1 were used for flow cytometrie. 5 x 105 cells in 50 pl RPMI 1640 medium (GIBCO
BRL, Eggestein, Germany) which was supplemented with 10 %
FCS and 0.1 % sodium azide (referred to as complete medium) were incubated with 100 pl of the F, antibody preparations for 45 minutes on ice. After washing using the complete medium the cells were incubated with 100 pl 10 pg/ml anti-c-myc-Mak 9E10 (IC Chemikalien) in the same buffer for 45 min on ice. After a second wash cycle, the cells were incubated with 100 pl of the FITC-labeled goat-anti-mouse-IgG (GIBCO
BRL) under the same conditions as before. The cells were then washed again and resuspended in 100 pl 1 pg/ml propidium iodide solution (Sigma, Deisenhofen, Germany) in complete medium with the exclusion of dead cells. The relative fluorescence of the stained cells was measured using a FACScan flow cytometer (Becton Dickinson, Mountain View, CA).

(C) Cytotoxicity test The CD19-expressing Burkitt lymphoma cell line Raji and Namalwa were used as target cells. The cells were incubated in RPMI 1640 (GIBCO BRL) which was supplemented with 10 %

heat-inactivated FCS (GIBCO BRL), 2 mM glutamine and 1 mM
pyruvate, at 37 C in a dampened atmosphere with 7.5 % CO2.
The cytotoxic T-cell tests were carried out in RPMI-1640 medium supplemented with 10 % FCS, 10 mM HEPES, 2 mM
glutamine, 1 mM pyruvate and 0.05 mM 2-ME. The cytotoxic activity was evaluated using a standard[51Cr] release test;
2 x 106 target cells were labeled with 200 pCi Na [51Cr] 04 (Amersham-Buchler, Braunschweig, Germany) and washed 4 times and then resuspended in medium in a concentration of 2 x 105/ml. The effector cells were adjusted to a concentration of 5 x 106/ml. Increasing amounts of CTLs in 100 pl were titrated to 104 target cells/well or cavity in 50 pl. 50 pl antibodies were added to each well. The entire test was prepared three times and incubated at 37 C for 4 h. 100 pl of the supernatant were collected and tested for [51Cr]
release in a gamma counter (Cobra Auto Gamma; Canberra Packard, Dreieich, Germany). The maximum release was determined by incubation of the target cells in 10 % SDS, and the spontaneous release was determined by incubation of the cells in medium alone. The specific lysis (%) was calculated as: (experimental release - spontaneous release)/(maximum release - spontaneous release) x 100.

Example 6: Construction of the plasmids pDISC5-LL and pDISC5-SL for the expression of bivalent, bispecific and/or tetravalent, bispecific F, antibody constructs in bacteria by high cell density fermentation Expression vectors were prepared which contained the hok/sok plasmid-free cell suicide system and a gene which codes for the Skp/OmpH periplasmic factor for a greater production of recombinant antibodies. The skp gene was amplified by PCR
using the primers skp-l, 5'-CGA ATT CTT AAG ATA AGA AGG AGT

TTA TTG TGA AAA AGT GGT TAT TAG CTG CAG G and skp-2, 5'-CGA
ATT AAG CTT CAT TAT TTA ACC TGT TTC AGT ACG TCG G using the plasmid pGAH317 (Hoick and Kleppe, 1988, Gene 67, 117-124).
The resulting PCR fragment was cleaved by AflII and Hindlll and inserted in the AflII/HindIll-linearized plasmid pHKK
(Horn et al., 1996, Appl. Microbiol. Biotechnol. 46, 524-532) so as to obtain the vector pSKK. The genes obtained in the plasmids pDISC3xl9-LL and pDISC3x1.9-SL and coding for the scFv antibody constructs were amplified by means of the primers fe-1, 5'-CGA ATT TCT AGA TAA GAA GGA GAA ATT AAC CAT
GAA ATA CC and fe-2, 5'-CGA ATT CTT AAG CTA TTA GTG ATG GTG
ATG GTG ATG TGA G. The XbaI/AflII-cleaved PCR fragments were inserted in pSKK before the skp insert so as to obtain the expression plasmids pDISC5-LL and pDISC6-SL, respectively, which contain tri-cistronic operons under the control of the lac promoter/operator system (cf. figs. 9, 10).

