CA2092317A1 - Purified thermostable nucleic acid polymerase enzyme from thermosipho africanus - Google Patents

Abstract

A purified thermostable enzyme is derived from the eubacterium Thermosipho africanus. The enzyme has DNA polymerase activity, reverse transcriptase activity, and optionally 5' $m(8) 3', and/or 3' $m(8) 5' exonuclease activity. The enzyme can be native or recombinant, and may be used with primers and nucleoside triphosphates in a temperature-cycling chain reaction where at least one nucleic acid sequence is amplified in quantity from an existing sequence.

Description

uo 9~0620~ 2 a 9 2 3 :L 7 Pcr/~s9l/0707~
, .
PURIFIED THERMOSTABLE NUCLEIC ACID POLYMERASE
ENZYME FROM ~Bk~e~E~
Field of ~he Inven~Qn The present invention relates to a purified, thermostable DNA polyrnerase S purified from the tnermophilic bacteria Thermosi~ho 3f~n~ CEO and means for isolating and producing the enzyme. Therrnostable DNA polyrnerases are useful inrnany recombinant DNA techniques. especially nucleic acid amplification by the ~;
polymerase chain reaction (PCR).
~açk~rQund Art Extensive research has been conducted on the isola~ion of DNA polymerases frorn mesophilic microorganisms such as E. ~. See, for example, Bessman et al., 1957, J. Biol. Chem. 223:171-177, and Buttin and Kornberg, 1966, 1. Biol. Chem.
241 :5419-5427.
Much less investigatinn has been rnade on the isolation and purificalion of DNA `
po;~merases from thermophiLes such as Taf. Kaledin et al., 1980, Biokhvmiva 45:644-651, disclose a six-step isolation and purification procedllre of DNA polymerase from cells of Thermus ~a~E YT-1 sbain. These steps involve isolation of crude extract, DEAE-cellulose chr~matography, fracdonation on hydroxyapadte, fractionation on DEAE-cellulose, and chromatography on single-strand DNA-cellulose. The molecularweight of the pur;fied enzyme is reported as 62,000 daltons per monomeric unit. ~'~
A second purification scheme for a polyrnerase from O aquaticus is described by Chien et aL, 1976, 1. Bacteriol. 127:1550-1557. In this process, the crude extract is applied to a DEAE-Sephadex column. The dialyzed pooled fractions are then subjeeted to treatn1ent on a phosphocellulose column. The pooled frac~ons are dialyzed and bovine serum albumin (BSA) is added to prevent loss of polymerase ;;
~ .~vity. The ~esulting mixD is loaded on a DNA-cellulos olurnn. The pooled rnatenal from the column is dialyzed and analyzed bv gel fil~ation to haYe a molecular weight of a~out 63,000 daltorls and by sucrose gradient centrifugation of about 68,000 daltons. ~ -The use of thermostable enzymes, such as those descnbed in U.S. Patent No.
4,889,818, to amplify existing nucleic acid sequences in amounts that are large compared to the arnount initially present was described United States Pa~ent Nos.
4,683,195 and 4,683,202, which describe the PCR process, both disclosures of which are incorporated herein by reference. Primers, template, nucleoside triphosphates, the appropriate buffer and reac~on condi~ons, and polymerase are used in the PCR

: . . . - ........, . ..................................... :
-- , . . . ; .

: ~

.

WO 9Z/0620~ PCI/l,'S91/0707h

2~9~3~ 2 process, which involves denaturation of target DNA7 hybndization of primers, andsynthesis of complemen~ary strands. The exterlsion product of each primer becomes a template for the production of the desired nucleic acid sequence. The two paten~s disclose that, if the polymerase employed is a thermostable enzyme, then polymerase S need not be added after every denaturation step, because heat will not destroy the polymerase activity.
United States Patent No. 4,889,818, European Patent Publication No.
258,017, and PCI Publication No. 89/06691, the disclosures of which are incorporated herein by reference, all describe the isolation and recombinant expression 10 of an ~94 kDa thermostable DNA polymerase from Thermus ~guaticus and t'ne use of that polymerase in PCR. Although T. ~a~ DNA polymerase is especially preferred for use in P~R and other recombinant DNA techniques, there remains a need for other tnermostable polymerases.
Accordingly, there is a desire in the art to produce a pulified, thermostable DNA
15 polyrnerase that may be used to improve the PCR process described above and to irnprove the results obtained when using a thermostable DNA polymerase in other recombinant techniques such as DNA sequencing, nick-translation, and even reverse transcription. The present invention helps meet dlat need by providing recombinant expression vectors and purification protocols for a DNA polyrnerase from Taf. ~ -20 ~u~rlarvof~lnven~ion Accordingly, the present invention provides a purified thermostable enzyme that catalyzes combination of nucleoside triphosphates to forrn a nucleic acid strandcomplementary to a nucleic acid template s~and. 'rhe purified enzyme is the DNA
polymerase I activity from Taf. In a pre~e~ed embodiment, the enzyme is isolated from 25 Taf strain OB-7 (DSM 5309). This purified material may be used in a temperature-cycling amplification reaction wherein nucleic acid sequences are produced from a given nucleic acid sequence in amounts that are large compared to the arnount initially present so that the sequences can be manipulated and/or analyzed easily.
The gene encoding Taf DNA polyrnerase I enzyme from Taf has also been 30 identified and cloned and provides yet another means to prepare the therrnostable enzyme of the present invention. In addition to the portions of the gene encoding the E~ enzyrne, derivatives of these gene p~rtions encoding Taf DNA polymerdse I activity are also provided.
The invention also encompasses a stable enz3rme composition comprising a 35 purified, therrnostable Taf enzyme as described above in a buffer containing one or more non-ionic polymeric detergents. ~ ~-;:

.. . . ....... . .

: . , . : . , .

',', . ~: ' WO 92/06~û~ 2 ~ 3 ~ 3 1 7 ~Cr/US91/07076 Finally, the invention pr~vides a method of purification for the thermostable polymerase of the invention. This method involves preparing a crude extract from Taf or recombinant host cells, adjus~ing the ionic strength of the crude ex~ract so that tne DNA polymerase dissociates from nucleic acid in the extract, subjecting the extract to at least one chromatographic step selected from hydrophobic interaction chromalography, DNA binding protein affinity chromatography, nucleotide binding protein ~ffinitychromatography, and cation, anion, OF hydroxyapatite chromatography. In a preferred embodiment, these steps are performed sequentially in the order ~iven above. Thenucleotide binding prosein affinity chromato~aphy step is prefe~ed for separating the DNA polymerase from endonuclease proteins.
r ef Descri~ticn of the Fi~lres Figure 1 shows various PCR profiles.
Figure 2 shows the effect of various PCR profiles on amplification.
Figure 3 shows various PCE2 profiles.
12~iLed Desc~ion o~he Inven~Qn The present invention provides DNA sequences and expression vectors ~hat encode Taf DNA polymerase I. To facilitate understanding of the invention, a number of terms are defined below. ~ --The terms "cell", "cell line", and "cell culnlre" can be used interchangeably and all such designations include progeny. Thus, the words "transformants" or ~ -"~sfc~ned cells" include the prima~y transfolmed cell and cultures denved from that cell without regard to the number of ~nsfers. All progeny may not be precisely identical in DNA content, due to deliberate or inadvertent muta~ions. Mutant progeny that have the same functionality as screened for in the originally transformed cell are 2S included in the definition of transfolmants.
The te~m "control sequences" refers to I)NA sequences necessary for the expression of an operably linked coding sequence in a particular host organism. The control sequences that are suitable for procaryotes, for example, include a promoter, opdonally an operator sequence, a ribosome binding site, and possibly other sequencas. Eucaryotic cells are known to utilize promoters, polyadenyladon signals, and enhancers.
The term "expression system" refers to DNA sequences containing a desired - coding sequence and control sequences in operable linkage, so ~hat hosts transfo~
with these sequences are capable of producing the encoded proteins. To effect - ~

~o 9~/0620~ Pcr/~s9l/07~)76 209~3~ 4 transfo~nation, the expression sys~em may be included on a vector; however, the relevant DNA may also be integrated into the host chromosome.
The telm "gene" refers tO a DNA sequence that comprises control and coding sequences necessary for the production of a recoverable bioactive polypeptide or5 precursor. The polypeptide can be encoded by a full length gene sequence or by any portion of the coding sequence so long as the enzyrnatic ac~ivity is re~ined.
The term "operably linked" refers to the positioning of the coding sequence such that control sequences will function to drive expression of the protein encoded by the coding sequence. Thus, a coding sequence "operably linked" to control sequences 10 refers to a configuration wherein the coding sequences can be expressed under the direction of a control sequence.
The terrn "mixture" as ie relates to rnixtures containing Taf polymerase refers to a collection of rnaterials which includes Taf polymerase but which can also include other proteins. If the Taf polymesase is derived from recombinant host cells, the other 15 proteins will ordinarily be ~hose associated with the host. Where the host is bacterial, the contarninating proteins will, of course, be bacterial proteins.
The terrn "non-ionic polymeric detergents" refers to surface-active agents that have no ionic charge and that are characterized for purposes of this invention, by an ability to stabilize the Ta enzyme at a pH range of from about 3.5 to about 9.5,20 preferably from 4 tO ~.5.
The term "oligonucleotide" as used herein is defined as a molecule comprised of t~vo or more deoxyribonucleotides or ribonucleotides, preferably more than three, and usually more than ten. The exact size will depe~ld on many factors, which in turn depends on the ultimate function or use of the oligonucleotide. The oligonucleotide ~;
25 may be derived synthetically or by cloning.
The terrn "primer" as used herein refers to an oligonucleotide which is capable ~ ,~
of acting as a point of initiation of synthesis when placed under condinons in which pnmer extension is initiated. An oligonucleotide "primer" may occur naturally, as in a purified restriction digest or be produced synd~etically. Synthesis of a primer extension ~ -30 product which is complementary to a nucleic acid strand is initiated in the presence of ~ ~-four different nucleoside triphosphates and the Taf ~nostable enzyme in an approp~iate buffer at a suitable temperature. A "buffer" includes cofactors (such as divalent metal ions) and salt (to provide the appropriate ionic strength), adjusted to the desired pH For Taf polymerase, the buffer preferably con~uns 1 to 3 mM of a 35 magnesium salt, preferably MgCl2, 50 to 200 ~,IM of each nucleotide, and 0.2 to 1 of each plimer, along with 50 mM RCI, 10 mM Tris buffer (pH 8.0-8.4), and 100 ' "`' : ,, : :
: , ., , :
.:.. .
"

wo g~/06~0' 2 ~ 9 2 31 7 PCI/l_'S91/07076 ~g/ml gelatin (al~hou~h gelatin is not requi~l, and should be avoided in some applications, such as DNA sequencing).
A primer is single-stranded for m~ximum efficiency in arnpliIScation, but may alternatively be double-stranded. If double-stranded, the primer is first treated to S separate its strands before being used to prep re extension products. The primer is usually an oligodeoxyribonucleotide. The prirner must be sufficiently long to prime the synthesis of extension prodncts in the presence of the polymerase enzyme The exact length of a primer will depend on many factors, such as source of primer and result desired, and the reac~on temperature must be adjusted depending on primer length and 10 nucleotide sequence to ensure proper anneai~ng of pr rner to template. Depending on the complexity of the target sequence, an oligonucleotide primer typically contains 15 to 35 nucleotides. Short primer molecules generally require lower temperatures to ~orm sufficiently stable complexes with template.
A prirner is selected to be "substandally" complementa~ to a strand of specific 15 sequenee of the template. A p~irner must be sufficiently complementary to hybridize with a template strand for primer elongation to occur. A p~.~rner sequenS~e need not reflect ~e exact sequence of the template. For exa.nple, a non-complemen~ry nucleotide fragment may be attached to the 5' end of the primer, with the remainder of the pr~ner sequence being substantially complement~ry to the strand. Non-20 complemen~y bases or longer sequences can be interspersed into the primer, provir.' ;-d tha~ ~e p~imer sequence has sufficient complelrnentarity with the sequence of the template to hybridize and thereby fo~m a temp;late primer complex fcr synthesis of the extension pr~duct of the primer.
T~e terms "restriction endonucleases" ~d "restIiction enzyrnes" refer to 25 bacterial enz~nnes which cut double-stranded ONA at or near a specific nucleotide sequence.
The terms "thennostable polymerase" and "the~rmostable enzyme" ~ef r to an enzyme which is stable to heat and is heat resistant and catalyzes (facilitate~`combination of d~e nucleotides in the p~oper manner to fo~n primer extension products 30 that are complemen~y to a template nucleic acid st~nd. Gene~ally, synthesis of a primer extension product begins at dle 3' end of the primer and proceeds in the 5' direction along the template strand, until synthesis terminates. ~ ~ .
The T~f thermostable enzyrne of the present invention satisfies the requirements~or e~ective use in the amplification reaction known as the pol~nerase chain reaction or 35 PCR. The ~ enzyme does not become irreversibly denatured (inactivated) when subjected to the elevated temperatures for the tirne necessary to effect denaturation of double-stranded nucleic acids, a key step in the PCR process. Irreversible denaturation :

..... . .

., ,, WO 9~/0620' PC~/US91/07076 ~a9~3~ 6 for pl~rposf~s herein refers to permanent and complete loss of enzymatic activity. The heating conditions necessary for nucleic acid denaturation will depend, e.g., on the buffer salt concentration and the composition and length of the nucleic acids being denatured, but typically range from about 90C to about lOS"C for a time depending S mainly on the temperature and the nucleic acid length, typically from a few seconds up to four minutes. Higher temperatures may be required as the buffer salt concentration andlor GC compcsition of the nucleic acid is inc~eased. The Taf enzyme does not become irre~ersibly denatured for relatively short exposures to temperatures of abou~
90C-1~0C.
10The Taf thermostable enzyme has an optimum temperature at which it functions that is higher than about 45C. TempeIatures below 45C facilitate hyb~idization of primer to template, but depending on salt composition and concentration and primer composition and length, hybridization of prirner to template can occur at higher~emperatures (e.g., 45-70C), which may promote specificity of the primer 15 hybridization reaction. The Taf enzyme exhibits activity over a broad temperature range from about 37C to 90C.
The present invention provides DNA sequences encoding the thermostable DNA polymerase I activity of Taf. The encoded amino acid sequence has homology to portions of she thermostable DNA polyrnerases of Therrnus species Z0~ ( IZ05), 20 Thelmotoea maritima C~). Th~mus aqua~c~ ~) stIain YTl, T. thennophilus (:~h). and Thermus species sps17 ~sps17). The entire Taf coding sequence and thededuced amino acid se~quence is depicted below as ~EQ ID NO: 1. The amino acid sequences is also listed as SEQ ID NO: 2. For convenience, the amino acid sequence of this Taf polymerase is numbered for referenc e. Portions of the 5' and 3' noncoding 25 ~egions of the Taf DNA polymerase I gene are also shown.
1 GAATTCTTGAAGAAGGGACTTTAAATACTAAGAGGTTTTTTAACT ;~
46 TAGATGGAAATGTTTACAAAAAGGGTGCATTAGATGAGAAAACAA .
9l AGGAATTAATGGGACTTGTTGCTTCAATGGTTTTA~GGTGTGATG
l36 ATTGTATTACTTATCATATGAT~AGGTGTGCACAACTTGGAGTTA :~
30l8l GTGATGAAGAATTTTTTGAAACTTTTGATGTGGCATTGATAGTTG ~:

- 27l TTGAGGATATCAGGGAGATGCAA~AAAATGGGAAAGATGTTTCTA
l MetGlyLysMetPheLeu :
3l6 TTTGATGGAACTGGATTAGTATACAGAGCATTTTATGCTATAGAT :-~
7 PheAspGlyThrGlyLeuValTyrArgAlaPheTyrAlaIleAsp . .

... , . : ~ . . . . . :. .. : .. .. . .. . : .:: , . : . ,: - :: . .-. ; . , ;,:, '. ' ' ' . . .
.:. : . .,: . . , :; , , : .

WO~/06202 2 ~ 9 2 317 PCT/US~1/07n76

3'1 CAATCTCTTCAAACTTCGTCTGGTTTACACACTAATGCTGTATAC
_2 GlnSerLeuGlnThrSerSerGlyLeuHisThrAsnAlaValTyr 406 GGACTTACTAAAATGCTTATAAAATTTTTAAAAG~. -ATATCAGT
3? ~lyLcu~ Ti~MetLcuIlcLysPhc~euLysGl ..isIleSer 52 IleGlyLysAspAlaCysValPheValLeuAspSerLysGlyGly 49~ AGCAAAA~GAAAGGATATTCTTGAAACATATAAAGCAAATAGG
67 SerLysLysArgLysAspIleLe `luThrTyrLysAlaAsnArg 82 ProSerThrProAspLeuLeuLeuGluGlnIleProTyrValGlu 586 GAACTTGTTGATGCTCTTGGAATAAAAGTTTTAAA~ATAGAAGGC
97 GluLeuValAspAlaLeuGlyIleLysValLeuLysIleGluGly 112 PheGluAlaAspAspIleIleAlaThrLeuSerLysLysPheGlu 127 SerAspPh-~GluLysValAsnIleIleThrGlyAspLysAspLeu 142 LeuGlnLeuValSerAspLysValPheValTrpArgValGluArg 157 GlyIleThrAspLeuValLeuTyrA~pArgAsnLysValIleGlu 811 AAATATGGAATCTACCCAGAACAATrrCAAAGATTATTTATCTCTT
172 LysTyrGlyIleTyrProGluGlnPheLysAspTyrLeuSerLeu 187 ValGlyAspGlnIleAspAsnIleProGlyValLysGlyIleGly 901 AAGAAAACAGCTGTTTCGCTTTTGAAA~AATATAATAGCTTGGAA
202 LysLysThrAlaValSerLeuLeuLysLysTyrAsnSerLeuGlu 946 AATGTATTAAAAAATATTAACCTrLTTGACGGAAAAATTAAGAAGG
217 AsnValLeuLysAsnIleAsnLeuLeuThrGluLysLeuArgArg :
, . .
.: .
.;,. , : : :

- ~, : ' .,, ' ~ . .

~VO9?./0620~ PCT/US9l/07076 23 ~ 8 232 LeuLeuGluAspSerLysGluAspLeuGlnLysSerIleGluLeu ~ / 'v~dlGiuLeulleTyrAspValProMetAspValGiuLysAsp-,lu 262 IleIleTyrArgGlyTyrAsnProAspLysLeuLeuLysValLeu 277 LysLysTyrGluPheSerSerIleIleLysGluLeuAsnLeuGln 292 GluLysLeuGluLysGluTyrIleLeuValAspAsnGluAspLys 307 LeuLysLysLeuAlaGluGluIleGluLysTyrLysThrPheSer 322 IleAspThrGluThrThrSerLeuAspProPheGluAlaLysLeu 337 ValGlyIleSerIleSerThrMetGluGlyLysAlaTyrTyrIle 352 ProValSerHisPheGlyAlaLysAsnIleSerLysSerLeuIle 367 AspLysPheLeuLysGlnIleLeuGlnGluLysAspTyrAsnIle 382 ValGlyGlnAsnLeuLysPheAspTyrGluIlePheLysSerMet 397 GlyPheSerProAsnValProHisPheAspThrMetIleAlaAla 412 TyrLeuLeuAsnProAspGluLysArgPheAsnLeuGluGluLeu 1576 TCCTTAAAATATTTAGGTTATAA~ATGATCTCGTTTGATGAATTA
427 SerLeuLysTyrLeuGlyTyrLysMetIleSerPheAspGluLeu 1621 GTAAATGAA~ATGTACCATTGTTTGGA~TGACTTTTCGTATGTT
442 ValAsnGluAsnValProLeuPheGlyAsnAspPheSerTyrVal 457 ProLeuGluArgAlaValGluTyrSerCysGluAspAlaAspVal 472 ThrTyrArgIlePheArgLysLeuGlyArgLysIleTyrGluAsn 487 GluMetGluLysLeuPheTyrGluIleGluMetProLeuIleAsp , , . - ~ , ,:., . , , "" ......................... '''. ,', : ', . .