SEQUENCE LISTING

<110> Deutsches Krebsforschungszentrum Stiftung Des Offentlichen Rechts <120> Multivalent Antibody Constructs <130> 1.1279-3 <140> CA 2,331,641 <141> 1999-05-05 <150> DE 198 19 846.9 <151> 1998-05-05 <160> 1.7 <170> Patentln Ver. 2.1.
<210> 1 <211> 1698 <212> DNA
<213> unknown <220>
<221> CDS
<222> (28)... (1689) <400> 1 gaattcatta aagaggagaa attaacc atg aaa tac cta ttg cct acg gca 51 Met Lys Tyr Leu Leu Pro Thr Ala gcc get ggc ttg ctg ctg ctg gca get cag ccg gcc atg gcg cag gtg 99 Ala Ala Gly Leu Leu Leu Leu Ala Ala Gln Pro Ala Met Ala Gln Val caa ctg cag cag tct ggg get caa ctg gca aga cct ggg gcc tca gtg 147 Gln Leu Gln Gln Ser Gly Ala Glu Leu Ala Arg Pro Gly Ala Ser Val aag atg tcc tgc aag get tct cgc tac acc ttt act agg tac acg atg 195 Lys Met Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Arg Tyr Thr Met cac tgg gta aaa cag agg cct gga cag ggt ctg gaa tgg att gga tac 243 His Trp Val Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile Gly Tyr att aat cct agc cgt ggt tat act aat tac aat cag aag ttc aag gac 291 Ile Asn Pro Ser Arg Gly Tyr Thr Asn Tyr Asn Gln Lys Phe Lys Asp aag gcc aca ttg act aca gac aaa tcc tcc agc aca gcc tac atg caa 339 Lys Ala Thr Leu Thr Thr Asp Lys Ser Ser Ser Thr Ala Tyr Met Gln ctg agc agc ctg aca tct gag gac tct gca gtc tat tac tgt gca aga 387 Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys Ala Arg tat tat gat gat cat tac agc ctt gac tac tgg ggc caa ggc acc act 435 Tyr Tyr Asp Asp His Tyr Ser Leu Asp Tyr Trp Gly Gln Gly Thr Thr ctc aca gtc tcc tca gcc aaa aca aca ccc aag ctt ggc ggt gat atc 4B3 Leu Thr Val Ser Ser Ala Lys Thr Thr Pro Lys Leu Gly Gly Asp Ile ttg ctc acc caa act cca get tct ttg get gtg tct cta ggg cag agg 531 Leu Leu Thr Gln Thr Pro Ala Ser Leu Ala Val Ser Leu Gly Gln Arg 155 :L60 165 gcc acc atc tcc tgc aag gcc agc caa agt gtt gat tat gat ggt gat 579 Ala Thr Ile Ser Cys Lys Ala Ser Gln Ser Val Asp Tyr Asp Gly Asp agt tat ttg aac tgg tac caa cag att cca gga cag cca ccc aaa ctc 627 Ser Tyr Leu Asn Trp Tyr Gin Gln Ile Pro Gly Gln Pro Pro Lys Leu ctc atc tat gat gca tcc aat cta gtt tct ggg atc cca ccc agg ttt 675 Leu Ile Tyr Asp Ala Ser Asn Leu Val Ser Gly Ile Pro Pro Arg Phe agt ggc agt ggg tct ggg aca gac ttc acc ctc aac atc cat cct gtg 723 Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Asn Ile His Pro Val gag aag gtg gat get gca acc tat cac tgt cag caa agt act gag gat 771 Glu Lys Val Asp Ala Ala Thr Tyr His Cys Gln Gln Ser Thr Glu Asp ccg tgg acg ttc ggt gga ggc a cc aag ctg gaa atc aaa cgg get gat 819 Pro Trp Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg Ala Asp get gcg gcc get ggt ggt ggt ggt tct ggc ggc ggt ggt agc ggt ggt 867 Ala Ala Ala Ala Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly ggc ggc tcc ggt ggt ggt ggt agc cag gtg cag ctg cag cag tct ggg 9-5 Gly Gly Ser Gly Gly Gly Gly Ser Gln Val Gln Leu Gln Gln Ser Gly get gag ctg gtg agg cct ggg tcc tca gtg aag att tcc tgc aag get 963 Ala Glu Leu Val Arg Pro Gly Ser Ser Val Lys Ile Ser Cys Lys Ala tct ggc tat gca ttc agt agc ta.c tgg atg aac tgg gtg aag cag agg 1011 Ser Gly Tyr Ala Phe Ser Ser Tyr Trp Met Asn Trp Val Lys Gln Arg 315 '20 325 cct gga cag ggt ctt gag tgg att gga cag att tgg cct gga gat ggt 1059 Pro Gly Gln Gly Leu Glu Trp Ile Gly Gln Ile Trp Pro Gly Asp Gly gat act aac tac aat gga aag tt.c aag ggt aaa gcc act ctg act gca 1107 Asp Thr Asn Tyr Asn Gly Lys Phe Lys Gly Lys Ala Thr Leu Thr Ala gac gaa tcc tcc agc aca gcc tac atg caa ctc agc agc cta gca tct 1155 Asp Glu Ser Ser Ser Thr Ala Tyr Met Gln Leu Ser Ser Leu Ala Ser gag gac tct gcg gtc tat ttc t:gt gca aga cgg gag act acg acg gta 1203 Glu Asp Ser Ala Val Tyr Phe Cys Ala Arg Arg Glu Thr Thr Thr Val ggc cgt tat tac tat get atg gac tac tgg ggt caa gga acc tca gtc 1251 Gly Arg Tyr Tyr Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr Ser Val acc gtc tcc tca gcc aaa aca aca ccc aag ctt ggc ggt gat atc gtg 1299 Thr Val Ser Ser Ala Lys Thr Thr Pro Lys Leu Gly Gly Asp Ile Val ctc act cag tct cca gca atc atg tct gca tct cca ggg gag aag gtc 1347 Leu Thr Gln Ser Pro Ala Ile Met Ser Ala Ser Pro Gly Glu Lys Val acc atg acc tgc agt gcc agc tca agt gta agt tac atg aac tgg tac 1395 Thr Met Thr Cys Ser Ala Ser Ser Ser Val Ser Tyr Met Asn Trp Tyr cag cag aag tca ggc acc tcc ccc aaa aga tgg att tat gac aca tcc 1443 Gln Gln Lys Ser Gly Thr Ser pro Lys Arg Trp Ile Tyr Asp Thr Ser aaa ctg get tct gga gtc cct get cac ttc agg ggc agt ggg tct ggg 1491 Lys Leu Ala Ser Gly Val Pro Ala His Phe Arg Gly Ser Gly Ser Gly acc tct tac tct ctc aca atc agc ggc atg gag get gaa gat get gcc 1539 Thr Ser Tyr Ser Leu Thr Ile Ser Gly Met Glu Ala Glu Asp Ala Ala act tat tac tgc cag cag tgg agt agt aac cca ttc acg ttc ggc tcg 1587 Thr Tyr Tyr Cys Gln Gln Trp Ser Ser Asn Pro Phe Thr Phe Gly Ser ggg aca aag ttg gaa ata aac egg get gat act gca cca act gga tee 1635 Gly Thr Lys Leu Glu Ile Asn Arg Ala Asp Thr Ala Pro Thr Gly Ser gaa caa aag ctg ate tea gaa gaa gac eta aac tea cat cac cat cac 1683 Glu Gln Lys Leu Ile Ser Glu Glu Asp Leu Asn Ser His His His His cat cac taatctaga 1698 His His <210> 2 <211> 554 <212> PRT
<213> unknown <400> 2 Met Lys Tyr Leu Leu Pro Thr Ala Ala Ala Gly Leu Leu Leu Leu Ala Ala Gln Pro Ala Met Ala Gln Val Gln Leu Gln Gln Ser Gly Ala Glu Leu Ala Arg Pro Gly Ala Ser Val Lys Met Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Arg Tyr Thr Met His Trp Val Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile Gly Tyr Ile Asn Pro Ser Arg Gly Tyr Thr Asn Tyr Asn Gln Lys Phe Lys Asp Lys Ala Thr Leu Thr Thr Asp Lys Ser Ser Ser Thr Ala Tyr Met Gin Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys Ala Arg Tyr Tyr Asp Asp His Tyr Ser Leu Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val Ser Ser Ala Lys Thr Thr Pro Lys Leu Gly Gly Asp Ile Leu Leu Thr Gln Thr Pro Ala Ser Leu Ala Val Ser Leu Gly Gln Arg Ala Thr Ile Ser Cys Lys Ala Ser Gln Ser Val Asp Tyr Asp Gly Asp Ser Tyr Leu Asn Trp Tyr Gln Gln Ile Pro Gly Gln Pro Pro Lys Leu Leu Ile Tyr Asp Ala Ser Asn Leu Val Ser Gly Ile Pro Pro Arg ]?he Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Asn Ile His Pro Val Glu Lys Val Asp Ala Ala Thr Tyr His Cys Gln Gln Ser Thr Glu Asp Pro Trp Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg Ala Asp Ala Ala Ala Ala Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln Val Gln Leu Gln Gln Ser Gly Ala Glu Leu Val Arg Pro Gly Ser Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Ala Phe Ser Ser Tyr Trp Met Asn Trp Val Lys Gln Arg Pro Gly Gin Gly Leu Glu Trp Ile Gly Gln Ile Trp Pro Gly Asp Gly Asp Thr Asn Tyr Asn Gly Lys Phe Lys Gly Lys Ala Thr Leu Thr Ala Asp Glu Ser Ser Ser Thr Ala Tyr Met Gln Leu Ser Ser Leu Ala Ser Glu Asp Ser Ala Val Tyr Phe Cys Ala Arg Arg Glu Thr Thr Thr Val Gly Arg Tyr Tyr Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr Ser Val Thr Val Ser Ser Ala Lys Thr Thr Pro Lys Leu Gly Gly Asp Ile Val Leu Thr Gln Ser Pro Ala Ile Met Ser Ala Ser Pro Gly Glu Lys Val Thr Met Thr Cys Ser Ala Ser Ser 435 4:40 445 Ser Val Ser Tyr Met Asn Trp Tyr Gin Gln Lys Ser Gly Thr Ser Pro Lys Arg Trp Ile Tyr Asp Thr Ser Lys Leu Ala Ser Gly Val Pro Ala His Phe Arg Gly Ser Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Gly Met Glu Ala Glu Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Trp Ser Ser Asn Pro Phe Thr Phe Gly Ser Gly Thr Lys Leu Glu Ile Asn Arg Ala Asp Thr Ala Pro Thr Gly Ser Glu Gln Lys Leu Ile Ser Glu Glu Asp Leu Asn Ser His His His His His His <210> 3 <211> 1653 <212> DNA
<213> unknown <220>
<221> CDS