W~9~/06~0~ 2 3 ~ ~' 3 1 7 PCTt~'S91/07076 502 ValLeuSerGluMetGluLeuAsnGlyValTyrPheAspGluGlu 1846 TATTTAAAAGAATTATCAAAAAAATATCAAGA.~AAAATGGATGGA
517 TyrLeuLysGluLe~SerLy~Ly~lyrGi~lGiuLy~MetAsp~iy 1891 ATTAAC .~AAAAGTTTTTGAGATAGCTGGTGAAACTTTCAATTTA
532 IleLysGluLysValPheGluIleAlaGlyGluThrPheAsnLeu 547 AsnSerSerThrGLnValAlaTyrIleLeuPheGluLysLeuAsn 1981 ATTGCTCCTTACAAAAAA~CAGCGACTGGTAAGTTTTCAACTAAT
562 IleAlaProTyrLysLysThrAlaThrGlyLysPheSerThrAsn 577 AlaGluValLeuGluGluLeuSerLysGluHisGluIleAlaLys 592 LeuLeuLeuGluTyrArgLysTyrGlnLysLeuLysSerThrTyr 607 IleAspSerIleProLeuSerIleAsnArgLysThrAsnArgVal 622 HisThrThrPheHisGlnThrGlyThrSerThrGlyArgLeuSer 2206 AGTTCAAATCCA~ATTTGCAAAATCTTCCAACAAGAAGCGAAGAA
637 SerSerAsnProAsnLeuGlnAsnLeuProThrArgSerGluGlu 652 GlyLysGluIleArgLysAlaValA3.gProGlnArgGlnAspTrp 667 TrpIleLeuGlyAlaAspTyrSerG:LnIleGluLeuArgValLeu 2341 GCGC,ATGTAAGTAAAGATGAAAATCTACTTA~AGCATTTAAAGAA
682 AlaHisValSerLysAspGluAsnLeuLeuLysAlaPheLysGlu 697 AspLeuAspIleHisThrIleThrAlaAlaLysIlePheGlyVal 712 SerGluMetPheValSerGluGlnMetArgArgValGlyLysMet 727 ValAsnPheAlaIleIleTyrGlyValSerProTyrGlyLeuSer 742 LysArgIleGlyLeuSerValSerGluThrLysLysIleIleAsp 2566 AACTATTTTAGATACTATAAAGGAGTTTTTGAATATTTA~A~AGG
757 AsnTyrPheArgTyrTyrLysGlyValPheGluTyrLeuLysArg ,...:: , . .: ~ . : . - . ., .: - , . ~ .

., . . : : : :: . : . :::~

.

W09 /0620~ PCT/~!59l/07076 ~, 0 9 ~ o 2611 ATGAAAGATGAAGCAAGGAAAAAAGGTTATGTTAC.~ACGCTTTTT
772 MetLysAspGluAlaArgLysLysGlyTyrValThrThrLeuPhe 2656 GGAAGGCGCAGATATATTCCACAGTTAAGATCGAA~AATGGTAAT
787 GliArgAryA.g.y~ Il2~GGl..1euAr~SerLysA~nGlyAsn 802 ArgValGlnGluGlyGluArgIleAlaValAsnThrProIleGln 27~6 GGAACAGCAGCTGATATAATAAAGATAGCTATGATTAATATTCAT
817 GlyThrAlaAlaAspIleIleLysIleAlaMe~IleAsnIleHis 832 AsnArgLeuLysLysGluAsnLeuArgSerLysMetIleLeuGln 847 ValHisAspGluLeuValPheGluValProAspAsnGluLeuGlu 862 IleValLysA~pLeuValArgAspGluMetGluAsnAlaValLys 877 LeuAspValProLeuLysValAspValTyrTyrGlyLysGluTrp 2971 GAATAATGGCTGGGGTAAAGGAATTTAAAGATCTAATAGAATTA~
892 Glu 3106 CTACAGGTTTGTATATTGATGTTTCACAACCTTATACTGCA~AGA

3241 AACTTGTTGGGAAAAAATGGATTTTI'CAAGGGAGACTTTCTTTTT

3466 AAAGTGCAGCGGGTTACGAAGATTTTTTAA~AAACTTGACAGTTC

3691 TTGGAATAGAAAbmTGCAAAGTTTAATGAGTATTGTCCAATTTTAT

;, , ~ , ,:~ ; . , ; ,: ; :

WO92/0620' 2 ~ 9 2 3 ~ 7 PCT/~;S91/~7076 4006 AAAAGATTGAAAATTTTGTTAGTTACAAAATAAATGATTCATCT~
4051 AGAGACTATCTG~GATTTTTTAAGGTTTATGTCTAATTCTCTTG

4186 CAATGCTTAATGA~ACATTTCAGGAGCTTTTAAAACGAGAAGAAT

The above nucleo~ide sequence was identified by a "degenerate prirner" method that has broad utility and is an ~rn~ortant aspect of the present invention. In the degenerate primer method, DNA fragrnents of any thermostable polymerase coding sequence corresponding tO conserved domains of known therrnostable DNA
lS polyrnerases can be iden~ed.
The degenerate primer method was developed by comparing the an~ino acid sequences of DNA polvmerase I protein~ &om ~Q, Tth, 17, and E. coli in which various conserved regions were idendfi~ Primers collesponding to ~hese conselvedregions were then designed. As a result of the present invention, Taf sequences can be used to design other degenerate primers, as can the coding sequences of the l'he~nus species spsl7 DNA polymerase I gene (see PCr Publication No. , filed September 30,~1991, and incoIporated herein ~ re~erence) and the Thermoto~a maritima DNA polymerase I gene (see PCI Publication No. , fled August 13, 19~1, and incorporate~ herein by reference), and the errnus species Z05 DNA polymerase I gene (see PClr Publica~on No. , filed September 30, 1991, and incorporated herein by reference). The generic utility of the degenerate primer process is exemplified herein by specific reference to the method as ~ ~;
applied to cloning the Taf DN~ polymerase I gene.
To clone the Taf DNA polymerase I gene, regions of cons~ved amino acid sequences of DNA polymerase I enzyrnes were converted toall of the possik codonswhich rep~esent each of the arnino acids. Due to the degenerate nan~re of the genEtic code, a given amino acid may be represented by several different codons. Where more than one base can be present in a codon for a given arnino acid, the sequence is said to be degenerate.
The primers were then synthesized as a pool of all of the possible DNA
se~quences that could code for a given amino acid sequence. The amount of degeneracy ' .:
,: ', . , : . ::
'`'~ . ', ', ' : ~ ' wo 92/0620' ~ P~r/US~1/07076 ~,a~3~

of a given prirner pool can be detemlined by multiplying the number of possible nucleotides at each position.
The ~reater the number of individual unique primer DNA sequences within a pr~ner pool, the greater the probability that one of the unique primer sequences will S bind to regions of the target chromosomal DNA other than the one desired; hence, the lesser the specificity of the resulting amplification. To increase the specificity of the arnplification using degenerate primers, tne pools are synthesized as subse~s such that the entire group of subsets includes all possible DNA sequences encoding tbe given amino acid sequence, but each individual subset only includes a portion: for example, 10 one pool may contain either a G or C at a certain position while another pool contains either an A or T at the same position. As described herein, these subpools are designated with a DG number ~where number is between 99 and 200).
Both forward primers (directed from the 5' region toward the 31 region of the gene, complementary to the noncc~ing strand) and reverse primers (directed from the 15 3' region of the gene toward the 5' region of tbe gene, complementary to the coding strand) were designed for most of the consen/ed regions to clone Taf polymerase. The pIimers were designed with restric~on sites at ~he 5' ends of the primers to ~acilitate - -cloning. The forward prirners conta~ned a ~glII restric~on site ~AGATCI'~, while the reverse p~imers contained an EcoRI restriction site (GAATTC). In addition, the ~0 prirners contained 2 additional nucleotides at the 5' end to increase the efflciency of cutting at the restriction site.
Degenerate primers were then used in PCR processes tO arnplify chromosornal DNA from Taf. The products of the PCR processes using a combination of forward and reverse pr~mer pools in conjunction with a series of temperature proISles were 25 compar~d. When specific products of sirnilar size to the producc generated using Taq chromosomal DNA were pr~duced, the PCR fiagments were gel purified, reamplified and cloned into the vector pBSMl3+1E~ndm~ glII (a derivative of the Stratagene~
vector pBSMl3+, now marketed as pBS+, in which the Hindm si~e of pBSM13~ was converted to a B~lII site). The PCR ~agments were cloned and sequenced; fragments 30 were iden~ied as potential thennostable DNA polyme~ase coding sequences if the fiagments con~ained sequences ~hat encode regions of amino acid homology to o~her known polymerase protein sequences, particularly ~ose of ~g polymerase and Tth ;
polymerase.
The por~ons of the Taf DNA polymerase gene were then identified in the 35 chromosomal DNA of Taf by Southern blot analysis. The Taf chromosomal DNA wasdigested with a vanety of enzymes and transferred tO nitrocellulose filters. Probes ~;
labeled with 32p or biotin-dU'IP were generated for various regions of the gene from ' ; ' ' ' ' ' ' ~ ' ; ' ! ,, '' ' ' ~
/. , . ~ ' ' ' ', ' WO s~/062n~ 2 0 9 ~ 317 pcT/uss1/n7l)76 the cloned PCR products. The probes were hybridized to the ni~rocellulose-bound genomic DNA, allowing identification of the molecular weight of the chromosornalDNA fragment hybridizing to the probe. The use of probes covering the 5' and 3' regions of the gene ensures that the DNA fragrnent(s) contain most if not all of the S structural gene for the polymerase. Restriction en~ymes can be identified that can be used to p~duce fragrnents that contain the s~uctural gene in a single DNA fragrnent or in several DNA fragments to facilitate cloning.
Once identified, ch~mosornal DNA encoding p~ions of the Taf DNA
polyrnerase gene was cloned. Chrormosomal DNA was digested with the iden~fied 10 res~icdon enzymes, and size fractionated. Fractions containing the desired size range were concentrated, desalted, and cloned into the pBSM13+Hindm::BglII cloning vector. Clones were identified by hybridization using labeled probes generated from the previous cloned PCR products. The cloned fragments were identified by restriction enzyrne analysis and Southern blot analysis.
The DNA sequence and amino acid sequence shown above and the DNA
compounds that encode those sequences can be used tO design and construct recombinant DNA ex~ression vect~rs to express Taf DNA polyme rase activity in a wide variety of host cells. A DNA compound encoding all or part of Ihe DNA
sequence shown above can also be used as a pro~e to identify thermostable polymerase-20 encoding DNA fi~m nther o~ganisms, and the amino aad sequence shown abo~te can be used to design peptides ~or use as immunogens to prepare antibodies that can be used to identifS and purify a therrnostable polymerase.
~ Vhe~her produced by recombinant vect~s ~hat encode the above arnino acid sequence or by native Taf cells, however T~ DNA polyrnerase will typically be 25 pulified prior to use in a recombinant D. ~ technique. The present invention provides such purification methodology.
For recovenn~ the native protein, the cells are grown using the rnethod of Huber et al., 1989, ~ App. Mic~hial. 12:32-37. After cell growth, the isolation and purification of the enzyme takes place in six stages, each of which is carried out at a 30 tempe~ature below room temp~ature, preferably about 0 to about 4C, unless s~ated otherwise.
In the first stage or step, the cells, if frozen, are thawed, disintegrated by ultrasound, suspended in a buffer at about pH 7.5, and centrifuged.
In dle s~:: ond stage, the supernatant is collected and then fractionated by adding 35 a salt such as dry ammoniurn sulfate. The appropriate fraction (typically 45-7S% of saturadon) is collected, dissolved in a 0.2 M po~assium phosphate buffer preferably at ~`
pH 6.5, and dialyzed against the same buffer.

: , .",'' '' ' ' ' ' .
,, , , ' , , ~ ''' . ' ' ': , , " , , w~ s2/n620~ Pcr/l~;s91/0707~
~,a9?~3~

The third step removes nucleic acids and some protein. The fraction from the second stage is applied to a DEAE-cellulose column equilibrated with the same buffer as used above. Then the column is washed with the same buf~er and the flow-through prote~n-conta~ning fractions, detenr~ined by absorbance at 280 nm, are collected and S dialyzed against a 10 mM potassium phosphate buffer, preferably with the sarne ingredients as the first buffer, but at a pH of 7.5.
The fourth step consists of hydroxyapatite chromatography; the fraction so collected is applied to a hydroxyapa~ite coluinn equilibrated with the buffer used for dialysis in the third step. The column is then washed and the enzyme eluted with a linear gradient of a buffer such as 0.01 M to 0.5 M potassium phosphate buffer at pH
7.5 containing 10 mM 2-mercaptoethanol and 5% glycerol. The pooled fractions containing thermostable DNA polymerase activity are dialyzed against the same buffer used for dialysis in the third step.
The fifth stage consists of anion exchange chrornatography; the dialyzed fraction is applied to a DEAE-cellulose column, equilibrated with the buffer used for dialysis in the third step. The colurnn is then wasbed and the enz~"me eluted with a linear gradient of a buffer such as 0.01 to 0.6 M KCI in the buffer used ~or dialysis in ~ ~
the third step. Fractions with thermostable enzyme activity are then tested for ~ `
contaminating deoxyTibonucleases (end~ and cxonucleases) using any suitable , procedure. Por example, the endonuclease activity may be determ~ed -electrophoretically from the change in molecular weight of phage lambda DNA or supercoiled plasmid DNA after incubation with an excess of DNA polymerase.
Simila~ly, exonuclease activity rnay be determined electrophore~cally from the change in molecular weighc of restriction enzSnne-cleaved DNA after treatment with the DNA
polymerase fraction. The fractions dete~nined tO have polymerase acd~ity but no deoxyribonuclease activity are pooled and dialyzed against the sarne buffer used in the third step. ~ .
The sixth step consists of DNA binding protein affinity chromatography; the pooled fractions are placed on a phosphocellulose column with a set bed volume. The column is washed and the enzyme eluted with a linear gradient of a buffer such as 0.01 to 0.8 M KCl in a potassium phosphate buffer at pH 7.5. The pooled fractions having thermostable polymerase acdvity and no deoxylibonuclease activity are dialyzed against a buffer at pH 8Ø
The molecular weight of the DNA polymerase purified from Taf may be determined by any technique, for example, by SDS-PAGE analysis using protein molecular weight markers. The molecular weight, calculated from the coding sequence, of Taf DNA polyrnerase I is 103,273 daltons. The purification protocol of ~, , .
' : i . ' , . ~ : , W(~ 9~/0620' 2 ~ 9 ~ 3 1 7 P~/~'S91/07076 n~tive Taf DNA polymerase is described in detail in Exarnple l. Purification of the recombinant Taf polyrnerase of the invention can be carned out with similar me~hodology.
The entire coding sequence of the Taf DNA polymerase gene is not required, 5 however, to produce a biologically active gene product with DNA polyrnerase activity.
The availability of DNA encoding the ~ DNA polymerase sequence provides the opportunity to modify the coding sequence so as to generate mutein (mutant protein) forms also having DNA polymerase activity. The amino(N)-terminal portion of the Taf polymerase is not believed to be necessary for polymerase a~ivity. Using recombinant 10 DNA methodology, one can delete up to approxirnately one-third of the N-terminal coding sequence of the Taf gene, clone, and express a gene product that is quite active in polymerase assays. Because certain N-terminal shortened forms of th~ polymerase are active, the gene cons~ucts used for expression of these polyrnefases can include the corresponding shortened forrns of the coding sequence.
In addition to the N-terminal deletions, individual amino acid residues in the peptide chain of 'raf polyrnerase tnay be modified by oxidation, reduction, or other derivation, and the ~rotein may be cleaved to obtain fragrnents that retain activity. Such alterations that do not des~oy ac~vity do no~ remove the protein from the definition of a protein with Taf polymerase activity and so are specifically included within the scope of 20 the present invention.
- Modifications to the prirnary strucnTre of the Taf DNA polyrnelase gene by deletion, addihon~ ~r alteration so as to change the amino acids incoIporated into the Taf DNA polymerase during translation can ~ made without destroying the high tempera~e DNA polyrnerase activity of the p~Gtein. Such substitutions or other 25 alte~ations result in the p~duction of proteins having an amino aad sequence encoded by DNA falling wi~hin the contemplated scope of the presen~ invention. Likewise, ~e cloned genomic sequence, or homologous syn~etic sequences, of the TaiF DNA
polymerase gene can be used ~ express a fusion polypep~de with ~DNA
polymerase acdvity or to express a protein with an amino acid sequence identical to that 30 of nadve Taf DNA polymerase. In addi~ion, such expression can be directed by a control sec~uence that functions in whatever host is chosen to express the Taf DNA
polymerasç.
Thus, the present invention pro~ides a coding sequence for Taf DNA
polymerase from which expression vectors applicable to a variety of host systems can 35 be cons~ucted and the coding sequence expressed. Portions of the Taf polyrnerase~
encoding sequence are also useful as probes to re~ieve other thermostable polyrnerase-encoding sequences in a variety of species. Accordingly, oligonucleotide probes that '' ''' , , " ' ,, ~, ;, ~vo()~o~n2 2~23~ PCl/US91/07076 encode at least four to six arnino acids can be synthesized and used to retrieve additional DNAs encoding a therrnostable polymerase. Because there may not be an exact natch between the nucleotide sequence of the therrnostable DNA polymerase gene of Taf and the corresponding gene of other species, oligomers containing approximately 12-18 S nucleotides (encoding the four to six amino sequence) are usually necessary to obtain hybridization under conditions of sufficient smngency to eliminate false positives.
Sequences encoding six an~ino acids supply arnple information for such probes.
The present inven~ion, by providing coding sequences and arnino acid sequences for Taf DNA polynerase, therefore enables the isolation of other theImostable polyrnerase enzymes and the coding sequences for those enzymes. Thededuced arnino acid sequence of the T~af DNA polymerase I protein is sirnilar to the amino acid sequences for other thermostable DNA polymerases, such as those from and Tth (see PCI` Publication No. 91/09950, incorporated hesein by reference).
However, regions of dissirnilarity between the coding sequences of the thermostable l~NA polyrnerases can also be used as probes to iden$ify other thermostable polymerase coding sequences which encode enzymes having some properties of one known therrnostable polymerase and perhaps different proper~es.
For example, the coding sequence for a thennostable polymerase having some properties of ~9 and other divergent proper~ies of ~ may be identified by using probes comprising regions of dissimilarity between ~.9 and Taf.
Whether one desires to p~duce an enzyme identical to native T~DNA
polymerase or a derivahve or homologue of shat enzyme, the production of a recombinant form of Taf polymerase typically involves the cons~uction of an expression vector, the transforrnation of a host cell with the vector, and culture of the ~ansforcned host cell under conditions such that expression will occur.
To construct ~e expression vector, a DNA is obtained that encodes ~e mahlre (used here to include all muteins) enzyme or a fosion of the Taf polyrnerase to an additional sequence that does not destroy activity or to an additional sequence cleavable under contr~lled condidons (such as treatment with peptid~se) to give a~ active protein.
The coding sequence is then placed in operable linkage with suitable control sequences in an expression vector. The vector can be designed to replicate autonomously in the ~ "
host cell or to integrate into the chromosomal DNA of the host cell. The vector is used ~:
to ~ansfoIm a suitable host, and the transfoImed host is cul~ured under con~itions suitable ~or expression of recombinant Taf polymerase. The Taf polyrnerase is isolated from the medium or from the cells, although recovery and purification of the protein -may not be necessary in some instances.

' .

, .
, .
,, . ~ .

wo 9Z/0620~ 2 ~19 ~ 317 PCl/us9l/o7n76 Each of the foregoing steps can be done in a var ty of ways. For example, the desired coding sequen~e may be ob~ined frolTl genomic fragments and used directly in appropriate hosts. Thc construction of expression vectors operable in a variety of hosts is tnade using appropriate replicons and control sequences, as set forth generally S below. Construction of suitable vectors containing the desired coding and con~ol sequences ernploys standard ligation and restriction techniques that are well und~rstood in the art. Isolated plasmids, DNA sequences, or synthesized oligonucleotides are cleaved, modified and religa~ed in the fonn desired. Suitable restriction sites can, if not normally available, be added to the ends of the coding sequence so as to facilitate 10 construction of an expression vel~tor, as exemplified below.
Site-specific DNA cleavage is pe~formed by treating with the suitable restriction enzyme (or enzyrnes) under conditions that are generally understood in the art and specified by the rnanufacturers of cormrnercially available restnction enzymes. See, e.g., New England Biolabs, Product Catalog. In general, about 1 ~Lg of plasrnid or 15 other DNA is cleaved by one Imi~ of enzyme in about 20 ~LI of buffer solution; in the examples below, an excess of resmction enzyme is generally used to ensure complete digestion of the DNA~ Incubadon times of about one to two hours at about 37C are ~rpical, although variations can be tolertted. After each incubation, protein is removed by extraction with phenol and chlorofoqm; this ex~action can be followed by ether 20 extraction and recove3y of the DNA from aqueous ~actions by precipitation with ethanol. If desired, size separation of the cleaved fragments may be performed by polyacrylamide gel or agarose gel elec~ophoresis using standard techniques. See, e.g., Maxam et al., , 198û, ~:499-560.
RestP.ction-cleaved fragmen~s wi~h single-strand "overhanging" tennini can be 25 made blunt~ nded (double-strand ends~ by treal~g with the large fragment of E. coli DNA polymerase I (Klenow) in thc presence o~F the four deoxynucleoside triphosphates (dNTPs) using incubation times of about 15 to 25 minutes at 20C to 25C in 50 mM
Tns, pH 7.6, 50 mM NaCl, 10 mM MgC12, 10 rnM Dl-r, and 5 to 10 IlM dNTPs.
The Klenow fragment fills in at 5' protruding ends, but chews back protruding 3'30 single strands, even though the four dNTPs are present. If desired, selective repair can be performed by supplying only one of the, or selected, dNTPs within the limitations ~-dictated by the nawre of the p~udir~ ends. After treamlent with Klenow, the rnixture is ex~racted with phenoUchloroIo~ ethanol precipitated. Sirnilarresults can be achie~ed using S 1 nuclease, becausc ~eatment under appropriate ronditions with S 1 35 nuclease results in hydrolysis of any single-stranded portion of a nucleic acid.
Synthetic oligonucleotides can be prepared using the tnester me~od of Matteucci et al., 1981, 1. Arn. .Chem. Soc. ~ 3185-3191, or automated synthesis .