<222> (28)... (1644) <400> 3 gaattcatta aagaggagaa attaacc atg aaa tac cta ttg cct acg gca 51 Met Lys Tyr Leu Leu Pro Thr Ala gcc get ggc ttg ctg ctg ctg gca get cag ccg gcc atg gcg cag gtg 99 Ala Ala Gly Leu Leu Leu Leu Ala Ala Gln Prc Ala Met Ala Gln Val caa ctg cag cag tct ggg get gaa ctg gca aga cct ggg gcc tca gtg 147 Gln Leu Gln Gln Ser Gly Ala (3lu Leu Ala Arg Pro Gly Ala Ser Val aag atg tcc tgc aag get tct ggc tac acc ttt act agg tac acg atg 195 Lys Met Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Arg Tyr Thr Met cac tgg gta aaa cag agg cct gga cag ggt ctg gaa tgg att gga tac 243 His Trp Val Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile Gly Tyr att aat cct agc cgt ggt tat act aat tac aat cag aag ttc aag gac 291 Ile Asn Pro Ser Arg Gly Tyr Thr Asn Tyr Asn Gln Lys Phe Lys Asp aag gcc aca ttg act aca gac aaa tcc tcc agc aca gcc tac atg caa 339 Lys Ala Thr Leu Thr Thr Asp Lys Ser Ser Ser Thr Ala Tyr Met Gln ctg agc agc ctg aca tct gag crac tct gca gtc tat tac tgt gca aga 387 Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys Ala Arg tat tat gat gat cat tac agc ctt gac tac tgg ggc caa ggc acc act 435 Tyr Tyr Asp Asp His Tyr Ser Leu Asp Tyr Trp Gly Gln Gly Thr Thr ctc aca gtc tcc tca gcc aaa aca aca ccc aag ctt ggc ggt gat atc 483 Leu Thr Val Ser Ser Ala Lys Thr Thr Pro Lys Leu Gly Gly Asp Ile ttg ctc acc caa act cca get tct ttg get gtg tct cta ggg cag agg 531 Leu Leu Thr Gln Thr Pro Ala Ser Leu Ala Val Ser Leu Gly Gln Arg 155 1.60 165 gcc acc atc tcc tgc aag gcc agc caa agt gtt gat tat gat ggt gat 579 Ala Thr Ile Ser Cys Lys Ala Ser Gln Ser Val. Asp Tyr Asp Gly Asp agt tat ttg aac tgg tac caa crag att cca gga cag cca ccc aaa ctc 627 Ser Tyr Leu Asn Trp Tyr Gln Gin Ile Pro Gly Gln Pro Pro Lys Leu ctc atc tat gat gca tcc aat cta gtt tct ggg atc cca ccc agg ttt 675 Leu Ile Tyr Asp Ala Ser Asn I.eu Val Ser Gly Ile Pro Pro Arg Phe agt ggc agt ggg tct ggg aca gac ttc acc ctc aac atc cat cct gtg 723 Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Asn Ile His Pro Val gag aag gtg gat get gca acc tat cac tgt cag caa agt act gag gat 771 Glu Lys Val Asp Ala Ala Thr Tyr His Cys Gln Gln Ser Thr Glu Asp ccg tgg acg ttc ggt gga ggc acc aag ctg gaa atc aaa cgg get gat 819 Pro Trp Thr Phe Gly Gly Gly -hr Lys Leu Glu Ile Lys Arg Ala Asp get gcg gcc get ggt ggc cca ggg tcg cag gtg cag ctg cag cag tct 867 Ala Ala Ala Ala Gly Gly Pro Gly Ser Gln Val Gln Leu Gln Gln Ser ggg get gag ctg gtg agg cct ggg tcc tca gtg aag att tcc tgc aag 91.5 Gly Ala Glu Leu Val Arg Pro Gly Ser Ser Val Lys Ile Ser Cys Lys get tct ggc tat gca ttc agt agc tac tgg atg aac tgg gtg aag cag 963 Ala Ser Gly Tyr Ala Phe Ser Ser Tyr Trp Met Asn Trp Val Lys Gln agg cct gga cag ggt ctt gag tgg att gga cag att tgg cct gga gat 107.1 Arg Pro Gly Gln Gly Leu Glu Trp Ile Gly Gln Ile Trp Pro Gly Asp ggt gat act aac tac aat gga aag ttc aag ggt aaa gcc act ctg act 1059 Gly Asp Thr Asn Tyr Asn Gly Lys Phe Lys Gly Lys Ala Thr Leu Thr gca gac gaa tcc tcc agc aca gcc tac atg caa ctc agc agc cta gca 1107 Ala Asp Glu Ser Ser Ser Thr Ala Tyr Met Gln Leu Ser Ser Leu Ala tct gag gac tct gcg gtc tat t.tc tgt gca aga cgg gag act acg acg 1155 Ser Glu Asp Ser Ala Val Tyr Phe Cys Ala Arg Arg Glu Thr Thr Thr gta ggc cgt tat tac tat get atg gac tac tgg ggt caa gga acc tca 1203 Val Gly Arg Tyr. Tyr Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr Ser gtc acc gtc tcc tca gcc aaa aca aca ccc aaa ctt ggc ggt gat atc 1251 Val Thr Val Ser Ser Ala Lys Thr Thr Pro Lys Leu Gly Gly Asp Ile gtg ctc act cag tct cca gca atc atg tct gca tct cca ggg gag aag 1299 Val Leu Thr Gln Ser Pro Ala Isle Met Ser Ala Ser Pro Gly Glu Lys gtc acc atg acc tgc agt gcc agc tca agt gta agt tac atg aac tgg 1347 Val Thr Met Thr Cys Ser Ala =per Ser Ser Val. Ser Tyr Met Asn Trp tac cag cag aag tca ggc acc tcc ccc aaa aga tgg att tat gac aca 1395 Tyr Gln Gln Lys Ser Gly Thr Ser Pro Lys Arg Trp Ile Tyr Asp Thr tcc aaa ctg get tct gga gtc cct get cac ttc agg ggc agt ggg tct 1443 Ser Lys Leu Ala Ser Gly Val Pro Ala His Phe Arg Gly Ser Gly Ser ggg acc tct tac tct ctc aca etc agc ggc atg gag get gaa gat get 1491 Gly Thr Ser Tyr Ser Leu Thr Ile Ser Gly Met Glu Ala Glu Asp Ala gcc act tat tac tgc cag cag tag agt agt aac cca ttc acg ttc ggc 1539 Ala Thr Tyr Tyr Cys Gln Gln Trp Ser Ser Asn Pro Phe Thr Phe Gly tcg ggg aca aag ttg gaa ate aac cgg get gat act gca cca act gga 1587 Ser Gly Thr Lys Leu Glu Ile Asn Arg Ala Asp Thr Ala Pro Thr Gly tcc gaa caa aag ctg etc tca gaa gaa gac cta aac tca cat cac cat 1635 Ser Glu Gln Lys Leu Ile Ser Glu Glu Asp Leu Asn Ser His His His cac cat cac taatctaga 1653 His His His <210> 4 <211> 539 <212> PRT
<213> unknown <400> 4 Met Lys Tyr Leu Leu Pro Thr Ala Ala Ala Gly Leu Leu Leu Leu Ala Ala Gln Pro Ala Met Ala Gin Val Gln Leu Gln Gln Ser Gly Ala Glu Leu Ala Arg Pro Gly Ala Ser Val Lys Met Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Arg Tyr Thr Met His Trp Val Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile Gly Tyr Ile Asn Pro Ser Arg Gly Tyr Thr Asn Tyr Asn Gln Lys Phe Lys Asp Lys Ala Thr Leu Thr Thr Asp Lys Ser Ser Ser Thr Ala Tyr Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys Ala Axg Tyr Tyr Asp Asp His Tyr Ser Leu Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val Ser Ser Ala Lys Thr Thr Pro Lys Leu Gly Gly Asp Ile Leu Leu Thr Gln Thr Pro Ala Ser Leu Ala Val Ser Leu Gly Gln Arg Ala Thr Ile Ser Cys Lys Ala Ser Gln Ser Val Asp Tyr Asp Gly Asp Ser Tyr Leu Asn Trp Tyr Gln Gln Ile Pro Gly Gln Pro Pro Lys Leu Leu Ile Tyr Asp Ala Ser Asn Leu Val Ser Gly Ile Pro Pro Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Asn Ile His Pro Val Glu Lys Val Asp Ala Ala Thr Tyr His Cys Gln Gln Ser Thr Glu Asp Pro Trp Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg Ala Asp Ala Ala Ala Ala Gly Gly Pro Gly Ser Gln Val Gln Leu Gin Gln Ser Gly Ala