, .

wO 922~~,3~ ~ P~T/US91/07076 1~
methods. Kinasing of single strands prior to annealing or for labeling is achieved using an excess, e.g., approximately lû units, of polynucleotide kinase to 0.5 ~M substrate in the presence of 50 rnM Tris, pH 7.6, 10 mM MgC12, 5 rnM dithiothreitol (Dl-r), and 1 to 2 ~,lM ATP. If kinastng is for labeling of probe, the ATP will be labeled with 32p S Ligations are perforrned in 15-30 ~I volumes under the following standardconditions and temperatures: 20 mM Tris-CI, pH 7.5, 10 rnM MgCI2, 10 rnM DTI, 33~g/ml BSA, 10 mM 50 rnM NaCl, and either 40 ~iM ATP and 0.01-0.02 (Weiss) units T4 DNA ligase at 0C (for ligation of fragments with complementary single-stt~nded ends) or 1 mM ATP and Q.3-0.6 units T4 DNA ligase at 14C (for "blunt end" ~
ligation). Intermolecular liga~ions of fragments with complementary ends are usually ~;
perfoImed at 33^100 ~lg/ml ~otal DNA concemrations (5-100 nM total ends concentration). Intermolecular blunt end liga~ions (usually employtng a 20-30 ~old molar excess of linkers, optionally) are perfonned at 1 ~lM total ends concentration.
ln vector cons~ction, the vector f~grnent is cornmonly treated with bacterial orcalf intestinal aLkaline phosphatase (BAP or CIAP) to remove the 5' phosphate and -prevent religation and reconstruction of the vector. BAP and CLAP digestion conditions are well l~own in the art, and published protocols usually accompany the cornrnercially available BAP and CIAP enzyrnes. To recover the nucleic acid ~agments, the preparation is extracted with phenol-chlorofoqsn and ethanol precipitated '~
to remove the phosphatase and purify the DNA. Alternatively, religation of unwanted vector fragments can be prevented by ~estricdon enzyme digestion before or afterligation, if appropriate restriction sites are available. ~ -For por~ions of vectors or coding sequences that Tequire sequence modifications, a variety of site-specific pnmer~directed mutagenesis methods areavailable. The polymerase chain reaction (PCR~ can be used to perfolm site-specfflc mutagenesis. In another technique now standard in the art, a synthetic oligonucleotide ~ ;
encoding the desired mutation is used as a prirner to direct synthesis of a complementary nucleic acid sequence contained in of a single-stranded vector, such as pBSM13~ defivatives, that seIYes as a template for constmction of the extension product of the mu~agenizing primer. The mutagenized DNA is transformed into a host ~ ~ :
bacterium, and cultures of the transfo~ned bacteria are plated and identified. The identification of modified vectors may involve transfer of the DNA of selected transformants to a nitrocellulose filter or other membrane and the "li~ts" hybndized with Idnased synthetic mutagenic p~imer at a temperature that pem~its hybridization of an exact match to the modified sequence but prevents hybridization with the original unrnutagenized strand. Transforrnants that contain DNA that hybridizes with the probe ` ~ -: :

., : . ' .

WO ~/0620~ 2 ~ 9 ~ 3 :1 7 PCl/I~S91/07076 are then cultured (the sequence of the DNA is generally confirrned by sequence analysis) and serve as a reselvoir of the modified DNA.
In the construc~ion set forth below, correct ligations for plasrnid constructionare conf~ned by first transforrning E. coli strain DGlOl (ATCC 47043) or another5 suitable host with the ligation rn~xture. Successful transformants are selected by arnpicillin, te~acycline or other antibiotic resistance or sensitivity or by using other mar~ers, depending on the mode of plasn! ' cons~ruction, as is understood in the art.
Plasmids from the transformants are Ihen ptepared according to the method of Clewell et ~., 1969, Pr~c. Na,~l. e~- Sçi. ~ 62:1159, optionally following 10 chloramphenicol amplification (Clewell, 1972, l Bacerioh ~Q:667). Another method for obtaining plasmid DNA is desc~ibed as the "Base-Acid" extraction method at page 11 of the Bethesda Research l,aboratones publication Focus, volume 5, number 2, and very pure plasmid DNA can be obtained by replacing steps 12 through 17 of the protocol with CsCVethidium brornide ultracentrifugation of the DNA. The isolated15 DNA is analyzed by resmction enzyme digesdon and/or sequenced by the dideoxy method of Sanger et ol., 1977, Proc. Nath Acad. Sci. USA ~ s463. as further descnbed by Messing et al., 1981, Nuc. Acids ~. 9:309, ~r by the method of Maxametal., 1980, Methodsi_EnzvmQlo~v 65:499.
The con~ol sequences, expression vectors, and transformation methods are 20 dependent on the type of host cell used to express the gene. Generally, procaryotic, yeast, insect, or marnmalian cells are used as hosts. Procaryotic hosts are in general the most emcient and convenient for the production of recombinant proteins and ar.
therefore prefe~ ~or the expression of Taf polyrnerase.
The proca~yote most frequently used to express recombinant proteins is E. coli.
25 ~;or cloning and sequencing, and for expression of constructions under comrol of most ~ ~ ;
bacterial promo~e~s, E. coli K12 s~rain MM294, obtained from the E. coli GeneticStock Center under GCSC #6135, can be used as ~he host. For expression vectors with the PLNRBS or PLT7R~S con~ol sequence, E. coli K12 strain MC1000 lambda lysogen, ~N7Ns3CI857 SusP80, ATCC 39531, may be used. E. coli DGl 16, which 30 was deposited with the ATCC (ATCC 53606) on April 7, 1987, and E. coli KB2, which was deposited wilh the ATCC ~ATCC 53075) on March 29, 1985, are also useful host cells. For M13 phage .~combinants, E. çQ~ s~ains susceptible to phage infection, such as E. coli K12 strain DG98, are employed. The DG98 strain was deposited with the ATCC (ATCC 39768) on July 13, 1984.
However"~icrobial stTains other than E. coli can also be used, such as bacilli, for example Bacillus subtilis, various species of Pseudomonas, and other bacterial strains, for recombinant expression of Taf DNA polymerase. In such procaryotic .. : . , ~ : .
, . . . , . ~ , ~:

': ' : '.,~ . '' :, , ~o9~/n620~ 923 1~ Pcr/us91/07076 2û
systems, plasmid vectors tha~ contain replication sites and control sequences derived from the host or a species compatible with the host are typically used.
For exarnple, E. çQ~ ir, typically cansfo~ned using derivatives of pl3R322, described by Bolivar ç~ al., 1977, ~ç 2:95. Plasmid pBR322 cont~uns genes for 5 arnpicillin and te~acycline resistance. These drug resis~ance markers can be either retained or destroyed in constructing the desired vec~or and so help to detect ~he presence of a desired recombinant. Cotnrnonly used procaryotic control sequences, i.e., a promoter for transcription initiation, optionally with an operator, along with a ribosome binding site sequence, include the ,B lactamase (penicillinase) and lactose llac) 10 promoter systerns (Chang et ~1., 1977, ~3~ ~:1056), the ~yptophan (tlp) promoter system (Goeddel et al., 1980, ~. ~.~ ~. 8:4057), and the lambda-derived PL promo~er (Shimatake et~., 1981, ~YE~ 292:128) and N-gene libosome binding site (NRBS)- A portable control system cassette is set fo~th in IJnited S~ates Paten~ No. 4,711,845, issued December 8, 1987. This cassette comprises a PL
15 promoter operably linked to the NRBS in turn positioned upstream of a third DNA
sequence having at least one restricdon site that pen~its cleavage within six bp 3' of the NRBS sequence. Also useful is the phosphatase A (phoA) system described by Changet al. in European Pa~ent Publication No. 196,864, published October 8, 1986.
However, any available promoter system compadble with procaryotes can be used to20 construct a Taf expression vector of the invention.
In addition to bacteria, eucaryo~ic mic~obes, such as yeast, can also be used asrecombinant host cells. Labora~ory s~ains of SaccharomYces cerevisiae, Baker's yeast, are most often used, although a number of othet strains are commonly available. While vectors employing the two micron o~gin of replication are common ~Broach, 1983, 25 ~ç~. Enz. 101:307), other plasrnid vectors suilable for yeast expression are known (see, for example, Sdnchcomb çt al., 197~, Nature 2~2:39; Tschempe et ~1., 1980,Gene 10:157; and Clarke ç.~ ~1., 1983, Meth. ~L 101:300). Control sequences for ~ .
yeast vectors include promoters for the synthesis of glycolytic enzymes (Hess et al., ~ `
1968, l Adv. Enzvme ~g. 7:149; Holland et al., 1978, Biotechnolo~y 17:4900; and 30 Holland et aL, 19B1, 1. Biol. 5h~. 256:1385). Additional promoters known in the ~`
art include the promoter for 3-phosphoglyceTate k:inase (Hitzeman et al., 1980, J. Biol.
Chem. ~:2073) and those for other glycolytic enzymes, such as glyceraldehyde 3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-~phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, 35 triosephosphate isomerase, phosphoglucose isomerase, and glucokinase. Other promoters that have the additional advantage of transcription controlled by growth conditions are the promoter regions for alcohol dehydrogenase 2, isocytochrome C, . . . . . .... .
.... .. . . .
. . . - ' , ~

..
. . . .

WO 92/0620~ 2 ~ 9 2 31 7 pcr/~!ssl/o7o76 acid p~. ?hatase, degrada~ive enzyme . associated with l~itrogen metabolism, andenzymes responsible for mal~ose and galactose utiliza~on (Holland, ~).
Tem~ina~or sequences may also be usesi to enhance expression when placed at the 3' end of the coding sequence. Such terrninaturs are found in the 3' untranslated region following the coding sequences in yeast-denved genes. Any vector containing a yeast-compatible promoter, origin of replication, and other control sequences is suitable for use in cons~ucting yeast af expression vectors.
The ~ gene can also be expressed in eucaryotic host cell cultures derived from multicellular Grganisms. See, for example, ~ 1~, Acadernic Press, Cruz and Patterson, editors (1973j. Useful host cell lines include COS-7, COS-A2, CV-1, murine cells such as murine myelomas N51 and VERO, HeLa cells, and Chinese hamster ovary (CHO) cells. Expression vectors for such cells ordinarily include promoters and control sequences compatible with mamrnalian cells such as, for example, the commonly used early and late promoters from Simian Virus 40 ~SV 40)(Fiers e~ al., 1978, ~aturç 273:113), or other vir~l promoters such as those derived f~om polyoma, adenovirus 2, bovine papillomavinls (BPV), or avian sarcoma viruses, or immunoglobulin promoters and heat shock promoters. A system for expressing ~`DNA in mammalian systems using a BPV vector system is disclosed in United StatesPatent No. 4,419,446. A modification of this system is described in United States Patent No. 4,601,978. C;eneral aspeets of mammalian cell host system ~sformations have been described by Axel, IJnited S~tes Patent No. 4,399,216. "Enhaneer" regions are also important in optimizing expression; ~lese are, generally, sequences found ~ `
upstream o~ the promoter region. C)rigins of replicadon may be obta~ned, if needed, from Yiral ~,urces. However, integration into dle chromosome is a common mechanism for DN~ replication in eucaryotes.
Plant cells can also be used as hosts, and control sequences compatible with plan~ cells, such as the nopaline synthase promoter and polyadenylanon signal sequences a)epicke~ et al., 1982, l. MoL ~L. GQ- 1:561) are available. Expression systems employing insect cells utilizing the control systems provided by baculovirus vectors have a~so been desclibed ~Miller et al., in C;enetic En~e~neerin J (1986), Setlow et aL, eds., Plenum Publishing, Vol. 8, pp. 277-297). Insect cell-based expression can be accomplished in ~ fiu~ipeida. These systems are also successful in producingrecombinant E~polymerase.
Depending on the host cell used, transfolmation is done using standard techniques appropriate to such cells. The calcium treatment employing calcium chloride, as described by Cohen, 1972, Pr~c. Natl. Acad. Sci. USA 69:2110 is used ` ~ :
for procaryotes or other cells that contain substantial cell wall ba~iers. Infection with , ':

., , ~ . - ~ ; , ~. . , : ,.:. -:-wo 9Z/0620~ ~cr/Us9l/07076 ~a~J3~7 2~

A~robactenl~m n~ (Shaw çt ~., 1983, ~ 2~:315) is used for certain plant cells. For marnm~lian cells, d~e calcium phosphate precipitation method of Graharn and van der Eb, 1978, Virol~ v ~2:546 is preferred. Transformations into yeast are carried out according to dle method of Van Solingen et al., 1977, 1. Bact. 130:946, and Hsiao et ah, 1979, Proc. Nath Acad. Sçi. lJSA 76:3829.
Once the Taf DNA polymerase has been expressed in a recombinant host cell, purification of the pr~tein rnay be desired. Al~hough a variety of punfica~ion procedures can be used to purify the ~ecombinant the~rnost~ble polyr;nerase of the invention, fewer steps may be necessary to yield an enzyme preparation of equal purity.
Because E. ÇQ!i host proseins are heat-sensitive, the ~combinant thennostable Taf DNA
polymerase can be substantially enriched by heat inactivating the crude Iysate. This step is done in the presence of a sufficient amount of salt (typically 0.3 M ammonium sulf~te) to ensure dissociation of the Taf DNA polymerase frorn the host ~NA and to reduce ionic interactions of Taf DNA polyrnerase with other cell lysate proteins.
In addition, the presence of 0.3 M am3noniutn sulfate promotes hydrophobic `~
interaction with a phenyl sepharose column. Hydrophobic interaction chromatography `
is a separation technique in which substances are separa~ed on the basis of differing strengths of hydrophobic interaction with an uncharged bed tnaterial rontaining ~ ~ -hydr~phobic groups. Typically, the column is first equilibrated under conditionsfavorable to hydrophobic binding, such as high ionic strength. A descending saltgradient may then be used to eluie the sample.
According to the invention, an aqueous ~m~xture (containing either na~ive or recombinant Taf DNA polyrnerase) is loaded onto a column containing a relativelystrong hydrophobic gel such as phenyl sepharose (manufactured by PhaTmacia) or Phenyl TSK (manufactuTed by Toyo Soda). To promote hydrophobic interaction with a phenyl sepharose colurnn, a solvent is used which contains, for example, greater than or cqual to 0.3 M ammonium sulfate. The column and the sample are adjusted to 0.3 M
ammonium sulfate in 50 mM Tris (pH 7.5) and 5 mM EDTA ("TE") buffer that also ~ ~
contains 0.5 mM DTF, and the sarnplè is applied to the column. The column is washed ~ -with the 0.3 M ammonium sulfate buffer. The enzyme may then be eluted wi~h solvents which attenuate hydrophobic interactions, such as decreasing salt gt~dients, or increasing gradients or addidon of ethylene or propylene glycol, or urea. For native Taf DNA polymerase, a prefe~ed embodiment involves washing the column with 2 M ; -urea in 20% ethylene glycol in TE-Dl'r wash.
For long-term stability, Ea~ DNA polymerase enzyme can be stored in a buffer that contains one or more non-ionic polyrneric detergents. Such detergents are generally those that have a molecular weight in the range of approximately 100 to ~ -. - :. : , - , -.. ., -., , ,, ., . . . , . - - .
, . . : . , , .': "' . . ~ ,': ~

,:

wo 9~/0620~ 2 ~) 9 2 317 PCT/1_591/07076 ~3 250,000 daltons, preferably about 4,000 ~o 200,000 daltons and stabilize the enzyme at a pH of from about 3.5 to about 9.5, preferably from about 4 to 8.5. Examples of such detergents include Ihose specifiled on pages 2~5-2~8 of McCutcheon's Emulsifiers &
Deter~ents, North American edi~ion (1983), published by the McCutcheon Division of S MC Publishing Co., 175 Rock Road, Glen Rock, NJ (USA).
Pr~oferably, ~he detergents are selected from the group comprising ethoxylated fatty alcohol ethers and lauryl ethers, ethoxylated alkyl phenols, octylphenoxy polyethoxy ethanol compounds, modified oxyethylated and/or oxypropylated s~aight-chain alcohols, polyethylene glycol monooleate compounds, polysorbate compounds,lO and phenolic fatty alcohol ethers. More particularly preferred are Tween 20, a polyoxyethylated (20) sorbi~an monolaurate from ICI Americas Inc., Wilmington, D.E., and Iconol NP-40, an ethoxylated aLkyl phenol (nonyl) from BASF Wyandotte Corp. Parsippany, NJ. ~ ;
The the~slostable enzyme of this invention may be used for any purpose in 15 w'nich such enzyme activity is necessary or des~red. In a particularly preferred embodiment, ~he enzyme catalyzes the nucleic acid amplification reaction known as PCR. This process for amplifying nucleic acid sequences is disclosed and claimed in United States Patent No. 4,683,202, issued July 28, 1987, the disclosure of which is incolporated herein by reference. The PCR nucleic acid amplification method involves 20 arnplifying at least one specific nucleic acid seq1lence contained in a nucleic acid or a rnixture of nucleic acids and in the most comrnon embodiment, produces double- ; stranded DNA.
Foq ease of discussion, the protocol set ~orth below assumes that the specific sequence to be amplified is contained in a double-stranded nucleic acid. However, ~he 25 process is equally useful ir, - mplifying single-s~anded nucleic acid, such as rnRNA, although in the prefe~ed emb~nent the ultimate pr~duct is still double-s~nded DNA. In the amplification of a single-stranded nucleic acid, the first step involves the syn~hesis of a complementary s~and (one of the two amplification prirners can be used ;~
for this purpose), and the succeeding steps proceed as in the double-s~anded 30 arnplificadon process described below.
This arnplification process comprises the steps of: ~ `
(a) contacdng each nucleic acid strand with four different nucleoside triphosphates and one oligonucleotide p~imer for each s~and of the specific sequence being amplified, whe~ein each primer is selected to be subs~antially complementary to 35 ehe different s~ands of t'ne specific sequence, such that the extension product synthesized from one primer, when it is separaeed from its complement, can ser-re as a template for synthesis of the extension product of the other primer, said contaceing ,, - -... ........ ,.

. . ; . ............... . :. : ~: ~ -, ~

.: : , U '0 92/062t)' PCI/I,'S91/07076 2o923~ 2~
being at a temperature which allows hybridization of each pnmer to a complementary nucleic acid strand;
(b) contacting each nucleic acid strand; at the same nme as or after step (a), with a DNA polymerase from T which enables combination of the nucleoside ~iphosphates to form primer extension products complementary to each strand of the specific nucleic acid sequence;
(c) maintaining the mixture from step ~b) at an effective temperature for an ef~ective time ~o promote the activity of the enzyrne and to synthesize, for each different -: ;
sequence being amplified, an ext nsion p~duct of each primer which is complementary to each nucleic acid strand template, but not so high as to separate each extension ~ :
product from the complementary strand template;
td) heating the mixture from step (c) for an effective ~me and at an effective ~ :
ternperature to separate the primer extension products from the templates on which they were synthesized to produce single-stranded molecules but not so high as to denature :
iIreversiblytheenzyme; : ;:
(e) cooling the mixture f~m step (d) for an effective tirne and to an effective ~emperature to p~mote hybridization of a pnrner to each of ~he single-stranded molecules produced in step (d); and (f) maintaining the mixture f~m step (e) at an effective tempe~ature for an ~::
effective time to promote the acdvity of the enzyme and to syndlesize, for each different sequence being amplified, an extension product of each plimer which is complementaIy to each nucleic acid template produced in step (d) but not so high as to separate each extension product from the complementary stland template. The effective tirnes and temperatures in steps (e) and (f) may coincide, so that steps (e) and (f) can be ca~ied out simultaneously. Steps (d)-(f) are repeated un~l the desired level of ampliflcation is ob~ained.
The ~nplification method is useful not only for producing large amounts of a specific nucleic acid sequence of known sequence but also forpr~ducing nucleic acid ~:
sequences which are known to`exist but are not completely specified. One need know :
only a sufficient number of bases at both ends of the sequence in sufficient detail so that two oligonucleotide primers can be prepared which will hybridize to different s~ands of :
the desired sequence at relative positions along the sequence such that an extension product synthesized from one primer, when separated from the template (complement), can serve as a template for extension of the other primer. The greater the knowledge about the bases at both ends of the sequence, the greater can be the specificity of the : :
pnrners for the target nucleic acid sequence. ~ ~ ~

,, ,, . ' '' : ~

wo 9Z/06202 2 ~ 9 2 3 1 7 Pcr/l~S91/07076 In any case, an initial copy of the sequence to be amplified must be available, although the sequence need not be pure or a discrete rnolecule. In general, the amplificaaon process involves a chain reaction for producing at least one specific nucleic acid sequence, called the "targe~" sequence, given lhat (a) the ends of the targe~
sequence are known in sufflcient detail that oligonucleotides can be synthesized which will hybndize to them, and (b) a small arnount of the sequence is available to initiate the chain reaction. The product accumulates exponentially relative to the number of reac~ion steps involved. The p~duct of the chain reaction is a discrete nucleic duplex with ternnini corresponding to the ends of the specific primers employed.
Any nucleic acid scquence, in purified or nonpurified form, can be utilized as the starting nucleic acid(s), provided it contains or is suspected to contain the speci~lc nucleic acid sequence desired. The nucleic acid to be arnplified can be obtained from any source, for example, from plasrnids such as pBR322, from cloned DNA or RNA, from na~al DNA or RNA from any source~ including bacteria, yeast, viruses, 15 organelles, and higher organisms such as plants and animals, or from preparations of nucleic acid made in vitro. DNA or RNA may be extracted from blood, tissue material such as chorionic villi, or arnnio~ic cells by a variety of techniques. See, e.g., Maniatis et al., 1982, ~21ecul~1onin~ A l,aboratorv Manual (Cold Spling Harbor Laboratory, Cold Spring Harbor, New York) pp. 280-281. Thus, the process may 20 employ, fo¢ example, DNA or RNA, including messel~ger RNA, which DNA or RNA
may be single-stranded or double-s~anded. In addition, a DNA-RNA hybrid which contains one s~nd of each may be u~lized. A nnL~ e of any of these nucleic acids can also be employed as can nucleic acids produced f~nn a previous arnplification reac~on (using the same or different prirners). The specific nucleic acid sequence to be25 amplified rnay be only ~ ction of a large molecule or can be present initially as a discre~e molecule, so tr.a~ the specific sequeslce constitutes dle endre nucleic acid.
The sequence to 'oe amplified need not be present initially in a pure folm, t'nesequence can be a minor fracdon of a complex ~xture, such as a portior o~` the ~ -~-globin gene contained in whole hurnan DNA (as exemplified in Saik. ,L al., 1985, 30 Science 2~ 30-1534) or a por~on of a nucleic acid sequence due to a particular microo~ganism, which oq ganism migh~ constitute only a very minor fraction of a pardcular biological sample. The cells can 'oe directly used in the amplification process ;
after suspension in hypotonic buffer and heat treatmenl at about 90-100C until cell lysis and dispersion of intracellular components occur (generally 1 to 15 minutes).
35 After the hea~ng step, t'ne amplification reagents may 'oe added directly to the lysed cells. The starling nucleic ~cid sequence may contain more than one desired specific nucleic acid sequence. The amplification process is useful not only for producing large . , .:
, .~, . . . . . . . .
, '- ~

wo s~/0~2n~ /US91/07076 ~9~3~ l 26 amounts of one specific nucleic acid sequence but also for arnplifying simultaneously more than one different specif1c nucleic acid sequence located on the same or different nucleic acid molecules.
Primers play a key role in the PCR process. The word "primer" as used in 5 describing the arnplification process can refer to more than one primer, particularly in the case where there is some ambiguity in the inforrnation regarding the terrminal sequence(s) of the fragment to be arnplified. For instance, in the case where a nucleic acid sequence is inferred from protein sequence infor nadon, a collecdon of prirners containing sequences represendng all possible codon variations based on degeneracy of 10 the genetic code will be used for each strand. A least one pnrner from this collection will be sufficiently homologous with the end of the desired sequence to be arnplified to be useful for amplification. ~ -In addition, more than one specific nucleic acid sequence CM be amplified from the first nucleic acid or mixture of nucleic acids, so long as the appropriate nurnber of 15 different oligonucleotide primers are utilized. For example, if two differen~ specific nucleic acid sequences are to be produced, four primers are utilized. Two of theprimers are specific for one of the specific nucleic acid sequences and the other two p imers are specific for the second specific nucleic acid sequence. In this rnanner, each of the two different specific sequences can be produced exponentially by the present ; -20 process. When allelic variants or different members of a multigene family are to be arnplified, however, one can often amplify seveIal dlfferent sequences with a single set of primers.
A sequence within a given sequence can be amplified after a given number of amplificadons to obtain greater specificity of the reaction by adding after at least one 25 cycle of amplification a set of pnmers that are complementary to internal sequences (that are not on the ends) of the sequence to be amplified. Such primers may be added at any stage and will provide a shorter amplified f~gment. Alternatively, a longer fragment can 'oe-prepared by using primers with non-complementary 5' ends but having some 3' overlap with the 5' ends of the primers previously utilized in the amplification.
Primers also play a key role when the amplification process is used for in vitromutagenesis. The product of an amplificadon reac~on where the primers employed are ; -~
not exacdy complementary to the original template will contain the sequence of dhe primer rather than the template, so in~roducing an in vitro mlutation. Although the initial cycles may be somewhat inefflcient, due to the mismatch between the mutagenic primer `
35 and the target, in further cycles the rnutation will be amplified with an undiminished eff;ciency because no further mispaired priming is required. The process of making an altered DNA sequence as described above could be repeated on the altered DNA using , . ~ . ~, . -., , ,, .. , .

~vo 92/0620 '? ~ 9 2 ~ ~ 7 P~S91/07076 different prirners to induce fur~her sequence changes. In this way, a series of mutated seguences can gradually be produced wherein each new addition to the series differs from the last in a minor way, but from the original DNA source sequence in an .
Increaslngly ma]or way.
S Because the pnmer can contain as part of its sequence a non-complementary sequence, provided that a sufficient arnount of the primer contains a sequence that is complementary to the strand to be amplified, rnany other advantages can be realized.
For example, a nucleo~de sequence that is not complementary to the template sequence (such as, e.g., a promoter, linker, coding sequence, etc.) may 'oe attached at the 5' end of one or botn of the primers and so appended to the product of the amplification process. After the extension rnmer is added, sufficient cycles are run to achieve the desired amount of new templa~e containing the non-complementary nucleotide insert.
This allows production of large quantities of the combined fragments in a relatively short period of time (e.g., two hours or less) using a simple technique.
igonucleotide primers can 'oe prepared using any suitable method, such as, for example, the phosphotriester and phosphodiester methods or automated embodiments thereof. The phospno~riester method is descri'oed in Narang et al., 1979, Meth. Enz~. 68:90, and U.S. Patent No. 4,3S6,270. The phosphodiester method is descri'oed in Brown ç~ aL, 1979j Meth. Enzymol. 68: l09. In one such automated embodiment, die~hylphosphorarnidites are used as starting materials and may be synthesized as described by Beaucage et 3~ 198 l, Tetrahedron ~3ÇE 22: l 859- l 862.
One method for synthesizing oligonucleotides on a modified solid support is described in United States Patent No. 4,458,066. One can also use a primer that has been isolated from a biological source (such as a restriction endonuclease digest).
To produce a specific nucleic acid sequence using PCR, a nuc eic acid containing that se~guence is used as a template. The firs~ step involves contactin~ each nucleic acid strand with four different nucleoside triphosphates and one c mucleotide pr~ne~ for each strand of each specific nucleic acid sequence being arnplifi :d or detected. If the nucleic acids to be amplified or detected are DNA, then the nucleoside triphosphates are usually dATP, dCIP, dGTP, and dl~P, although various nucleotide derivatives can also be used in tne process. The concentration of nucleoside triphosphates can vary widely. Typically the concen~ation is 50-200 ~,IM of eachdNTP in the buffer for arnplification, and MgC12 is present in ~he buffer in an amount of 1 ~o 3 mM to ac~vate the polymelase and increase the specificity of the reac~on.
However, dNTP concentrations of 1-20 IlM ~ay 'oe prefe~ed for some applications,such as DNA sequencing or labeling PCR products at high specific activity.

- " - , ' '' .

wo 9z/0620~ Pcr/US91/07076 2 ~923~ 28 The nucleic ac~d s~nds of the target nucleic acid serve as templa~es for the synthesis of addi~ional nucleic acid strands, which are extension products of the pnmers. This synthesis can be pefformed using any suitable method, but generallyoccurs in a buffered aqueous solution, pre~rably at a pH of 7 to 9, most preferably about 8. To facilitate synthesis, a molar excess of the two oligonucleotide primers is added to the buffer containing the template strands. As a practical matter, the arnount of primer added will generally be in molar excess over the amount of complementary strand (template) when the sequence to be amplified is contained in a m~xture ofcomplicated long-chain nucleic acid s~nds. A large molar excess is p~eferred to improve the efficiency of the process. Accordingly, primer:template ratios of about 1000:1 are generally employed for cloned DNA templates, and primer: tennplate ratios of about 108 1 are generally employed for amplification from complex genomic samples.
The mixture of template, primers, and nucleoside tnphosphates is then treated according to whether the nucleic acids being amplified or detected ~e double- or single-stranded. If the nucleic acids are single-stranded, then no denaturation step need be employed, and ~e Teac~ion mixture is held at a temperature which promotes ~ -hyb~idization of the pIirner to its complementary target (template) sequence. Such temperature is generally from about 35C to 65C or mo~e, prefeTably about 37-60C
for an effec~ve time, generally from a few seconds to five minutes, prefe~ably from 30 seconds to one minute. A hybridiza~on tempelature of 35-80C may be used for ~
DMA polyrnerase, and 15-mer o~ longer p~imers are used to incr~ase the specificity of pnmer hybndization. Shorter pIimers ~qD lower hybridizadon temperatures oq agents which stabilize double stranded DN~
The complement to the ori~nal single-s~anded nucleic acids can be synthesized by adding Taf DNA polymerase in the presence of the appropriate buffer, dNI Ps, and one or more oligonucleotide primers. If an appropriate single primer is added, the primer extension product will be complementary to the single-stranded nucleic acid and will be hybqidized with the nucleic acid strand in a duplex of strands of equal or unequal length (depending where the primer hybridizes on the template), which may then be separated into single strands as described above to produce two single, separated, complementary strands. Alternatively, two or more appropriate primers (one of which will prime synthesis using the extension product of the other primer as a template) may be added to the single-stranded nucleic acid and the reaction calried out.
If the nucleic acid contains two strands, as in lhe case of arnplification of a double-stranded target or second-cycle amplification of a single-stranded target, the strands of nucleic acid must be separated before the primers are hybridized. This strand . .. . .

, WO ~/06202 2 ~3 9 ~ ~ 1 7 P(~ S9 1 /07076 2~3 scparation can be accomplished by any suitable denatu~ing method, including physical, chernical or enzyrnatic means~ One preferred physical nnethod of separating the strands of the nucleic acid involves he~ting the nucleic acid until complete (>99%) denaturation occurs. Typical hea~ denaturation involves temperatures ranging from about 90 to 5 10SC ~or times generally ranging from about a few seconds to 4 m~nutes, depending on the composition and size of tile nucleic acid. Preferably, the effective denaturing temperature is 90-100C for a few seconds to 1 mimJte. S~and separation may also be induced by an enzyme from the class of enzymes known as helicases or the enzyme RecA, which has helicase activity and in the presence of ATP is known to denature 10 DNA. The reaction conditions suitable for separating the strands of nucleic a~ids with helicases are descr~bed by Kuhn Hoffmann-Berling, 1978, CSH-Ouantitative Biolo~v43:63, and techniques for using RecA are reviewed in Radding, 1982, Ann. Rev.
Genetic~ 16:405-437. The denaturation produces two separated complementary strands of equal or une~ual length.
1s T~ the double-stranded nucleic acid is denatured by heat, the reaction mixture is allowed tO cool to a temperature which promotes hybridization of each primer to the complementary target (template) sequence. This temperature is usually from about35C to 65C or more, depending on reagents, preferably 37-60C. The hybridization temperature is maintained for an effecsive dme, generally 30 seconds so 5 minutes, and 20 preferably 1-3 rninutes. In prac~ical terrns, the: temperature is simply lowered from about 95C to as low as 37C, and hybridization occurs at a temperature within this range.
Whether the nueleic acid is single- or double-stranded, the DNA polymerase from Taf may be added at the denat~ation step or when the temperature is being 25 reduced to or is in the range for promoting hybridi~ation. Although the theImostability of Taf polymerase allows one to add Taf polymerase to ~e reac~ion mixture a~ any time, one can substantially inhibit non-specific arnpli~lcation by adding the polymerase to ~he reaction mixture at a point in time when the mixt~e will not be cooled below ulestringent hybridization temperature. After hybridization, the reaction mixture is then 30 heated to or maintained at a temperan~ at which the activity of the enzyme is promoted or optimized, i.e., a temperature sufflcient to increase the activity of the enzyme in facili~ating synthesis of the primer extension products from the hybridiæd primer and template. The temperature must actually be sufficient to synthesi~e an extensionproduct of each primer which is complementary to each nucleic acid template, but must 35 not be so nigh as to denature each extension product from its complementary template (i.e., the temperature is generally less than about 80-90C).

,' ' ' ": ' ' ''"

, 92/06~ ~ 2 3 ~ ~ PCrt' 'S91 /07û76 ~ epending on the nucleic acid(s) employed, the typical temperature effecdve for this synthesis reaction generally ranges from about 40 to 80~'C, preferably 50-75C.
I he temperature more preferably ranges from about 65-75C for Taf DNA polymerase.
The penod of time required for this synthesis may range from several seconds to 40 5 minutes or more, depending mainly on the tem~"erature, the length of the nucleic acid, the enzyrne, and the complexity of the nucleic acid mixrure. The extension time is usually about 30 seconds to three rninutes. If the nucleic acid is longer, a longer tirne period is generally required for complementary strand synthesis. The newly synt'nesi7ed s~nd and the complement nucleic acid strand form a double-stranded 10 molecule which is used in the succeeding steps of the arnplification process.In the next step, the strands of the double-stranded molecule are separated by ~-heat denaturation at a temperature and for a t rne ef~ective to denature the molec~le, but not at a temperature and for a period so long that the thermostable enzyme is completely and ~reversibly denatured or inactivated. After t'nis denaturation of template, the 15 tempe~ature is decreased to a level w'nich promotes hybridization of the primer to the complementary single-stranded molecule (template) produced fro;n the previous step, - as described above. ~-After ~his hybridization step, or conculTently witn the hybndization step, tne temperature is adjusted to a temperature that is effective to promote the activity of the 20 therrnostable enzyme to enable synthesis of a primer extension product using as a template ~oth the newly synthesized and the original strands. The temperature again must not be s~ high as to separate (denature3 the extension product fiom its template, as descnbed above. Hybridization rnay occur duIing this step, so that the previous step of ~ ~;
cooling after denaturation is not required. ln such a case, using simultaneous steps, the `
25 prefe~red temperature range is 50-70~.
The heating and cooling steps involved in one cycle of strand separation, hybAdization, and extension p~duct synthesis can be repeated as ohen as needed to produce the desired quantity of the specific nucleic acid sequence. The on!y lin~tation is the amount of the pIirners, thennostable enzyme, and nucleoside triphosphates3û present. Usually, from I5 to 30 cycles are completed. For diagnostic detection of amplified DNA, the number of cycles will depend on the nature of the sample and the sensitivity of the detection process used after amplification. If the sarnple is a complex mixture of nucleic acids, more cycles will usually be required to amplify the si~nal sufficiently for detecdon. For general amplification and detection, ~e process is 35 repeated about lS times. When arnplification is used to generate sequences to be detected with labeled sequence-specific probes and when human genornic DNA is the target of amplification, the p-rocess is usually repeated lS to 30 times to amplify the , WO ~2/0~2U~ 2 0 ~ ~ ~17 ~'Cr/~S91/0707tj ~

sequence sufficienlly that a clearly desectable signal is produced, i.e., so that backgroulld noise does not interfere with detection.
I~.lo additional nucleotides, primers, or therrnostable enzyrne need be added after the initial addition, provided that no key reagent has been exhausted and that the S enzyme has not become denatured or irreversibly inactivated, in which case additional polyrnerase or other rea~ent would have to be added for the r~action to continue. After the appropriate number of cycles has been completed to produce the desired amount of the spe ific nucleic acid sequence, the reaction nLay ~e halted in the usual manner, e.g., by inactivating the enzyrne by adding EDTA, phenol, SDS, or CHC13 or by separating the components of the reaction.
The amplification process rnay be conducted continuously. In one embodiment of an automated process, the reaction m~s~re may be temperature cycled such that the temperature is progTammed to be con~olled at a certain level for a certain time. One such instrument for this purpose is the automated machine for handling the amplification reaction developed and mar}~eted by Perkin-Elmer Cetus Instruments.
Detailed instructions for carrying out PCR with ~e instrument are available uponpurchase of the instrument.
~f DNA polymerase is very useful in the diverse p~cesses in which amplification of a nucleic acid sequence by ~:le polymerase chain reaction is useful. The amplificadon me~hod may be utilized to clone a par~cular nucleic acid sequence for :
- inser~on into a suitable expression vector, as described in United States Patent No. .

4,800,159. The vector may be used to transf~m an appropriate host organism to produce the gene p nduct of the sequence by standard methods of Iecombinant DNA
techndogy. Such cloning may involve direcf. ~gation into a vector using bluni-end ligation, or use of restrietion enzymes to cleave at sites contained ~thin the primers or amplified target sequences. Other processes suitable for Taf polymerdse include those described in United States Patent Nos. 4,683,194; 4,683,195; and 4,683,202 and European Patent Publica~on Nos. 229,701; 237,362; and 258,017; these patents andpublications are incorporated herein by reference. In addition, the present enzyme is ~:
useful iD asyn~netric PCR (see Gyllensten and Erlich, 1988, oc. ~2~. ~. Sci. :
- USA 8S:7652-7656, incolporated herein by reference); inverse PCR (Ochman et al., 1988, enetics ~:621, incorporated herein by reference); and for DNA sequencing (see I mis et a1., 1988, Pr~c. ~EL. ~Ld. ~. ~ ~5:9436-9440, and McConlogue et al., 1988, ~. ~ B~. 16(20):9869). ~ polymerase is also believed to have reverse transcriptase activity, (see PCI publication WO 91/09944, which is incorporated herein by reference), and 5'~3' exonuclease activity ~also known asstructure dependent single strand endonuclease (SDSSE) activity).