Glu Leu Val Arg Pro Gly Ser Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Ala Phe Ser Ser Tyr Trp Met Asn Trp Val Lys Gin Arg Pro Gly Gln Gly Leu Glu Trp Ile Gly Gln Ile Trp Pro Gly Asp Gly Asp Thr Asn Tyr Asn Gly Lys Phe Lys Gly Lys Ala Thr Leu Thr Ala Asp Glu Ser Ser Ser Thr Ala Tyr Met Gln Leu Ser Ser Leu Ala Ser Glu Asp Ser Ala Val Tyr Phe Cys Ala Arg Arg Glu Thr Thr Thr Val Gly Arg Tyr Tyr Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr Ser Val Thr Val Ser Ser Ala Lys Thr Thr Pro Lys Leu Gly Gly Asp Ile Val Leu Thr Gln Ser Pro Ala Ile Met Ser Ala Ser Pro Gly Glu Lys Val Thr Met Thr Cys Ser Ala Ser Ser Ser Val Ser Tyr Met Asn Trp Tyr Gln Gln Lys Ser Gly Thr Ser Pro Lys Arg Trp Ile Tyr Asp Thr Ser Lys Leu Ala Ser Gly Val Pro Ala His Phe Arg Gly Ser Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Gly Met Glu Ala Glu Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Trp Ser Ser Asn Pro Phe Thr Phe Gly Ser Gly Thr Lys Leu Glu Ile Asn Arg Ala Asp Thr Ala Pro Thr Gly Ser Glu Gin Lys Leu Ile Ser Glu Glu Asp Leu Asn Ser His His His His His His <210> 5 <211> 57 <212> DNA
<213> artificial sequence <220>
<223> description of artificial sequence: Primer <400> 5 tatatactgc agctgcacct gcgaccctgg gccaccagcg gccgcagcat cagcccg 57 <210> 6 <211> 45 <212> DNA
<213> artificial sequence <220>
<223> description of artificial sequence: Primer <400> 6 ccgtgaattc caggtgcaac tgcagcagtc tggggctgaa ctggc 4:5 <210> 7 <211> 34 <212> DNA
<213> artificial sequence <220>
<223> description of artificial sequence: Primer <400> 7 ggtcgacgtt aaccgacaaa caacagataa aacg 34 <210> 8 <211> 348 <212> DNA
<213> unknown <220>
<221> CDS
<222> (1)...(348) <400> 8 atg aga ttt cct tca att ttt act get gtt tta ttc gca gca tcc tcc 48 Met Arg Phe Pro Ser Ile Phe Thr Ala Val Leu Phe Ala Ala Ser Ser gca tta get get cca gtc aac act aca aca gaa gat gaa acg gca caa 96 Ala Leu Ala Ala Pro Val Asn Thr Thr Thr Glu Asp Glu Thr Ala Gln att ccg get gaa get gtc atc ggt tac tca gat tta gaa ggg gat ttc 144 Ile Pro Ala Glu Ala Val Ile Gly Tyr Ser Asp Leu Glu Gly Asp Phe gat gtt get gtt ttg cca ttt t.cc aac agc aca aat aac ggg tta ttg 192 Asp Val Ala Val Leu Pro Phe Ser Asn Ser Thr Asn Asn Gly Leu Leu ttt ata aat act act att gcc agc att get get aaa gas gaa ggg gta 240 Phe Ile Asn Thr Thr Ile Ala Ser Ile Ala Ala Lys Glu Glu Gly Val tct ctc gag aaa aga gag get ca.a get gaa ttc cag gtg caa ctg cag 288 Ser Leu Glu Lys Arg Glu Ala G1u Ala Glu Phe Gln Val Gln Leu Gln cag tct ggg get gaa ctg gca aga cct ggg gcc tca gtg aag atg tcc 336 Gln Ser Gly Ala Glu Leu Ala Arg Pro Gly Ala Ser Val Lys Met Ser tgc aag get tct 348 Cys Lys Ala Ser <210> 9 <211> 116 <212> PRT