, . ~, .. . . .
,;, ~, . . . . .
, ':
,,, . ~ . . .. .

wo 9~/062n2 PCT/US91/07076 209?~3~ 32 The reverse transcnptase activity of the Taf DNA polymerase permits this enzyme to be used in methods for hanscribing and amplifying ~NA. The improvementof such methods resides in the use of a single enzyme, whereas previous methods have required more than one enzyme.
S The improved methods comprise the steps of: (a) combining an RNA template with a suitable primer under conditions whereby the primer will anneal to the corresponding RNA template; and (b) reverse transcribing the RNA template by ~ncubating the annealed primer-RNA template rn~xture with ~a~ DNA polyrnerase under conditions sufficient for the DNA polyme[ase to catalyze the polymerization of deoxyribonucleotide triphosphates to form a DNA sequence complementary to the sequence of the RNA template.
In ano~er aspect of the above method, the primer which anneals to the RNA
template may also be suitable for use in a PCR amplification. In PCR, ja second primer which is complementary to the reverse transcribed cDNA strand provides a site for initiation of synthesis of an extension product. As already discussed above, theDNA polymerase is able to ca~alyze this extension reaction on the cDNA template.In the amplification of an RNA molecule by ~ 3~ DNA polym~ase, the first extension rea~tion is reverse transcription, and a DNA st~and is produced as an RNA/cDNA hybrid molecule. The second extension reaction, us~ng the DNA strand asa template, produces a double-s~anded DNA rnolecule. Thus, syndlesis of a complementary DNA s~and ~m ar~ RNA template with Taf DNA pol~nerase pIovides the star~ng material for amplificadon by PCR.
When Taf DNA polymerase is used foI reverse transcripdon from an RNA
template, buffers which contain Mn2+ may provide improved s~nulation of ~ reve~se transcriptasé activity compared to Mg2+ - con~uning reve~se transcription buffers.
Consequently, increased cDNA yields may also result f~om these methods.
As stated above, the product of RNA reverse ~ranscription by T~f DNA.
polymerase is an RNA/cDNA hybrid molecule. The RNA can be removed or separated from the cDNA by heat denaturation or any number of other known methods including alkali, heat or enzyme treatmenL The remaining cDNA strand then serves as a template for polyme~izatibn of a complementary strand, thereby providing a means for obtaining a double-stranded cDNA molecule sui~able for amplification or other manipulalion. The second strand synthesis requires a sequence specific plimer and Taf DNA polymerase.
Following ~he synthesis of the second cDNA strand, the resultant double-stranded cDMA molecule can serve a number of purposes including DNA sequencing, amplification by PCR or detecdon of a specific nucleic acid sequence. Specific primers useful for arnpli~lcation of a segrnent of the cDNA can be added subsequent to the uo 92/n620 2 ~ 7 Pcr/vs9~/o7o76 reverse transcription. Also, it may be desirable tO use a first set of primers tv synt'nesiæ a specific cDNA molecule and a second nested set of primers to amplify a desired cDNA segment. All of fhese reactions are catalyzed by Taf DNA polymerase.
T DNA polymerase may also be used to simplify and improve methods for

5 detection of RNA target molecules in a sarnple. In these methods, Taf DNA
polymerase catalyzes: (a) reve~se transcIiption; (b) second strand cI)NA synthesis;
and, if desired (c) amplification by PC~R. The use of :I~ DNA polymerase in the descTibed methods elirninates the previous requirement of two sets of incubalio n conditions which were necessary due to the use of different enzymes for each step.
10 The use of Taî DNA polymerase provides RNA reverse trarlscription and amplification of the resulting complementary DNA with enhanced specificity and wi~h fewer steps -~
than previous RNA cloning and diagnostic methods. These methods are adaptable for use in laboratory or clinical analysis, and kits ~or making such analysis simple to per~orm are an important aspect of the preser invention.
The E~NA which is reverse trdnscribed and amplified in the abo~e methods can be denved ~rom a number of so~ces. The RNA template may be contained within a nucleic a id preparation f~rn an organism such as a viral or bactelial nucleic acid preparation. The preparation may contain cell debris and other components, purified total RNA ~r puIified mRNA. The RNA template may also be a popula~ion of 20 heterogeneous RNA molecules in a sample. ~urthermore, the target RNA may be contained in a b:ologi~al sarnple, and the sample rnay be a heterogeneous sample in which RNA is but a small pof~on thereo Examples of such biological samples ~ --include blood samples and biopsied tissue samples.
Although the primers used in the rever ~e transcliption step of the above 25 methods are generally completely complementary to the RNA template, they need not be. As in PCR, not every nucleotide of the pnmermust be complementary to the template for reverse transcnption to occur. For exarnple, a non-complementary nucleotide sequence m~y be present at the S' end of the primer with the remainder of the pr~mer sequence being complementary to the RNA. Alte~natively, non-complementary30 bases can be interspersed into the primer, provided that the primer sequence has sufficient complementarity Wit;l the RNA template for hybridization to occur and allow synthesis of a complementary DNA strand.
The structure dependent single s~randed endonuclease (SDSSE) activity of Taf l:)NA polymerase I may limit the amount of pToduct produced by PCR? thus creating a 35 plateau phenomenon in the no¢mally exponential accumulation of product. The SDSSE
activity may also lirnit the size of the PCR product produced and the ability to generate PCR product from (:;C-rich target template. However, SDSSE activity can also be ,, . ~
,,; -:: .. .. . . ..
..,.. ~ .

;;

.

wo 9~/0620~ PClt'~lS91/07076 ~92~ 34 helpful; see PCr Publicanon No. ~, based on PCr Application No. 91/05591, filed August 6, 1991, and incorporated herein by reference. SDSSE activity relates to the hydrolysis of phosphodies~er bonds. SDSSE activity generally excises 5' ~erminal regions of double-s~nded DNA, thereby releasing 5'-mono- and oligonucleotides.
S The preferred substrate for the SDSSE activity is displaced single-stranded DNA, with hydrolysis of the phosphodies~er bond which occurs between the displaced singie-stranded DNA and the double-s~anded DNA. The cleava~e site is a phosphodiester bond in thç double-stranded r~gion.
Site-directed mutagenesis or deletion mutagenesis rnay be utilized to eliminate 10 the SDSSE activity of a polymerase having such activity. For exarnple, a site-directed mutation of G to A in the second position of the codon for Gly at residue 46 in the Taq DNA polymerase coding sequence has been found to result in an approximately >1,000-fold reduction of SDSSE activity in the protein encoded by the sequence with no apparent change in polyrnerase activity, processivi~ or extension rate. This site-15 directed mutation of the a~9. DNA polyme~se nucleotide sequence results in an aminoacid change of Gly (46) to Asp. Glycine 46 is conserved in ThermQ~h~ africanus DNA polymerase, but is present at codon 37, and the same Gly to Asp mutation would have a similaI effect on E~ SDSSE activity.
Gly 46 is found in a conserved AVYGF sequence domain in ~ DNA
20 polymerase; the sequence AVY~ 3L contains ~e IGly (37) of T~ DNA polymerase.
Changing the glycine ~o asparhc acid within this conser~ed sequence domain will reduce or eli~ate the SDSSE activity. In addition, a deletion of all amino terrninal amino acids up to and including the glycine in the AVYGF~ domain will also reduce or eliminate the SDSSE activi~ of any ~errnostable DNA polymerase having this 25 sequence doma~n, including the DNA polymerase of Taf.
One property found in the ~f- DNA polymerase, but lacking in native ~a DNA
polyrnerase and native Tth DNA polymerase, is 3'~5' exonuclease activity. This 3'~5' exonuclease activity is generally considered desirable in certain applications, because rnisincolporated or unmatched bases of the synthesized nucleic ~cid sequence 30 a~ eliminated by this activity. Therefore, the fidelity of PCR utilizing a polymerase with 3'~5' exonuclease activity (e.g. Taf DNA polymerase) may be increased. The 3'~5' exonuclease activity ~ound in Taf DNA polymerase also decreases the probability of the fonnation of primer/dimer complexes in PCR. The 3'~5' exonuclease activity in effect prevents any extra dNTPs from attaching to the 3' end of 35 the primer in a non-template dependent fashion by removing any nucleotide that is attached in a non-template dependent fashion. The 3'~5' exonuclease activity caneliminate single-str~ded DNAs, such as primers or single-s~anded template. In ~ ;

' , . ' .

wo 9Z/1)6202 2 ~ 3 2 317 Pcr/~ls~l/o7o76 essence, every 3'-nueleo~de of a single-s~nded primer or template is treate~ he enzyme as unmatched and is therefore deg~ded. To avoid pr;mer degrada~ion m PCR,one can add phosphorothioate to the 3' ends of the plimers. Phosphorolhioate modi~led nucleo~ides are more resistant to removal by 3'~5' exonucleases.
S "~omain shuffling" or construction of "thermostable chirneric DNA
polymerases" may be used to provide thermostable DNA polyrnerases containing novel properties. For example, substitution of the ~af DNA polymerase coding sequence comprising tne 3'~5' exonuclease domain for the Thermus ~ DNA
polymerase I codons 289~22 would yield a novel thermostable DNA polyrnerase containing the 5'~3' exonuclease domain of ~g DNA polymerase tl-289), tne 3'~5' exonuclease dorn~un of ~ )NA polyrnerase, and the DNA polymerase dom~un of DNA polymerase (423-832). Alternadvely, the 5'~3' exonuclease domain and the 3'~S' exonuclease domain of Taf DNA polymerase may be fused to the DNA
polymerase (dNTP binding and primer/template binding domains) portions of ~9, DNA polymerase (ca. codons 423-832). The donors and recipien~s need not be limited to ~ and ~Lf DNA polymerases. T~ DNA polymerase p~ovides analogous domains as E~.g DNA polymerase. In addition, the enhanced/preferred r~verse ~ranscriptase -properties of Ttk DNA polymelase can be furthes enhanced by the addition of a 3i~5' exonuclease domain as illus~ated above.
While any of a variety of means may be used to generate chimeric DNA
polymerase coding sequences (possessing novel properties), a preferred method employs "overlap" PCR. In this method, the intended junction sequence is designed into the PCR primers (at their 5'-ends). Following the ini~al amplificadon of the individual domains, the vanous products are diluted (ca. 100 to 1000 fold) and combined, denatured, annealed, extended, and then the final forward and reverse primers are added f~ an otherwise standaTd P('R.
Ihus, the sequence tha~ codes for the 3'~5' exonuclease activity of Taf ONA
polymerase can be r-moved from Taf DNA polyrnerase or added to other pol rases which lack this acn~,~ty by recombinant DNA methodology. One can even rep.a~e, in a non-thelmostable DNA polymerase, t'ne 3'~5' exonuclease activity domain with thethermostable 3'~5' exonuclease domain of ~f polymerase. Likewise, the 3'~5' exonuclease activity domain of a non-thermostable DNA polymerase can 'oe used toreplace the 3'~5' exonuclease domain of Taf polymerase (or any otheT thermostable ~ -polyme~ase) to create a useful polyme~ase of the invention. Those of skill in the art rec~gnize that the above chimeric polymerases are most easily constructed by ~ ~ -recombinant DNA techniques. Si nilar chimeric poly;nerases can be constructed by ;` ~t ~ lr,: " " ~ , :.

', . ':,,. ' ' ' .

o 92/0~20~ 23~ PCl/US9~/0707 3~
deleting or by moving the 5'~3' exonuclease domain of one DNA polymerase tu anolher.
The following examples are offered by way of illustration only and are by no means intended tO limit the scope of the claimed invention. In these examples, all S pereen~ages are by weight if ~or solids and by vohlme if for liquids, unless otherwise no~ed, and all temperanlres are given in degrees Celsius.

rificanoQs~f Th~mQSiQkQ~i~UlS (Tafl PNA Polv~eras~ I
This example describes the isolation of Taf DNA polymerase I from Taf.
Taf cells are grown by the method of Huber et a!., supra. The culture of the Tafcells is harvested by centrifugadon after cultivation, in late log phase, at a cell density of 0.2 g to .3 g wet weight/1. Twenty grams of cells are resuspended in 80 rnl of a buffer consisting of 50 rnM Tris HCI pH 7.5, 0.1 mM EDTA. 'rhe cells are Iysed and the Iysate is centrifuged for two hours at 35,000 rpm in a Beckrnan Tl 45 rotor at 4C. The 15 supe~natant is collected (fraction A) and the protein fraction precipita~ng between 45 and 75% sanlration of ammonium sulfate is collected, dissolYed in a buffer consistin~
of 0.2 M potassium phosphate buffer, pH 6.5, 10 mM 2-mercaptoethanol, and 5%
glycerol, and finally dialyæd against the same buffer to yield frac~on B.
Praction B is applied to a 2.2 x 30 ~m column of DEAE-cellulose, equilib~ated 20 with the above described buffer. The colurnn is then washed with the same buffer and the fiactions contain~ng protein (de~nined by absorbance at 280 nM~ are collected.
The combined protein fraction is dialyzed against a second buffer, containing 0.01 M
potassium phosphate buffer, pH 7.5, 10 mM 2-mercaptoe~anol, and 5% glycerol, to yield fraction C.
l;raction C is applied to a 2.6 x 21 cm column of hydroxyapatite, equilibrated with the second buffer. The column is then washed and the enzyrne is eluted with a linear gradient of 0.01-O.S M potassium phosphate buffer, pH 7.5, containing 10 mM
2-mercaptoethanol and 5% glyceTol. Fractions containing DNA polymerase activity are com'oined, concentrated ~our-~old using a n Anicon stirred cell and YM10 membrane, 30 and dialyzed against the second buffer to yield fraction D.
Fqaction D is applied to a 1.6 x 28 cm column of DEAE-cellulose, equilibrated with the second buffer. The colunnn is washed and the polyrnerase is eluted with a linear gradient of 0.01-0.5 M potassium phosphate in the second buffer. The fractions are assayed for contaminating endonuelease(s) and non-specific exonuclease(s) by35 electrophoretically detecting the change in molecular weight of phage ~ DNA or supercoiled plasmid DNA after incubation with an excess of DNA polymerase (for .
~ . , -o ~i,0620~ 2 a 9 2 3 L 7 Pcr/~s9l/07076 ensionuclease) and after t~ea~nent of restliction enzyme cleaved DNA with the DNA
polyrnerase fractions (for exonuclease). Only those DNA polymerase fraetions having minirnal non-specific nuclease contarnination are pooled. To the pool is added autoclaved gel~tin in an amount of 250 llg/ml, and dialysis is conduc~ed against the S second buffer to yield Frac~ion E.
Fraction E l 1pplied to a phosphocellulose column and eluted with a 100 rnl gradient (0.01-0.8 M KCl gradient in 20 mM potassium phosphate buffer pH 7.5).
The ~ractions are assayed for contamina~ng endo/exonuclease(s) as described above as well as for polyinerase acdvi~y (by the method of Kaledin et al.) and then pOOled. The 10 pooled fractions are dialyzed against ehe second buffe~, and then concentrated by dialysis against 50% glycerol and the second buffer to yield the desired ~100 Icilodalton polyrnerase.

~xam~le 2 ~e~m~-Table 1 provides a list of primers used in Examples 2 and 3 along with the - -sequence identification number for each.
Tl~oughout the exarnples, A is Adenine; C is Cy~idine; G is Guanidine; T is Thymidine; Y is C+T (pYrimidine); S is G + C (S~ong interaction; t}~ee hydr~gen 20 bonds); W is A, + T (Weak interaction; two hydrogen bonds); N is A + C + G + T
(aNy); and R is G ~ A (puRine). ~ -..
".

.

, wo 9~/()fi2~ Q ~ 2 3 ~ ~ 38 PCT/~'S9l/07076 Tablel ~merSe~uçnces DGl~ SEQ ~ NO:3 5'-CGGAATTCCNGGYARRTTATC
DG145 SEQ ~ NO:4 5'-CGGAATTCCNGGYARRTTGTC
S DG146 SEQ ~ NO:5 S'-CGGAATTCCNGGRAGRl~ATC
DG147 SEQ ~ NO:6 5'-CGGAATTCCNGGRAGRTTGTC
DG148 SEQ ~ NO:7 5'-CGGAATTCGCNGTYTTYTC~CC
DG149 SEQ ~ NO~8 5'-CGGAATTCGCNGTYTTYTCSCC
DG152 SEQ ~ NO:9 5'-CGAGATCTGARGCNGAYGA'rGT
DG153 SEQ ~ NO:10 S'-CGAGATCTGARGCNGAYGAC~T
DG154 SEQ ~ NO:ll 5'-CGAGATCTACNGCNACWGG
DGlSS SEQ ~ NO:12 S'-CGAGATCTACNGCNACSGG
DG156 SEQ ~ NO:13 5'-CGAGATCTCARAAYATHCCWGT
DG157 SEQ ~ NO:14 5'-CGAGATCTCARAAYATHCCSGT
DG160 SEQ ~ NO:15 5'-CGGAATTCRTCRTGWACCTG
DG161 SEQ ~ NO:16 5'-CGGAATTCRTCRTGWACTTG
DG162 SEQ ~ NO:17 5'-CGGAATTCRTCRTGSACCTG
DG163 SEQ ~ NO:18 S'-CGGAATTCRTCRTGSACTTG
DG164 SEQDDNO:l9 5'-CGAGATCT~GMTAYGrWGAAAC
DG165 SEQ ~ NO:20 5'-CGAGATCTIGGNTAYGrWGAGAC
DG166 SEQnDNO:21 S'-CGAGATCTIGGNTAYGTSGAAAC
DG167 SEQ ~ NO:22 5'-CGAGATCTGGNTAYGTSGAGAC
DG168 SEQDDNO:23 S'-CGGAATTCIGTYTCNACRTAWCC
DG169 SEQ ~ NO:24 S'-CGGAATTCGTYTCNACRTASCC
DG173 SEQ ~ NO:25 5'-CGGAATTCATYCKYTCSGC
DG174 SEQ~DNO:26 5'-CGGAATTCATRCGYTCSGC
DG175 SEQ ~ NO:27 5'-CGGAATTCATYCKYTCWGC
DG176 SEQ ~ NO:28 5'-CGGAATTCATRCGYTCWGC
DG181 SEQ ~ NO:29 5'-CGGAATTCNGCNGCNGTSCCYTG
DG1~2 SEQrDNO:30 5'-CGGAATTCNGCNGCNG ~ CCYTG
DG126 SEQDDNO:60 5'-CGGAATTCGCCCACATWGGYTC
DG127 SEQ ~ NO:61 5'-CGGAATTCGCCCACATSGGYTC
DG128 SEQ ~ NO:62 5'-CGAGATCTGGNGAYGAYC ~ ATG
DG129 SEQ ~ NO:63 5'-CGAGATCTGGNGAYGAYCCSATG
DG130 SEQ ~ NO:~ 5'-CGGAATTCATNGGRTCRTCWCC
DG131 SEQID NO:65 5'-CGGAATTCATNGGRTCRTCSCC
DG137 SEQ ~ NO:66 5'-CGAGATCTGARGGSGARGA

, . : , . .

:

~V09~/0620~ 2 ~ 9 ~ 317 PCr/~iS9l/07076 el-~onnnuçd ~merSe~
DG140 SEQ ~ NO:67 5'-CGAGATCTGCNCAYATGGAAGC
DG141 SEQ ~ NO:6B 5'-CGAGATCTGCNCAYATGGAGGC
S DG150 SEQ ~ NO:S~ 5'-CGAGATCTGTNTTYGAYGCWAA
DGl~l SEQ ~ NO:70 5'-CGAGATCTGTNTTYGAYGCSAA
DG158 SEQ ~ NO:71 5'-CGGAATTCACNGGDATRTTTTG
DG159 SEQ ~ NO:72 5'-CGGAA~TCACNGGDATRTTCTG
DG183 SEQ ~ NO:73 5'-CAATTCCT~ATTaCAAATTCGAAATTGACT- ~.
GGCGCGCGGCC(: GGGCGC;CCCC
MK131 SEQ ~ NO:745'-CCCGGATCAGGTTCTCGTC
MK143 SEQ ~ NO:755'-CCGCTGTCCTGGCCCACATG
A. oteinSe~u~omolQ~
To underscore the power of the degenerate PCE~ priming method of the 15 invention, info~nadon regarding the amino acid and DNA sequence homology between the the~rnostable DNA polymerases is provided below. Sirnilarity and identity are determined us~g Universiy of Wisconsin sequence analysis prograrns (Devereux et al.,1984,Nuc.Acids~.12(2)387395).
AminoAcidHc~y ~ E.~oli :~
y ~Similanjy Ide~
1~ 100 60.8 41 E coli 60.8 41 1~ 1~
.ijl7 91.~ 84.1 62.S 41.9 :
7~5 93.5 86.7 59.6 40.4 T~ 6~.3 41.5 62.3 41.5 spsl7 83 ~;
~ 85 T~ 44.6 . . .
. :, '' ' ' ;' .
.

wo 9~0~202 Pcr/~s9l/o7o76 9?~3 ~rl B. Calc~lla7~i~n s)f Tm Tm is defined as the temperanlre at which half of the template is dissocia~ed from the pr~mer. The equation used for the calculation of Tm is denved from the thermodynarnic equation:
-RTln(kd) = H - T~S
where R is a constant, T is the temperature (in o kel~n), kd is the dissocia7~ion constant, H and S are the thermodynarnic values ~aken from Elreslauer et ~1., 1986, Proc. Natl.
~cad. Sci. ~ ~:374~3748. Rea~Tanging the equation:
T = H / (~S - 2.3Rloglo(Kd).
10 In the presence of primer excess7 the Tm is defined as:
Tm ~ H / (S - 2.3Rloglo[P]), where [P] is the concentration of primer.
The values of H and S taken ~rom Breslauer et al. define the Tm in the presence of 1 M NaCl. To co~ect for the conditions of the PCR buffer (50 nM salt) 15 the following correction is made (taken from Dove et al., l.M.B. 5:35g (1966):
Tm(~2) - Tm(~ll) = 18.51 l0gl0(~
where ~1 and ~L2 are the ionic strengths of the b7~fer as defined by equation: ~ -~1 = 1/2 sum ~mZ2).
With ~he equations above, one can c31culate the Tm for the pnmer pools used in 20 the degenerate pIiming with respect to either E3~ or Taf DMA polymerase I gene sequences. The Tm for vanous pools are shown below; "all" refers to the total primer pool at a concentra~on of 250 nl!~, whe~eas "exact" takes imo account the exact concentration of the most completely complementary plimer in the pool. The concentration of the most complementary plimer is the total concentration divided by 25 the degeneracy of the pool. Lower case letters indicate a base pair mismatch ~elative to the X~ sequence. The pnr,ners were designed to be complementary to the ~mde~lined regions; 5' sequences ineorporate restriction sites to facilitate cloning of the amplified fragment.
Forward 30 TAQ CGGGCTACGAGGCGGACGA~T
DG152 CGaGaTctGARGCNGAyGAtGT
DG153 CGaGaTctGARGCNGAyGACGT
CONSENSUS CGaGaTctGARGCNGAyGAyGT
TAF AAGGCTTTGAAGCTGATGACAT

' ' , ' ' , ' ' , W09~062~2 2 9 9 2 3 ~ ~ PC~ S~ 7076 Calculated Tm ~ E~
1'aq 73C 65C
~ 56C ~7C

REVE~SE
TAQ CTTGACCCC~GGA~G~TTGTC.
DG144 CggaAttCCNGGyARRTTaTC
DG145 CggaAttCCNGGyARRTTGTC
DG146 CggaAttCCNGGrAGRTTaTC
10 DG147 CggaAttCCNGGrAGRTTGTC
CONS CggaAttCÇ~GGn~RRTTrTC
TAF TTTAACT~CTGGGATATTA~

~1 Exac~
~a 68C 57c ~ S3c s2c ', ' , , . . .

WO'~ 620~ PCT/~;S~l/07076 3 ~ 42 FORWARD
TAQ GGAGGCGGG~ C~G~AG~Ç.
DG164 cGAGatctGGNTAyGT~IGAaAC
DG165 cGAGatctGGNTAyGTwGAGAC
DG166 cGAGatctGGNTAyGTSGAaAC
DG167 cGAGatctGGNTAyGTSGAGAC
CONSENSUS cGAGatctG~ay~çaB~
TAF GGAAAAAAG~a5~3aS~

~11 E~act Taf 47C 3~C

REVERSE
TAQ ACCAGCTCGTCGTGGACCTG
lSDG160 cggAatTCRTCRTGwACCTG
DG161 cggAatTCRTCRTGwACtTG
DG162 cggAatTCRTCRTGSACCTG
DG163 cggAatTCRTCRTGSACtTG
CONSENSUS cggAatT~cBT~AcyTG
20TAF ACTAAC~

ALl E~s~

Taf 62C 53C

FORWARD
TAQ AGACGGCC~S99 DG154 cGAgatCtACNGCNACwGG
DG155 cGAgatCtACNGCNACSGG
CONSENSUS cGAgatCtACNG~a~GG

.
, -- , W092/062~)~ 2 ~ 9 2 3 1 7 PCT/~S91/07076 ~S~

~ 40C 29C

REVERSE
TAQ ATGAGGTC~CGGCG~TG~CC~ -DG181 cgGAatTCNGCNGCNGTSCCyTG
DG182 cgGAatTCNGCNGCNGTwCCyTG
CONSENSIJS cgGAat~.~9C~9b~e~C.. 1 T~FATTATATCAGCTGCTGTTCC~G

Calculated Tm ~Ll E~ ~

~ 71C 58~C

C.5 Standard 2- and 3-temperatu~e profiles were used ~or screening degenerate -primers on IZ05 and Tspsl7 (see U.S. Patenl: application Nos. 590,213, filed September 28, 1990, and 590,466s filed September 28, 1990, both incorporated herein by reference). However, it was noted early in the work with Taf that the standard 20 profiles wer~ inadequate. Figure 1 shows a variety of temperature profiles. Figure 2 shows the effect of temperature profile on ~e amplification of a puri~ed DNA
~agmenL Amplification of Taf ch~omosornal DNA with the degenerate prirner pools DG154-DG155 and DG160-DG164 generatecl the pattern shown in lane 4 (Figure 2).
The high molecular weight band is the desired fragment (later confirmed by cloning and 25 I)NA seq~lence analysis). The lower molecular weigh~ bands and the general ethidiurn bron~ide stain~ng background represent nonspecific amplification which potentially might mask specific amplification products as well as interfere significantly with cloning of the desired band.
The desired band was pulified ~om an agarose gel and reamplified using 30 temperature profiles 2-5 (Figure 1 and lanes 5-8 of Figure 2). Standard 2-ter ~rature profiles (lanes S and 6) were inadequate in genera~ng arnplification of the pumied band. It appeared that arnplification of the small amount of contarr~inating lower molecular weight bands predominated. In contrast, temperature profile S (Figure 3), in which the standard plateau a! the lower temperature was replaced by a S minute ramp ~ . , ,, :

wo 9~/062~' PCr/U~91/07076 ~,3 ~

extending be~een the lower temperature and 75C, produced the desired band as the predominant product.
Complex tempera~ure profiles were applied to the screening of degenerate primer pools with ~he Taf chromosomal DNA as shown in Figure 1. Generally, S
series of amplifica~ons were performed with many primer pairs. For profiles 1 and 2, an initial S cycles of amplification were performed in which a low temperature point was programmed (40C and 45C, respecnvely) followed by 25 cycles in which the low temperature was progra}nrned at 50C. In profile 3, 30 cycles were performedwith the low temperature prograrnrned at 50C. Profiles 4,5 and 6 increased the low temperamre point by 5C each and mcreased the cycle number by 5 or 10 cycles.
Measurement of in-tube-ternperature showed that ~he te,nperature in the tube reached 1 to 2C above the low temperature setting.
D. ~aa~
Amplification products were obtained from PCR amplification of Taf DNA
using the primers ~sted below. Each arnplification yielded products of a molecular weight equal to or greater than that obtained from amplification of ~g DNA using the same degenerate pIimers. Misrnatches '~etween the Taf sequence and the degenerate primers are shown counting ~om the 3' end of the primer.
DGlS2-DG153 with DG144-DG147 -2 (DG152-DG153) and -7 (DG144-DG147) DG152-DG153 witn DG148-DG149 -2 (DG152-DG153) and -4 (DcJl48-DGl49) DG154-DG155 with DG160 I:)G163 -8 (DG154-DG155) DG154-DG155 with DG173-DG176 -8 (DG154-DG155) and-2,-12 (DG173-DG176 DG154-DG155 with DG181-DG182 -8 (I)G154-DG155) DGl5~DG157 with DG168-DG169 -1,-2,-B (DGl5~DG157) -DG164-DG167 with DG160-DG163 -4,-5 (DG164-DG167) Magnesium concen~ation is known to aftect amplification efficiency. The optim~n magnesium concentration depended on 'ooth the template and the prirner sets used. With DG144-DG147 and DS3152-DG153 the optimum magnesium concentration was 3 mM with Taf chromosomal DNA. With the set DG154-DG155 and DG160-w~ 92/0620' 2 ~ 9 ? 3 :L 7 PCT/US~)l/070~6 D(~ 163 with Taf I: NA, the optimum was 2 mM. For the final buffer, 2 mM was standardly used.

This example presents a degenerate primer method used to isolate DNA
fragments that enco~e Taf DNA polymerase I. In this method, valious sets of forward and reverse pr~rners were used in the polymerase chain reaction. These prime~s were designed to various conserved motifs comprising the 5'~3' nuclease domain, the templatetprimer binding domain, tne dNTP binding domain, or the single-s~anded template DNA binding domain of polymerases of known ~nino acid sequence ( E. coli, r,~, and ~Q). P~imer sequences are proYided in ~he Sequence Listing sec~ion; Table 1 provides the identiflcation number for each primer. -Pairs of degenerate primers were screened using the sets of six profiles with the modified 5-minute ramp profiles as described in example 2. The amount of magnesium in the arnplification was found to e~fect the amount of PCR product amplified. The magnesium optimum depended both on the p~imer pairs chosen as well as the template.
For screening of the degenerate pnmer pools on Taf chromosomal DNA, an average magnesium concen~ation (2 mM) was chosen.
The PCR conditions thus consisted of 10 mM Tris, pH 8.3, 50 rnM KCl, 2 mM
MgC12, 200 IlM each dNTP, lO ng chromosomal DNA (at 4.7 x 106 base pairs per genome, or 5.2 x 1~15 g/genome, was equivalent to 3.2 x 10-14M genome), 50O nM
each oligo primer set, and 2.5-5 units I3q polyrnerase. A total of 16 pairs of primer pools were used, concentrating on sets to amylify the 5' and 3' end of the coding ~ -sequence of ~e polymerase 1 gene. Of the 16 sets screened,7 sets (DG152-DG153 with DG144-DG147, DG152-DG153 with DG148-DG149, DG154-DG155 with ' DG173-DG176, DG154-DG15~ with DG181-DG182, DG15~DG155 with I)G160-DG163, DG156-DG157 with DG168-DG169, DC;164-DG167 with DG16~1:)G163) produced discrete bands of a molecular weight equal or greater tO that of the I a.g product.
Four of the PCR products were selected and cloned (DG152-DG153 with DG148-DG149, DGl5~DG155 with DG181-DG182, DG154-DG155 witn l;)G160~
DG16~, DG164-D&167 with DG160-DG163). For cloning, the amount of the desired product was emiched. The PCR reaction products were extrac~ed with chloroform toremove the oil, ex~acted with phenoVchloroform to remove the ~ polymerase, etherextracted to remove residual phenol, and concentrated and desalted over a Biogel P-4 spin colu nn (marketed by Bethesda Research Laboratories). The preparations were .. . . .

.: '- ''' - ' ~ " ' ' :

wv 9~/0620?~3 ~ pcr/~91/07076 electrophoresed on a 3% low melting NuSieYe~ GTG agarose gel, and the desired band cut out. The DNA ~agrnent was isola~ed from the agarose by repeated phenol extractions, ether extractions, and desalting over a Biogel P-4 spin cohlmn.
The p~.~duct was then ~arnplified with the same primer sets used in the initial S generation using protocol 3 (Figure 3), in which the setting for the initial low-temperature was 50C. The oil was removed from the reactions by chloroform extraction~ the polymerase by phenol extraction, and residual phenol by ether extraction. Following desalting over a biogel P-4 spin column, the preparations were restricted with EcoRI and B~'III according to the manufacturer's specifications. These 10 sites were included in the incorporated primer sequences to allow for subsequeni cloning, as shown in Table 2. The res~iction enzymes were removed by phenol extraction, the sarnples concentrated and electrophoresed on a 3% low melting NuSteveTM GTG agarose gel. The target band was isolated as desctibed above.
Vector pBSM13+Hindm::B~lII was prepared by restricting plasmid with B~III
15 and EcoRI and dephosphorylating with bacte~ial aL~aline phosphatase. Protein was removed by extraction with phenoVchloro~o~m, and the prepara~ion desalted over aBiogel P~ spin column. Yector pBSM13+ (purchased from Stratagene) was used to rnake vector pBSM13~HindIII::B~lII by digesting vector pBSM13+ with restriction enzyme HindII[, blun~ng the ends of the digested Yector by Klenow lreatment, ligating 20 B~ II linkers (5'CAGATCIG~, ~ansforming host cells, and selecting transformants which contained a plasrnid identical to pBSM13+ but for the absence of a Hindm site and the presence of a ~g II site.
A sample of the purified fragment and prepared vector were ligated at 10C for 15 hours, transfo~rned into DG98, and a sample of the trasformed bacteria plated on -;
25 arnpicillin-containing agar plates. Ampicillin-resistant colonies were isolated, and crude plasrnid prepared. The correct clones were identified by comparing the size of the insert following restriction of the crude plasmid wit'n EcoRI and B~l~ with that of the initial PCR product, and comparing the digestion paKern of both the cloned insert with that of the initial PCR product using a variety of restriction endonucleases. Single-3û stranded DNA was prepared from selected clones and the sequence determined bystandard dideoxy sequencing me~hods. The arnino acid sequence deduced from the DNA sequence contained significant homology ~o known polymerase sequences, suggesting that the P~ products were in fact derived from a Taf polyrnerase gene.
This strategy resulted in the successful amplification and cloning of various 35 regions of the ~f DNA polymerase gene with the primer pairs shown in Table 2. The primers were designed to be complementary to sequences coding for the amino acidsequences shown; upstream sequences incorporate restriction sites used in the cloning , ~o 9~/0620~ 2 ~ 3 ~ 31 l PCT/U5~l/07076 of the arnplified producl. In Table 2, the amino acid sequence shown below the DNA
sequence for the reverse primer is given in the carboxy to amino direction and encoded by the corrnlement of the sequence. The pr~mers shown in Table 2 are characterized as follows.
Synthetic oligodeoxyr~bonucleotides DG148 and DG149 are two different 32-fold degenerate (each) 22 mer pools designed as "reverse" primers to one of the motifs in the 5' to 3' exonuclease dornain (3' most 14 nucleotides) of therrnostable DNA polyrnerases. The primers are designed to complement the (-~)-strand DNA
sequence that encodes the motif Gly-Glu-Lys-Thr-Ala and which colTesponds 10 identically to ~9 DNA polymerase an~ino acids 200 through 204 and to l th DNApolymerase amino acids 201 through 205. This motif is found in a DNA polymerase gene in all Thermus species. The combined primer pool is 6~fold degenerate and the primers encode an EcoRI recognition sequence at their 5'-ends.
Synthetic oligodeoxyribonucleotides I)G152 and DG153 are two different 15 l~fold degenerate ~each) 23 mer pools designed as "forward" primers to one of the mo~fs in the 5' to 3' exonuclease domain (3' most 14 nu-;leotides) of therrnostable DNA polyme~ases. This motif is the amino acid sequence Glu-Ala-As~Asp-Val and coqresponds iden~cally to ~ aQ DNA polymerase amino acids 117 through 121 and toTth DNA polymerase amino acids 118 thxough 122. This mo~f is found in a DNA
20 polymerase gene in all ermus species. The combirled primer pool is 32-fold degenerate and the pnmers encode a ~n recolgnition sequence at their 5'-ends.
Synthetic ~.igodeoxyribonucleoddes DG154 and DG155 are two diffe.ent ` -32-fold degenerate (each) 19 mer pools designed as "forward" primers to one of ,he motifs in t' primer:template binding domain (3' most l l nucleotides) of ~e~ostable ~A polyrilerases. This mo~if is ~e tetrapeptidle amino acid sequence Thr-Ala-Thr-Gly and corresponds identically to ~ DNA polymerase amino acids 569 thro n 572, and to Tth and ¢~ spec~es ZOS DNA polyrne~se amino aGids 571 through 574. This motif is found in a DNA polymerase gene in all Therrnus species. The combined `
pnrner pool is 64 fold degenerate and the primers encode a ~II recognition sequence `
30 at their 5'-ends.
Synthetic oligodeoxyribonucleotides DG~60 through DG163 are four different 8-fold degenerate (each) 20 mer pools designed as "reverse" primers to one of the motifs in the template binding doma~ns (3' most 14 nucleotides) of thermostable DlNA
polyme~ases. The plirners a~e designed to complement the (~)-strand DNA sequence35 that encodes the motif Gln-Val-His-Asp-Glu and which corresponds identically to Taq DNA polymerase arnino acids 782 through 786, and to Tth and ~Thermus species ZO5DNA polymerase amino acids 784 through 788. This motif is found in a DNA

. ` ~ , , , .
, wo g~/06~ Pcr/l,~s9 1 /07076 polymerase gene in all lllerrnus species. The combined primer pool is 32-fold de,,enerate and the primers encode an ~RI recognition sequence at their 5'-ends.Synthetic oligodeoxyribonucleotides DG 1~ through DG167 are four different 1 ~fold degenera~e (each) 22 mer pools designed as "~orward" primers to one of the S rnotifs in the template binding dornain (3' most 14 nucleotides) of thermostable DNA
polyrnerases. This rnotif is ~e pentapeptide amino acid sequence Gly-Tyr-Val-~lu-Thr and corresponds identically to ~E3.ÇI I)NA polyrnerase amino acids 718 through 722, to Tth and Thermlls species ZO5 DNA polyrnerase an~no acids 720 through 724. This motif is found in a DNA polymerase gene in most Eh~a~ species. The combined 10 prirner pool is ~fold degenerate and the primers encode a B ~lII reeognition sequence at their 5'-ends.
Synthetic oligodeoxyribonucleotides DG181 and DG182 are two different 256-fold degenerate (each) 23 mer pools designed as "reverse" plimers to one of the motifs in the template binding domain (3' most 17 nucleotides) of thermostable DNA
l S polymerases. The primers are designed to complement the (+)-strand DNA sequence that encodes the motif Gln-Gly-Thr-Ala-Ala-Asp and which corresponds identically to ~9, DNA polymerase amino acids 754 thrDugh 759 and to E~h DNA polymerase aIr~no acids 756 ~h~ough ~61. This motif is found in a DNA polymelase gene in all 'rh~nus species. The combined primer pool is512-folcldegenerateand the pIimers encode an20 EçoRI recognition sequence at their 5'-ends.

W(~9~/0620~ 2ag23l~ P~T/US91/07076 V ~
3 ~ u~ ) C t~ C t~ C ~ C ~:
h 3 ~ 3 ~
I ~ ~ ~ ~ W U ~ U U~ ~ UJ
:~ Z E~
V

~ v v v v ~
v v v v v ~ ~ ~
I u~ n , ",~, ,, ~:
I

¦ ~ ' L~ V V .' , 1 1 ~ ~
I a a I .~ ~,~;. , .
, I ~ V E~
r I to ~ ~ V ~ ~ V ~ V V V V V V
3 _1 æ
:~ V ~ ~ :~ V
rd æ ~ z ~ ~ h V V V
~5 V t!l V W V V ~
V V V V O V ,`

.. _ ~'~', ' ' . V ~
a a ~ I
2 ~ 'r , U~
I
V t~
a a : . : . . :
: / . , :, . . .: ..
:- , . , : ,. .. . :: ;. ~ .. :. ; ., .
': :i" .: : ' W O 92/0620' PCT/~S91/07076 ?J3~r~ 50 ~,~9 ~ C V C
V ~ ~ C ~ ~ V
~ ~ V
Z ~
r . ~ U~ q ~ ~ ~ ~ V
Z ~ Z
V ~ ~ V ~

v vv v v v ~ v c~ v ~- c ~ Q ~ ~

~ ~ ~ V ~ V
C!~ V V V V V V V
3 ~ ~ ~ g ~ ~ :
' .
~; ~ V~ V 0 V ~I V
~:
Q .C ~S Z ~ æ

!~ ,¢ ,¢ , C~ V C~ C~ ":

u~
Ln ~
a Ln 3 ~
n n , : . , : , ~ , ~ : :
: , ' - ' : ' .~', ' ~ , :, .

.

~O ~"/06202 2 ~ 9 ~ 3 ~ I PCI/i~591/07076 The entire coding sequence for Taf polyrnerase was then identified. Taf chromosomal DNA was digested with BarnHI, ~gJII, ~1~1, Eco~, HindIII, KpnI, PstI, SacI, and Sall according to the manufacturer's specifications and electrophoresed (with radioa~lively labeled ~_dIII-digested lambda DNA as a molecular weight marker) on a 0.7% agarose gel. The gel was acid nicked in 0.25 N HCI (30 rninutes), and transferred to HybondN-~lM nylon membrane (rnar~eted by Amersham) by capillary action in 0.4 N NaOH for 19 hours. The DNA was cross-linked to the membrane by irradiating with 50 mjoules by a St~atalirlkern4 1800 (rnarlceted by Stratagene) and treated with prehybridization buffer.
Radioactive probes were generated from the regions encoded 'oetween the prirner pairs DG160-DG163 and DG16~DG167, and DG144 DG147 to DG152-DG153. Initial PCR product was generated, confirmed by res~ic~ion analysis, and p~ified as desc~ibed above. Amplifica~ion was then repeated using a sample of t'ne purified PCR product as the template, and replacing tne dGTP in amplification with 50 IlM a-32P-dGTP. The oil was removed by chloroform extraction, the polymerase by extraction with phenoVchloroform, the sample concen~ated, and unincorporated label removed ~y desalting over a Biogel P4 spin column. The preparation was electrophoresed on a 3% low melting NuSieveD' GTG agarose gel, and the target ~ ~ -radioac~vely label~d band isolated as descAbed above.
The 3' end of the coding sequence for the polymerase gene was identifled by hybridizing the chromosomal blots with 3.6 x 106 cpm of probe TafDG160-DG163 to DG164-DG167 at 50C for 17 hours. The blots were washed ~wice with 2 X SSPE, 0.1% SDS at 23C for 10 to 25 minutes, then 1 X SSPE, 0.1% Sl:3S at 52C ~or 20 n~nutes and autoradiographed. Discrete bands hybridizing to the probe were identified and their mslecular weights determined by com~arison to the radioactively labeled lambda m~rkers. Thus, the 3' end of gene was located withirl the following fragments.

, WO 9~/0620~ PCI /I_;S~ I /07076 2~9'f~3-~ ~ 52 ~yme y~ w~f ~nent coneainin~ 3'end BarnHI 6,000 or 21,000 B~lII 2,330 ClaI 8,100 _._ EcoRI 4,900 or 6,800 HindIlI 5,350, 3,000 or 1,680 ~, 19,500 PstI 1,410 or 18,000 ~acI >23,000 ~I >23,~00 The poMon of gene encoding the S' end of the polymerase sequence was then identified. The 3' probe was removed by boiling the blots in 0.5% SDS, and the membranes hybndized to 3.0 x 106 cpm of Taf probe DG152-DG153 to DG148- -DG149 at 66C for 22 hours. The membranes were washed twice in 2 X SSPE, 0.1 %
15 SDS at 23C for 10 minutes and 1 X SSPE, 0.1% SDS at 65C for 30 minutes, andautoradiographed. The following fragmen~s were therefore identified as containing sequences that code for the 5' end of the polymerase gene:
~ , ~ 20,000 B~III 2,280 ~, ~laI 7,500 EcoRI 6,800 HindIlI 2~350 ~E_I 1, PstI 16,000 SacI 21,000 ~ ~23,000 From the ~o hybridization patterns, it was detem~ined that the gene contains both B~III and HindIIl sites. In addition, a 6,800 bp ~RI fragment contains sequences30 coding for both the 3' and 5' ends of ~e polyrnerase sequence.
The 6,800 bp ~RI fragment containing the en~re gene was then cloned from the chromosome. Taf chromosomal DNA (20 llg) was digested with EcoRI according to the manufacturer's specifications. 1 he completion of digestion was confirmed by electrophoresis of a sample on a 0.7% agarose gel, acid nicldng, ~ansferring to 35 HybondN+n' in 0.4 N NaOH, and probing with radioactively labeled ~ f PCR product extending between DG160-DG163 and DG164-DG167. The complete digest was size , ,~, ~ , .