<213> unknown <400> 9 Met Arg Phe Pro Ser Ile Phe Thr Ala Val Leu Phe Ala Ala Ser Ser Ala Leu Ala Ala Pro Val Asn Thr Thr Thr Glu Asp Glu Thr Ala Gln Ile Pro Ala Glu Ala Val Ile Gly Tyr Ser Asp Leu Glu Gly Asp Phe Asp Val Ala Val Leu Pro Phe Ser Asn Ser Thr Asn Asn Gly Leu Leu Phe Ile Asn Thr Thr Ile Ala Ser Ile Ala Ala Lys Glu Glu Gly Val Ser Leu Glu Lys Arg Glu Ala Glu Ala Glu Phe Gln Val Gln Leu Gln Gln Ser Gly Ala Glu Leu Ala Arg Pro Gly Ala Ser Val Lys Met Ser Cys Lys Ala Ser <210> 10 <211> 354 <212> DNA
<213> unknown <220>
<221> CDS
<222> (1)...(354) <400> 10 atg aga ttt cct tca att ttt act get gtt tta ttc gca gca tcc tcc 48 Met Arg Phe Pro Ser Ile Phe Thr Ala Val Leu Phe Ala Ala Ser Ser gca tta get get cca gtc aac act aca aca gaa gat gaa acg gca caa 96 Ala Leu Ala Ala Pro Val Asn Thr Thr Thr Glu Asp Glu Thr Ala Gln att ccg get gaa get gtc atc: agt tac tca gat tta gaa ggg gat ttc 144 Ile Pro Ala Glu Ala Val Ile Gly Tyr Ser Asp Leu Glu Gly Asp Phe gat gtt get gtt ttg cca ttt t.cc aac agc aca aat aac ggg tta ttg 192 Asp Val Ala Val Leu Pro Phe Ser Asn Ser Thr Asn Asn Gly Leu Leu ttt ata aat act act att gcc agc att get get aaa gaa gaa ggg gta 240 Phe Ile Asn Thr Thr Ile Ala Ser Ile Ala Ala Lys Glu Glu Gly Val tct ctc gag aaa aga gag get cfa.a get gaa ttc atg gcg cag gtg caa 288 Ser Leu Glu Lys Arg Glu Ala Glu Ala Glu Phe Met Ala Gln Val Gln ctg cag cag tct ggg get gaa ct.g gca aga cct ggg gcc tca gtg aag 336 Leu Gln Gln Ser Gly Ala Glu Leu Ala Arg Pro Gly Ala Ser Val Lys atg tcc tgc aag get tct 354 Met Ser Cys Lys Ala Ser <210> 11 <211> 118 <212> PRT
<213> unknown <400> 11 Met Arg Phe Pro Ser Ile Phe 7hr Ala Val Leu Phe Ala Ala Ser Ser Ala Leu Ala Ala Pro Val Asn Thr Thr Thr Glu Asp Glu Thr Ala Gln Ile Pro Ala Glu Ala Val Ile Gly Tyr Ser Asp Leu Glu Gly Asp Phe Asp Val Ala Val Leu Pro Phe Ser Asn Ser Thr Asn Asn Gly Leu Leu Phe Ile Asn Thr Thr Ile Ala Ser Ile Ala Ala Lys Glu Glu Gly Val Ser Leu Glu Lys Arg Glu Ala Clu Ala Glu Phe Met Ala Gln Val Gln Leu Gln Gln Ser Gly Ala Glu Leu Ala Arg Pro Gly Ala Ser Val Lys Met Ser Cys Lys Ala Ser <210> 12 <211> 42 <212> DNA
<213> artificial sequence <220>
<223> description of artificial sequence: Primer <400> 12 tcacacagaa ttcttagatc tattaaagag gagaaattaa cc 42 <210> 13 <211> 40 <212> DNA
<213> artificial sequence <220>
<223> description of artificial sequence: Primer <400> 13 agcacacgat atcaccgcca agcttgggtg ttgttttggc 40 <210> 14 <211> 43 <212> DNA
<213> artificial sequence <220>
<223> description of artificial sequence: Primer <400> 14 agcacacaag cttggcggtg atatctt:gct cacccaaact cca 43 <210> 15 <211> 57 <212> DNA
<213> artificial sequence <220>
<223> description of artificial sequence: Primer <400> 15 agcacactct agagacacac agatctl:tag tgatggtgat ggtgatgtga gtttagg 57 <210> 16 <211> 33 <212> DNA
<213> artificial sequence <220>
<223> description of artificial sequence: Primer <400> 16 cagccggcca tggcgcaggt gcaactcrcag cag 33 <210> 17 <211> 102 <212> DNA
<213> artificial sequence <220>
<223> description of artificial sequence: Primer <400> 17 tatatactgc agctgcacct ggctacca.cc accaccggag ccgccaccac cgctaccacc 60 gccgccagaa ccaccaccac cagcggccgc agcatcagcc cg 102

Claims

CLAIMS:

1. A Fv antibody construct comprising a single-chain monomer with four variable domains, wherein the four variable domains are two VL and two VH domains, said variable domains are linked one after another via a peptide linker 1, a middle peptide linker 2 and a peptide linker 3 in a single chain, wherein the peptide linkers 1 and 3 are a peptide bond or consist of 1 to 10 amino acids, peptide linker 2 consists of up to 10 amino acids;
and the monomer folds with another identical second single-chain monomer to a tetravalent F v antibody construct comprising four antigen binding sites, each being formed from a V L, domain of a monomer and a V H domain of the other monomer.

2. The F V antibody construct according to claim 1, wherein the peptide linkers 1 and 3 comprise the amino acid sequence GG.

3. F V antibody construct according to claim 1, wherein the F V antibody construct is bispecific.

4. The F V antibody construct according to claims 1 or 2, wherein the F V antibody construct is monospecific.

5. A method of producing the bivalent or tetravalent F V
antibody construct according to any one of claims 1 to 4, wherein DNAs coding for the peptide linkers 1, 2 and 3 are ligated with DNAs coding for the four variable domains of an F V antibody construct such that the peptide linkers link the variable domains one after another and the resulting DNA molecule is inserted in an expression plasmid, thereafter transfecting a host cell with the expression plasmid and expressing the F V antibody.

6. Expression plasmid coding for the multivalent F V
antibody construct according to any one of claims 1 to 4.

7. The expression plasmid according to claim 6, wherein the plasmid is pDISC3x19-SL as deposited under DSM 12149 with the DSM.

8. The expression plasmid according to claim 6, wherein the plasmid is pPIC-DISC-SL as deposited under DSM 12151 with the DSM.

9. The expression plasmid according to claim 6, namely pDISC6-SL according to Fig. 10.

10. Use of the multivalent F V antibody construct according to any one of claims 1 to 4 for the diagnosis and/or treatment of diseases.

11. Use according to claim 10, wherein the diseases are viral, bacterial or tumoral diseases.