WO ~)Z~0620~ 2 ~ 3 2 3 ~ 7 PCI/l,'S91/07076 ~3 ~ractionated by elect~oelution on a 0.5% SeaKem~ a~arose LE gel in TEA and frac~ions collected. The frac~ions containing the target ~JcoRI fragmen~ were identified by electrophresis on a 0.7% agarose gel, which was then acid nicked, transferred toHybondN~rM in 0.4 M NaOH, and hybTidized tO radioactively labeled ELf PCR product extendi. ~tween DGl60 DG163 and DG164-DG167. The fractions containing the

6,S00 bp ~çQRI fragment were pooled, concen~ated, and desalted over a Biogel P4 spin column.
Three vectors were prepared by digesting pBR322, pUC13, and pBSM13+HindlII :BglII with ~QRI, dephosphorylating with bacterial alkaline phosphata~se, extracting wi~h phenol/chloroform and then ethcr, and desalting vver a biogel P-4 spin column. The size fractionated material con~aining the 6,800 bp-EcoRI
fragrnent was ligated into the vectors, transfonned into DG9~, and the transfolmation rnixture plated onto ampicillin-containing agar pl:ltes.
Followir., g~wth at 37C for 16 hours, the colonies were lifted onto nitrocellulose filtels, Iysed with triton Iytic buffer, the DNA denan~red us~ng 0.5 M
NaOH, 1 M NaCI, neutralized with 0.5 M Tris, pH 8.0, 1.() M NaCl, linsed with 0.3 M NaCl, 10 mM Tris, pH 7.6, 1 mM EDTA, pH 8.0, and baked at 80C: for 3 hours.
The filters were incubated with prehybIidization buffer at 65C ~or 1 hour and hybridized with 4.4 x 10~ CPM of ~adioactively labeled ~ PCR product extending between I:~160-DG163 and DG164-I:)&167 f~r 15 hours at 50C. The filters were washed in S X SSC, 0.1 % SDS at 23C for 16 minuees, 2 X SSC, 0.1% SDS at 23C
for 30 minu~es, and au~oradiographed.
Pr~be positive colonies we~e inoculated into broth containing ampicillin and methicillin and grown at 37C. The colrect clones were identified by isolat ng plasmid DNA ~ollowed by restriction enzyme analysis. Clones containing a 6.8 kb insert were identified by rstriction with EcoRI. The correct clones were further idçntified by res~icuon analysis with ~adm, HindIlI and ~coRI or B~III, because it was de~rmined in the cnromosomal mapping t'nat the polymerase gene contained both Hindm and ~II sites.
For further confirrna~on, ~he restriction digeses of the suggested clones were electrophoresed on a 0.7% agarose gel, and the DNA bands transferred to HybondN+TM
and probed with raa: a~ively labeled Taf PCR product extending between I~G16 DG163 and DG164 DC~167, and subsequently with ~adioactively labeled Taf PC~
product extending between DG144 DG147 and DG152-DG153 as previously 3S described. Several clones were conf~rmed as correct (52-1, 52-2, 52-3, 52-6, 52-7, and 52-9).

WO 92/0~S20~ PCT/I~S91/07076 ~ 39~3 ~ 54 To facilitate sequencing and subsequent manipulation of the polymerase gene for the construction of expression vectors, a smaller 3,000 bp EcoRV fragrnerlt was subcloned from ihe larger 6,800 bp EcoRI fragmen~. Clone 52-1, containing ~he 6,800 EcoRI fragmen~ was digested with EcoRV, according to the manufacnlrer's S specifications, concen~ated, desal~ed over a biogel P-4 spin column, and electrophoresed on a 1% low melting NuSieven' GTG agarose gel. The target band was then purified as previously described.
For the vector, pBSM13~HindII[: BglII was restricted with ~I and dephosphorylated by bacterial aL~caline phosphatase. Tl~e protein was removed byphenoVchloroforrn extrac~ion, and ~he preparation desalted over a Biogel P-4 spin column. A sarnple of the vector and purified fragment was ligated with T4 DNA ligase and T4 RNA ligase at 23C ~or 7 hours, transformed into DG98 and the transformation rnixture plated on arnpicillin-containing agar pla~es. Ampicillin-resistant colonies were selected and grown in liquid broth, and crude plasrnid preparations isolated.
The size of the insert was deterrnined by restriction with ~RI and ~HI, which cut the vector on both sides of the ~_I site that contained the insert. The ~ -identity of the insert was fur~er confilmed by restnction with B~ II, a site previously ~ -detennined to be within the gene from the mapping of the cl~omosome (described above), EcoRI with ~I, and EcoRI wi~ Clones were identified which contained the polymerase gene in both o~ientations. The orientation that placed the coding sequence in position for expression fiorn the lac promoter was designatedpBSM:TafEcoRV.
:` :
xa~le 4 Construction of Therrnosipho af~icanus DNA Polvmerase I Expression Vectors The en~re Taf DNA polymerase I coding sequence can be isolated from Taf genomic DNA on an approximately 3 kb EcoRV fragrnent. This EcoRV fragment was isolated and cloned into the Stratagene~ vector pBSM13+, which had first been ` ~
digested with restriction enzyme SmaI. The resulting vector was designated - -pBSM:TaflEcoR~, and the orientation of the Taf gene EcoRV DNA fragrnent is such that the lac promoter, ribosome-binding site ~RBS), and ATG start codon for the coding sequence of beta-galactosidase from the pBSM13~ vector are positioned forexpression of the Taf DNA polymerase I coding sequence. The ATG start codon of the Taf DNA polyrnerase I coding sequence is about 20 bp from the EcoRV restriction enzyme recognition site, which is, in turn, about 84 bp from the ATG of the beta-galactosidase cading sequence.

":

- , '' ~ ', '' '`'' ' '~ "

wo 9~/0620~ 2 3 9 ~ 317 pcr/l-ls9l/û7o76 Oligonucleotide site-directed mu~genesis was then used ~o alter the carboxy te~inus encoding region of the ~ DNA polymerase I codin~ sequence in plasmid ~ TafEcoRV. Single-s~randed plasmid DNA was prepared by infecting a log pn~se culture of DG98 harbonng the plasmid wi~h helper phage R408. Single-stranded S DNA was recovered and purified via elec~oelution. Gapped-duplex DNA was formedbetween the singl~-stranded pBSM:Ta~oRV and the large PvuII ~ragment of vector pBSM13+, and then the gapped duplex was annealed with mutagenic oligomer, eitherDG233 or DG234. Extension and ligation of the reactions contai ung mutagenic oligomers annealed to gapped duplex was perfonned, and the rn~xtures were 10 tlansformed into DG101. Transfonned colonies on nitrocellulose filters were screened by hybridization with ~-32P-labeled oligomer DG235. Mini-screen DNA prepared from positive single colonies was analyzed by restriction analysis tv confilTn the presence of a new ~HI site, loss of a B,~III site, and the appropriate PvuII pattern.
DNA sequence analysis conf~ned the mutagenesis.
The sequences of the mutagenic and p~obe oligomers are shown below.
DG233 SEQIDNO: 31 5'-GCGAAl-rCGAGCI'CGGTACC-GGATCCI CAl'rCCCACI C~CC
DG234 SEQIDNO: 32 5'-CCI~l'rACCCCAGGATCC~C~T-TCC(~ACI Cl7rl'rCC , 20 DG235 SEQIDNO: 33 5'-GATCCTCATICCCACIC
Mutagenesls with DG233 changed dle TAA stop codon to TGA, created a ~II restriction site imrnediately following the new TGA stop codon, and deleted Taf and ve~or sequences to the ~p_I site in the polylinker of the vector, a deletion of 213 bp. One of the c~rrect mutants from the DG233 mutagenesis was designated pTaf~l.Mutagenesis with DG234 changed the T~A stop codon to TGA and created a new ~3~HI site directly downstream of the TGA stop, bu~ deleted no Taf or vectorsequences downslream of the ~lI site. One of the coIrect mutants from the DG234 mutagenesis w~s designated pBSM:TafRY3' and can be used to construct expression vecto~s illus~ated with pTaf~l, bei~
Oligonucleotide site-diIected mutagenesis was used to alter the 5'-end of the Taf DNA polymerase I gene in pTaf~l. Mutagenesis was as described above, using mutagenic oligonucleotide DG248 to insert an ~I res~iction site at the ATG start of the T~f DNA polymerase I coding sequence and to delete vector and Taf sequences to rnake the la~Z ATG start codon the start codon for the ~ DNA polymerase l coding35 sequence. Transformed colonies on nitrocellulose filters were screened by hybridization ~nth ~-32P-labeled oligonucleotide DG237. The sequences of the mutagenic ~nd probe oligont~ers are shown below.

.

.

wo 92/0620' P(~/l'S~1/07076 2~i323~ 56 DG248 SEQ Il:) NO: 34 5'-CAAATAGAAACATCI'I~CCC-ATGGCI GITI CCIGTGTGAAA~TC;
DG?37 SE(2 ID NO: 35 ~'-GAAACAGCCAT&~iGAAAG
Mini-screen DNA prepared from positive colonies was subjected to restnction S analysis to conf~n the presence of the new NcoI site and the deletion. DNA sequence analysis was also performed to ensure that the correct sequence was obtained. The correct plasmid was designated pTaf~)2. IPIG-induced cultures harboring pTafO2 expressed heat-stable polymerase activity at 24 units per mg crude extract protein (where a pBSM13~ control culo~re was 0.04 units ~r mg crude extract protein, and the pBSM:TafEcoRV culture was 6.5 units per mg crude ex~act protèin).
I he 2.7 kb Nc~I-BamHI DNA fra~nent comprising Ihe Taf DNA polymerase I
coding sequence in pTafO2 was cloned into four PL expression plasmids, pDG182-pDG185, which had been digested with NcoI and BamHI. Plasrnids pI)G182 and pD(:~184 are derivatives of pDG160, and pDG183 and pDG185 are deIivatives of pD~161. The construction of plastnids pDG160 and pDG161 is described in Example 6 of Serial No. 455,967, fîled December 22, 1989, the entire disclosure of which is incorporated herein by ~eference. The prefeiled host for such expression vectors is E.
coli K12 stra~n DG116, and culture of the host cells and induction of expression is carried out as described in Example 7 of Serial No. 455,967.
To construct exp~ession vecto~s pDG182-pDG185, plasn~ids pDG160 and pDG161 we~e digested with restriction enzymes ~s2I and KpnI, and ~e smaller of the resul~ng two fragments was replaced with a duplex adaptor linker, either FIA2/E;LA3 or PlA4/FLA5, and the vector Tecirculalized by ligation. The sequence of ~e duplex adaptor linkers FIA2 (SEQ. Il~ NO: 36); ~A3 (SEQ. ID NO: 37); FL44 (SEQ. ID
NO: 38); and FIA5 (SEQ. ID NO: 39) aIe shown below.

:., ;' W09~/~6202 2 ~ ~ ~ 3 ~ 7 PCT/US91/07076 ~ 2~3 5'-CCGGAAGAAGGAGAAAATACCATGGGCCCGGTAC-3' 3'-TTCTTCCTCTTTTATGGTACCCGGGC-5' 5'-CCGGAGGAGAAAATCCATGGGCCCGGTAC-3' 3'-TCCTCTTTTAGGTACCCGGGC-5' The following table describes the properties of plas~uds pDG1~2-pDG185.
Oligonucleotide Duplex Vector AmpR or TçtRRBS Site at Al'G Cloned into pD~3160 orPDG161 10pDG182 Amp T7 ~ NcoIFIA2/FLA3-pDG160 pDG184 AITIP N NcoIFL44/E;L45-pDG160 pI:)G183 Tet T7 NcoIFIA2/E~LA3-pDG161 pDG185 Tet N NcoIE;IA4/FlA5-pDG161 ~ -In ~ddition to the features tabula~ed a~e,dle ~- :)G182-pDG185 veetors also contain ~ :
~e ~tQxin positive retroregulator from Bacilh,ls ~jgDÇ~ and point muta~ions in the RNA D[ gene which rende~ the piasmids temperature sensitive for copy number.Deri~atives of pDG182-pDG185 containing the 2.7 kb NcoI to Bam~ -~agment are pTafO3 (from pDG182), pTafO4 (from pDG183), pTafO5 (from ;~
pI3G184), and pTaf~6 (from pDG185~. These plasmids produce ~Lf DNA polymerase I ac~nty when expression is induced.

About 1.25 units of the Ta~ DNA polymerase purified in Example 1 is used to amplify sequences fcom th genomic DNA. The reaction volume is 50 111, and the reaction mixture contains 50 pmol of primer DG73, 105 to 106 copiss of the Tth genome (-~ x 105 copies of genome/ng DNA3, 50 pmol of primer DG74, 200 ~lM of each dNTP, 2 mM MgC:12, 10 mM Tris-HCl, pH 8.3, 50 mM KCl, and 100 geladn (optionally, gelatin may be omined).
The reactic- s calTied out on a Perkin-Elmer Cetus Ins~nents DNA Ihermal Cycler. Twenty tG .nirty cycles of 96C for 15 seconds; 50C for 30 seconds, and 75C .- -for 30 seconds are carried out. At 20 cycles, the amplification pr~duct (160 bp in size) can be faintly seen on an ethidium blomide stained gel, and at 30 cycles, the product is readily visible (under W light) on the eithidium bromide stained gel ,, . ~ .
': , "'' ' , .

~vo 1)~/0620~ PCr/US91/07~76 ~9~3~7 58 The PCR may yield fewer non-specific products if fewer units of Taf DNA
polymerase are used (i.e., 0.31 units/50 ,ul reaction). Furthermore, the ~ddi~ion of a non-iomc deterent, such as laureth- 12, to the reaction m~7ttu~e tO a final concentratiorl of 1% can improve the yield of PCR produc~
Primers DG73 and DG74 are shown below:
DG73 SEQIDNO: 40 5'-TAC&TTCCCGGGCCI~GTAC
DG74 SEQIDNO: 41 5'-AG(3AGGTGATCCAACCGCA
~ .
Expression ~f mo~i~ed ~f~
In an effort to increase the expression levels, site specilSc mutagenesis was perfo~rned to (1) remove the predicted haupin structure t^rom codons 2 to 6 of the coding sequence; and ~2) change cc~ons 2, 5, 6, 7, 9, and 11 to codons used morecommonly ~n E. ~, than the codons present in the native sequence. Mutage ~ic pnmers, FR404 or F~405, each conta~ning a modified sequence were synthesized andphosphorylated. The msdified codon 9 and codon 10 form a KpnI site. Single-stranded pTaf~2 was prepared by coinfecting a log phase culture of DG101 containing -~
the plasmid with ~he helper phage R408, commerci~lly available ~om St~tagene. A
"gapped duplex" of single stranded pTa~2 ancl the large ~agment from the ~II
digestion of pBSM13+ was created by n~ixing the two plasmids, heating to boiling for ~ `
2 minutes, and conling to 65C for 5 minutes. Mutagenic primer FR404 or FR405 was then annealed with the "gapped duplex" by mixing, hea~ng to 80C ~or 2 rninutes, and then cooling slowly to room tempe~ re. The remaining gaps were filled by extension with Klenow and the fragnnenes ligated with T~ DNA ligase, both reactions taking place in 200 ~LM of each dNTP and 40 ~lM ATP in standard salts at 37C for 30 minutes.The resulting circular fragrnent was tr~nsformed into DG101 host cells by plate transfoImations on ni~cellulose filters. Duplicate filte~s were made and the presence of the correct plasmid was detected by probing with a ~2P-phosphorylated probe;
FR401 was used to screen for the product of mutagenesis with FR404 and FR399 wasused tO screen for the product of mutagenesis with FR405. Mini-screen DNA prepared from positive colonies was subjected to res~iction analysis tO confi~n the presence of the ~QI site from pTafO2 and the introduced KpnI site, after which the DNA sequence was conf~nned. Two expression vectors were produced by the above protocol; the vector created using ~R404 was designated pTa~07 and the vector created using FR405 was designated pTafO8.
The oligonucleotide sequences used in this exarnple are listed below.

.. . ..

.' . , ,, . :; : ' ' wo ~z/0620~ 2 ~ ~ 2 3 :l 7 PCr/~ 1/07076 FR399 SEQlI) NO: 4~ 5'-TAAGATGTTCTTGTTC
FR401 SEQ ~D NO: 43 5'-TAAGATGTTCCTGTTC
FR404 SEQIDNO: 44 5'-ATACTAAACCGGTACCAT-CGAACAGGAACATCTTACCCATGGC
FR405 SEQ :[D NO: 45 S'-ATACrAAACCGGTACCA-TCGAACAAGAACATCI'rACCCATCiGC
~ ., Ex~ression of 'rrun~at~d T~f PQIYmeraSe Mutein forms of the Taf polyrnerase lacking 5' ~ 3' exonuclease activity were constructed by introducing deletions in the 5 ~ end of the gene. Both 279 and 417 base pair deletions were created using the following protocol; an expression plasrnid was digested with res~iction enzymes ~o excise the desired fragrnent, the fragment ends were repaired with Klenow and all four dNTP' s, to produce blunt ends, and ~he products were ligated to produce a new circular plasmid with the desired deletion. To express a 93 ldlodalton, 5' i 3' exonuclease-deficient form of Ta~f polymerase, a 279 bp deleaon comprising a~no acids 2-93 was g~nerated. To express an 8~ kilodalton, 5' ~ 3' exonuclease-deficient fonn of I a~ polymerase, 417 bp deletion comprising amino acids 2-139 was generated.
To c~eate a plasmid vvith cods ~ns 2-93 deleted, pTaf03 was digested with NcoI
and ~I and the ends were repaired by ~leno~w treatrnent. The digested and repaired plasmid was diluted to S ~lg/rnl and ligated und~ blunt end conditions. The dilute plasmid concenttation favors intratnolecular liga~ions. The ligated plasmid was transformed into DCi116. Mini-screen DNA preparations were subjected to restriction analysis and correct plasmids were confirrned by DNA sequence analysis. The resulting expression vector created bv dele~ng a segment fiom pTaf~3 was designated pTaf09. A sirnilar vector created from pTaf05 was designated pTaflO.
Expression vectors also were c~eated with codons 2-139 deleted. The sarne protocol was used ~,vith the excep~on that the initial restricdon digesdon was performed with ~I and B ~elII. The expression vector created from pTaf03 was designated pTafl 1 and the expression vector created from pTaf05 was designated pTaf 12.

.. , ,' ,~ .

wo 9~/0620~ PCr/~'S91/07076 ,3 ~ 60 ~le ~s~ay~With T7 Pro~
Expression efficiency can be altered by changing the promoter and/or ribosomal binding site (RBS) in an expression vec~or. The T7 genelO promoter and RBS were used to control the expression of Taf DNA polymerase in expression vector pTaf 13~
and the 17 genelO promoter and the gene N RBS were used to con~rol the expression of ~DNA polymerase in expression vec~orpTafl4. The construction of these vectors took advantage of unique restricdon sites present in pTaf~5: an AflII site upstrearn of the promoter, an ~QI site downstrearn of the E~BS, and a ~I site between the promoter and the RBS. The existing promoter was excised from pTaf~5 and replaced with a synthetic 17 gene lO promoter using techniques similar ~o those described in the previous exarnples.
The synthetic insert was created from two overlapping synthetic oligonucleotides. To create pTafl3, equal portions of ~4l4 and FR416 were n~ixed, heated to boiling, and cooled slowly to room temperature. The hybndized oligonucleotides were extended s~,qth Klenow to create a full-length double-stranded insert. The extended fragrnent was then digested with AflII and ~QI, leaving theapprop iate sticky ends. The insert was cloned into plasrnid pTafO5 digested with AflII
and ~ç I. DGl 16 host cells were transfo~ned with the resulting plasmid and transformants screened for the desi~d plasmid.
The same procedure was used in the creation of pTafl4, except ~hat FR414 and FR418 were used, and the extended fragrnent was digested with AllII and ~2EI. This DNA ~agment was substituted for the PL p~moter in plasmid pTafO5 that had been -digested with e~II and ~2EI.
Plasrnids pTaf13 and pTafl4 a~e used to transfonn E. ~ host cells that have been modified lo contain an inducible T7 RNA polymerase gene. However, 'oecause 1-1 RNA polymerase may not recognize the o-toxin re~oregulator terminator sequence present ir ~he plasmid vector, it may be desirable to clone the T7 gene lO terminator sequence into pTaf13 or pTafl4.
The T7 gene lO tem~inator sequence was first cloned into a small, high copy number E. 5~Q~ cloning vector, pUCl9, available as ATCC 37254 (see Yanisch-Perron, et al., 1985, g~33:103-ll9). Synthedc oligonucleotides, HW73 and HW75, were annealed to pro~ide the 17 gene lO tenninator sequence flanked by Hindm sticky ends.
The pUCl9 plasn~id was diges~ed with ~dIIl and ligated witn the HW73/HVV75 duplex. The resulting plasmid, designated pTW66, was transformed into DGlOl and screened for orientation by restnction enzyme digestion and DNA sequence analyses.

.

, . .: . .
'''' ' ' ' : .
.

wo 9~/06~0' 2 ~ ~3 ~ 3 ~ 7 PC~ S91/07076 A secon~ ,c~or was created ~rom pUC19 by inserting the 17 promoter sequence. Synthetic oligonucleo~ides, HW7 l and HW / 2, were annealed to provide the T7 prornoter sequence flanked by ~3~HI sticky ends. ~e pUCl9 plasmid was digested with ~HI and ligated with the HW 71/HW72 duplex. The resulting S plasmid, designated pl'W64, was ~ansforrned into DG lO l and screened for orientation by restriction analyses and sequence analysis.
A 95 bp fragrnent containing the T7 promoter was isolated from pTWo4 by d ~estior with ~RI and ~d~I and separation of the restriction fragrnents by gel electrophoresis. The pTW66 plasmid was digested with EcoRI and HindIII and ligated with the purified ~ragment from the digestion of pl~V64. The resulting vector, designated pTW67, contains both the T7 promoter sequence and gene lO terq~nator sequence.
The T7 gene 10 tern~inator sequence is excised from the pTW67 vector by digestion with XhoI and ~1. l'he vector is also cut with uIl tO reduce background.
The pTafl3 vector is cut with ~I which cleaves at a unique site just downstream of the existing te~ainator. Digestions with ~QI and SalI leave the same sdcky end for ligation. The fragment containing ~he T7 gene lO taminator sequence is ligated with the cleaved pTaf13. The resultdng plasmid, designated pTaf16, is transfo3med into MM294 and screened for onentadon.
The e~ression plasmid pTaf16, which contains the T7 genelO promoter, RBS, and the T7 gene lO teYminator, is hansfolmed into an E. çPli host cell modified to contain an inducibl~ T7 RNApolymerase gene.
Ihe oligonucleotides used in the consl~uction of these vectors are listed below.FR414 SEQ ~ NO:46 5'-TCAGCTTAAGACTTCGAAATTAATA~
CGACTC~CTATAGGr~AGACCACAA-CGGTTTCCCTC
FR416 SEQ ~ NO:47 5'-TCGACCATGGGTATATCTCCTT-CI'TAAAG'rTAAACAAAAl'rATTTC-TAGAGGGAAACCGTTG
FR418 SEQ ~ NO:48 5'-TC~GTCCGGATAAACAAAA-TTAlTICTAGAGGGAAACCGTTG
H~71 SEQ ~ NO:49 5'-GATCACTTCGAAATTAA-TACGACTCACTAT~GGGAGACOG
H~N72 SEQ ~ NO:50 5'-GATCCGGTCTCCCTATAGTGAG-TCGTATTAATTTCGAAGT

, , ,:
- ~ . .

, wo 9Z/0620' P~/l,'S!)1/07fl76 ?~9~ 6~
HW73 SEQ D~ NO: 51 S'-AGICl'TTAAAS:~ATCTAATAACTA-GCATAACCCCTTGGGGCCTCTAAA-CGGGTCTT&AGGGGTTTTTTGCTGA-CTCGAG
S H~75 SEQ ~ NO:52 5'-AGCTCTCGAGTCAGCAA~U~ACCCC-TCAAGACCCGTrTAGAGGCCCCAA-GGGGTTATGCTAGTTATTAGATCTTTAA
~2 :
~nsla~onal C~Quplin~
To effect the ~ansladcn of the Taf polymerase gene, Iransla~ionally coupled denvatives of Taf expression vectors were constructed. An expression vector was constructed with a secondary translation irutiation signal and short coding sequence just upstream of the Taf gene coding sequence such that the stop codon for the short coding sequence is coupled, i.e., overlaps, with the ATG start codon for the Taf gene coding sequence. Transla~on of the short coding sequence brings the ribosome into closeproxirnity with the ~ gene ~ranslation initiation site, thereby enhancing translation of ~ .
the Taf gene.
Translationally coupled Taf expression vectors were constn~cted with the translation initiation signal and first ten codons of the T7 bacteriophage major capsid protein ~gene 10) fused in-f~rne to Ihe last six codons of the E. ~Q~ TrpE gene placed upstrearn of the Taf coding region. The TGA (stop' eoclon for TrpE is "coupled" with the ATG (start) codon for the Taf gene, ~oTming the sequence TGATG as it is coupled wi~h the ATG ~start) codon for TrpD on the E. c~ ehromosome. A one base frarne-shift is requiIed between ~nslation of the shc~ ccding sequence and Iranslation of the ~ coding sequence.
In the example below, a fragsnent eontaining the T7 gene 10-E. coli TrpE/TrpD
fusion product (the last 6 codons and TGA stop codon from ~rpE along wilh the overlapping ATG start cc~on from TrpD) was obtained from a pre-existing plasrnid.
One of ordinary skill will recognize that the T7 gene 10-E. ~ T~pE/TIpD fusion procluct used in the construction of the ~anslationally coupled expression vectors can be construeted from synthetic oligonucleotides. The sequence for the inserted fragment is lis~ed below.
The T7 gene l~E. ~ TrpE/TrpD fusion product was amplified using plasmid pSYC1868 and primers FL48 and FL50. FL52 and FL54 were used to amplify the 5 end of the ~ Pol I gene in pTafO2 from the ATG start codon to the B~III site downstream of the ATG start codon. The prirners FL50 and FL52 were designed to be ' '"'''' i,. ;;~.

wo ~2/0620 2 ~ 9 2 3 1 ~ P~ S91/07076 parually complementary. Consequently, the extension product of FIA8 can hybridize to the extension product of FL54. The two ~nplification products were tnixed, heated to 95C and slowly cooled to room temperanLre to anneal. Hybrids forrned between the extension products of FIA8 and FL54 were extended with ~g polymerase to forn a S full length double-stranded molecule.
The extended insert was amplif~ed with prirners FIA8 and FL54 and then digested with MroI and ~_II. Plasrnid pTaf~3 was diges~ed with ~ I and ~glII, t'nen treated with calf intes~ne allcaline phospha~ase to prevent re-ligation. The digçsted pTafO3 was ligated wi~h the insert. D(}116 host cells were t~ansformed with the 10 ~esulting construct and transformants screened for the desired plasmid DNA. The resultin~ vector was designated pTafl5.
The sequences of the oligonucleotide p~imers and the T7 gene 1~_. coli l~pE/TrpD fusion product (gene 10 insert) are listed below.

15 FIA8 SEQ ID NO: 53 5'-TCCCGACIVl~AAGAAGGAGATATAC .
FLSO SEQ I[) NO: 54 5'-AACATCITACCCATCAG~AAGTCrC~GTGC
FL52 SEQ n:) NO: 55 S'-AGACITrCI GATGGGT~AGATGTI'C
FL54 SEQ ID NO: 56 5'~ AG~TGTAAAAGATCITIATCTCCAG
GenelO inse~t SEQ ID NO: 57 5'-Cl rTAA~IAAGGAGATATACATATGGClAG-CATGACIY3GT(~&ACAGCAAATGCAT(~
GGAGACI ITCIGATG
~Q -Ar~ U tRNA E xpression The pattern of codon usage ditfels between Th~_siphQ africanus and E. ~.
25 In the Taf coding sequence, arginine is most ~equently coded for by the AGA codon, whereas this codon is used in low frequency in E. ~ host cells. The corresponding Arg U tRNA appears in low concentrations in E. coli. The low concentration in the host cell of Arg tRNA using the AGA codon may limit the translation efficiency of the Taf polymerase gene. The efficiency of translation of the Taf coding sequence within 30 an E. çQ~, host may 'oe improved by increasing the concentration of tnis tRNA species by cloning multiple copies of the tRNA gene into the host cell using a second expression vector that contains tne gene for the "Arg U" tRNA.
The Arg U tRNA gene was PCR amplified from E. ~li genomic DNA using the primers DG284 and DG285. The amplification product was digested with SalI and 35 Ba~T~II. TheÇQ~EI cornpatible vectorpACYC184, commercially available from - . , ,:
:
,: , . . .
:: : .

. , , wo 9~/U62~' PCr/l_lS91/07076 ~9~ 3~
New England Biolabs, was digested with Sall and BamHI, and the Arg U gene fragment was subsequently ligated with the digested vector. DG101 cells were ~ansfolmed, and the ligated Yector was designated pARG01. Finally, DG116 host cells were c~transforrned with pARG01 and pTaf~3.
The oligonucleotide pnimers used in this Example are listed below.
imersSEQ ID NO-. Sequ~a~
DG284SEQ ID NO: 58S'-CCiGGC-,ATCCAAAAGCCAl'rGACI'CAGCAAGG
DG285SEQ ID NO: 595'-GGGC3GTCGACGCATG(: GAGGAAAATAGACG

l~le 11 lQ
Recombinant Taf DNA Polymerase can be puri~led from the expression host/vector combina~ions described, for example, E. coli shain DGl 16 containing one of the expression vectors described in Example 4, above, using the following protocol.
The seed flask for a 10 L fennentation contains tryptone (20 gll), yeast ex~act ~ ~ .
15 (10 g/l), NaCI (10 g/l), glucose (10 ~), ampicillin (50 mg/l), and thiamine (10 mg/l).
The seed flask is inoculased with a colony fIom an agar plate (a froæn glycerol culture can be used). Ihe seed flask is grown at 30C So between 0.5 to 2.0 O.D. (A6go). The volume of seed cultu~e inoculated into the fennentor is calculated such that the bacterial concentration is 0.5 mg dry weigh~iter. The 10 liter growth medium contains 25 rnM
20 KH2PO4, 10 mM (NH4)2S04, 4 mM sodium citrate, 0.4 rnM FeCI3, 0.04 mM ZnCl2, ~ ;
0.03 mM CoCI2, 0.03 mM CuCI2, and 0.03 mM H3BO3. The following sterile ~-~
components aIe added: 4 mM MgS04, 20 g/l glucose, 20 mg/l thiamine, and 50 mg/l ampicillin. The pH is adjusted to 6.8 with NaOH and controlled during the ferrnentation by added NH4OH. Glucose is continually added by coupling to NH40H addition.
25 FoaIIung is controlled by the addition of propylene glycol as necessaIy, as an antifoaming agent. Dissolved oxygen concentration is maintained at 40%.
The fermentor is inoculated as described above, and the culture is grown at 30C to a cell density of 0.5 to 1.0 X 1010 cellslrnl (optical density [A6go] of 15). The growth temperature is shifted to between 37C and 41C to induce the synthesis of Taf ;-30 DNA polyrnerase. The ternpeTature shift increases the cvpy nu;nber of the expression plasmid and simultaneously derepresses the lambda PL plomoter controlling transcription of the modified Taf DNA polymerase gene through inactivation of the temperature-sensitive cI repressor encoded by the defective prophage lysogesl in the host.
The cells are grown ~or 6 hours to an optical density of 37 (A6go) and harvestedby centrifugation. The cell mass (ca. 95 g/l) is resuspended in an equivalent volume of ,, wo 9~/n620~ 2 0 9 2 3 :~ 7 PC~ S~I/07~76 buffer containing 50 rnM Tris-CI, pH 7.6, 20 mhl EDTA and 20% (w/v) glycerol. The suspension is slowly dripped into liquid nitrogen to freeze the suspension as "beads" or small pellets. The frozen cells are stored at -70C.
To 200 g of frozen beads (containing 100 g we~ weight cell) is added 100 ml of lX TE (50 mM Tris-CI, pH 7.5, 10 mM EDTA) and Dithiothreitol (Dl-I ) to 0.3 mM, phenylmethanesulfonyl flouride (PIvlSF3 to 2.4 mM, leupeptin to 1 llg/ml and L-1-Chloro-3-[4-tosylamido]-7-amino-2-heptanone-HCI (TLCK) (the latter three are protease inhibitors) to 0.2 mM. The sarnple is thawed on ice and uniforrnly resuspended in a blender at low speed. The cell suspension is Iysed in an Am~ncofrench pressure cell at 20,000 psi. To reduce viscosity, the Iysed cell sarnple is sonica~ed 4 times for 3 min. each at 50% duty cycle and 70% output. 'l~e sonicate is adjusted to 550 rnl with lX TE containing 1 mM Dl-r, 2.4 mM PMSF, 1 llg/ml leupeptin and 0.2 mM TLCK (Fraction I). After addilion of arnmonium sulfate to 0.3 M, the crude Iysate is ~apidly brought to 75C in a boiling water bath and ~ansferred to a 75C water bath for 15 min. to denatuIe and inactivate E. coli host proteins. The heat-treated sample is chilled rapidly to 0C and incubated on ice for 20 min.
Precipitated proteins and cell membranes are removed by cen~ifugation at 20,G00 X G
for 30 min. at 5C and the supematant (Fraction II3 saved The heat-trealed supematant (Fraction Il) is ~aeated with polyethyleneirr~ine (PEI) to rernove most of the DNA and RNA. Polymin P (34.96 ml of 10% [w/v], pH

7.5) is slowly added to 437 ml of Fracdon II at 0C while stirring r~pidly. Af Sr 30 min. at 0C, the sample is centrifuged at 20,000 X G for 30 min. The supernatant~Fraction III) is applied at 80 ml/hr to a 100 ~ml phenylsepharose column (3.2xl2.5 cm) that has been equilibrated in 50 mM TIis-CI, pH 7.5, 0.3 M amrnonium sulfate, 10 rnM
EDTA, and 1 mM DTT. The col~mn is washed with about 200 rnl of the sarne buffer (A2bo to baseline) and then with 150 ml of 50 mM Tlis-CI, pH 7.5, lûO rnM KCI, 10 nM EDTA and 1 mM Dl r. The Ta~DNA polymerase is then eluted from the column with b~lffer containing 50 mM Tris-CI, pH 7.5, 2 M urea, 20% (w/v) ethylene glycol, 10 rnM EDT~, and 1 mM DTT, and fractions containing DNA polymerase activity are pooled (Fraction IV).
Fraction IV is adjusted to a conductivity equivalent to 50 mM KCI in 50 rnM
Tris-CI, pH 7.5, 1 mM EDTA, and 1 mM Dl'r. The sarnple is applied (at 9 mVhr) to a 15 ml heparin-sepharose colurnn that has been equilibrated in the sarne buffer. The column is washed ~,vith the same buffer at ca. 14 ml/hr (3.5 colurnn volumes) and eluted with a 150 ml 0.05 to 0.75 M KCl gradient in the sarne buffer. Fractions containing the Taf DNA polymerase are pooled, concentrated, and diafiltered against 2.5X storage buffer (50 mM Tris-CI, pH 8.0, 250 mM KCI, 0.25 mM EDTA, 2.5 mM

, , " , ~ , , : ~ , wo 9~ 20~ PCT/1~'~91/07076 2o923irl 66 DTT, and 0.5% Tween 20), subsequently mixed with 1.5 volumes of sterile 80% (w/v) glycerol, and stored at -20C.
(:)peionally, the hcpann sepharose-eluted DNA polymerase or the phenyl sepharose-eluted DNA polyrnerase can be dialyzed or adjusted to a conductivity equivalent to 50 mM KCI in 50 mM Tris-Cl, pH 7.5, 1 mM DTT, 1 mM EDTA, and 0.2% Tween 20 and subjected to nucleotide binding protein affinity chromatography.
The polymerase containing extract is applied ( 1 mg protein/ml resin) to an affigel blue column thae has been equilibrated in the same buffer. The column is washed with three to five colurnn volumes of the sarne buffer and eluted ~,vith a 10 column volume KCI
gradient (0.05 to 0.8 M) in the same bu~fer. Fractions con~aining I)NA polymerase activity are pooled, concentrated, diafiltered, and stored as above.
Optionally, the pooled fractions can be subjected to cation exchange chromatography. The fractions are applied to a 2 ml CM-Tns-Acryl M (LKB) column equilibrated with a buffer consisting of 25 mM sodium acetate, 20 mM NaCI, 0.1 mM
EDTA, 1 mM DTT, and 0.2% Tween 20 at pH 5Ø The column is washed with ~5 colurnn volumes of the same buffer and the enzyrne eluted with a linear gradient forrn 20 to 400 rnM NaCI in sodium acetate buffer. Active fractions are pooled, concentrated, diafiltered, and sto~ed as above.

' :: ; , , , ,, ., , " ,. .
,;
. .
,:

, , WO 9~/0~20' 2 ~ PCr/~'S91/07076 ~,'iitS
The following deposit was rnade on the date given.
S~ain D~ositDate LE~
pTafO2 S This deposit was macie under the provisions of the Budapest Treaty on theInternational Recognition of the ~eposit of Microorganisms for the Purposes of Patent Procedure and the Regulations thereunder (Budapest Treaty). This assures maintenance of a viable culture for 30 years from date of deposi~. The organism will be made available bv ~TCC under the te~ns of the Budapest Treaty, and subject to anagreement between Applicants and ATCC, which assures pe~nanent and unrestricted availability of the progeny of ~he cultures to the public upon iSSuAnCe of the pertinent U.S. patent or upon laying open to the public of any U.S. or foreign patent application, whicheYer comes first, and assures availability of the progeny to one determined by the U.S. Commissioner of Patents and Trademarks to be entitled ~hereto according to 35 U.S.C. 122 and the Comrnissioner's rules pursuant thereto (including 37 C.F.R.
1.14 with particular reference to 886 OG 638). The assignee of the present application agrees that if the culture on deposit should die or be lost or des¢oyed when cultivate~ under suitable conditions, it will be promptly replaced on no~lcation with a viable specirnen OI the same culture. Availability of the deposited strain is not to be 20 construed as a license ~ractice ~e in~ention in contravention of the rights granted under the authoriry of any government in accordance with its patent laws.

:

Claims (21)

We Claim

1. A purified thermostable DNA polymerase I enzyme that catalyzes combination of nucleoside triphosphates to form a nucleic acid strand complementary to a nucleic acid template strand, said enzyme derived from the eubacterium Thermosipho africanus.

2. The enzyme of Claim 1 that has reverse transcriptase activity.

3. The enzyme of Claim 1 that has 5'?3' exonuclease activity.

4. The enzyme of Claim 1 that has 3'?5' exonuclease activity.

5. A method for purifying Thermosipho africanus DNA polymerase I, said method comprising the steps of:
(a) preparing a crude cell extract from cells that produce said polymerase;
(b) adjusting the ionic strength of said extract so that said polymerase dissociates from any nucleic acid in said extract; and (c) subjecting the extract to at least one step selected from the group consisting of: hydrophobic interaction, DNA binding protein affinity, nucleotide binding protein affinity, anion exchange, cation exchange, and hydroxyapatite chromatography step.

6. A recombinant DNA consisting essentially of a nucleotide sequence that encodes Taf DNA polymerase I activity.

7. The DNA of Claim 6 that encodes the amino acid sequence from amino to carboxy terminus:

, which is SEQ ID:2.

8. The DNA of Claim 7 that is SEQ ID NO: 3;
5'-

9. A recombinant DNA vector that comprises the DNA sequence of claim 6.

10. The recombinant DNA vector of Claim 9 that is a plasmid selected from the group consisting of pTaf01, pTap02, pTaf03, pTaf04, pTaf05, pTaf06, pTaf07, pTaf08, pTaf13, pTaf14, pTaf15, pTaf16, and pBSM:TafEcoRV.

11. A recombinant DNA consisting essentially of a nucleotide sequence that encodes the amino acid sequence consisting of amino acids 1 and 94 through 892 of SEQ ID NO: 2.

12. A recombinant DNA consisting essentially of a nucleotide sequence that encodes the amino acid sequence consisting of amino acids 1 and 140 through 892 of SEQ ID NO: 2.

13. A recombinant DNA vector that comprises the DNA of Claim 11.

14. A recombinant DNA vector that comprises the DNA of Claim 12.

15. A recombinant DNA vector of Claim 13 that is selected from the group consisting of pTaf09 and pTaf10.

16. A recombinant DNA vector of Claim 14 that is selected from the group consisting of pTaf11 and pTaf12.

17. A recombinant host cell transformed with a vector of Claim 9.

18. The recombinant host cell of Claim 17 that is E. coli.

19. The DNA of Claim 7 which has been mutated to cause the resultant polymerase activity to lack 5'?3' exonuclease activity.

20. The DNA of Claim 19 in which the mutation is a substitution of an Asp codon for the Gly codon at position 37.

21. The DNA of Claim 19 in which the mutation is a deletion up to and including the Gly codon at codon 37.